ID: 1143845425

View in Genome Browser
Species Human (GRCh38)
Location 17:9769739-9769761
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143845411_1143845425 26 Left 1143845411 17:9769690-9769712 CCCCTGAGTTCTGACCCGACATC No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845421_1143845425 0 Left 1143845421 17:9769716-9769738 CCTCCACGGTAGCAGGACGGGAC No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845413_1143845425 24 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845418_1143845425 4 Left 1143845418 17:9769712-9769734 CCTGCCTCCACGGTAGCAGGACG No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845416_1143845425 11 Left 1143845416 17:9769705-9769727 CCGACATCCTGCCTCCACGGTAG No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845415_1143845425 12 Left 1143845415 17:9769704-9769726 CCCGACATCCTGCCTCCACGGTA No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845412_1143845425 25 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845422_1143845425 -3 Left 1143845422 17:9769719-9769741 CCACGGTAGCAGGACGGGACCAC No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143845425 Original CRISPR CACCAGCCTTGTCCTGGAGT AGG Intergenic