ID: 1143845417

View in Genome Browser
Species Human (GRCh38)
Location 17:9769709-9769731
Sequence CATCCTGCCTCCACGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143845411_1143845417 -4 Left 1143845411 17:9769690-9769712 CCCCTGAGTTCTGACCCGACATC No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845410_1143845417 13 Left 1143845410 17:9769673-9769695 CCTGCTGCTTCGGTGAGCCCCTG No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845406_1143845417 27 Left 1143845406 17:9769659-9769681 CCAGGCCTGCCTTGCCTGCTGCT No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845408_1143845417 22 Left 1143845408 17:9769664-9769686 CCTGCCTTGCCTGCTGCTTCGGT No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845412_1143845417 -5 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845409_1143845417 18 Left 1143845409 17:9769668-9769690 CCTTGCCTGCTGCTTCGGTGAGC No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845413_1143845417 -6 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143845417 Original CRISPR CATCCTGCCTCCACGGTAGC AGG Intergenic