ID: 1143849534

View in Genome Browser
Species Human (GRCh38)
Location 17:9799842-9799864
Sequence CTGTTTCTTGAGGTGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143849529_1143849534 28 Left 1143849529 17:9799791-9799813 CCAACTGGGTGTGTATTGCAGCA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG 0: 1
1: 0
2: 1
3: 20
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143849534 Original CRISPR CTGTTTCTTGAGGTGGAGCA CGG Intronic
900039618 1:447460-447482 CTCTTTCCTGAGTTAGAGCAGGG + Intergenic
900061049 1:682436-682458 CTCTTTCCTGAGTTAGAGCAGGG + Intergenic
900566296 1:3333701-3333723 CTGATTTTGGAGGTGGAGCTTGG + Intronic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
902663161 1:17919643-17919665 ATCTTTCTTGAGATGGAGAATGG - Intergenic
905704077 1:40040954-40040976 CGGTCTCTTGAGGTGGGGCCGGG + Intronic
908699045 1:66878408-66878430 CTGATTCTAGAGTTGGTGCATGG - Intronic
909257197 1:73439082-73439104 CTGTTGCTTCAGATGGTGCAAGG + Intergenic
909365240 1:74813033-74813055 CTGTTTCTTGAAGTGGTGGTGGG + Intergenic
915046173 1:153018724-153018746 CTGCTTCTTTAGGTGGAACCTGG + Intergenic
915069045 1:153250443-153250465 CTGGTTCTTGAGGAAGAGTAGGG + Intergenic
916433373 1:164753947-164753969 CTGTTTAGTGTGGTGGAGAAGGG + Intronic
917450702 1:175145260-175145282 CTATTTCTTTAGGCTGAGCATGG + Intronic
918392510 1:184081493-184081515 CTCTTTCTTGAGGTAGATCATGG - Intergenic
918445446 1:184612667-184612689 TTGTTTTTTGAGATGGAGCCTGG - Intronic
918674718 1:187268970-187268992 CTATTTCTTGAGGCAAAGCATGG - Intergenic
919124988 1:193382645-193382667 CTGTTGCCTCAGGTGGTGCATGG + Intergenic
919220651 1:194624803-194624825 CTGCTTCTTTAGGTGGGGCCTGG + Intergenic
920122522 1:203669445-203669467 CTGTTTTTTGAGATGGAGTCTGG + Intronic
921492762 1:215799029-215799051 TGGTTTCCTGAGGTGGAGTACGG + Exonic
922515378 1:226204109-226204131 CTGTGTCATGAGGGAGAGCATGG - Intergenic
922656121 1:227385233-227385255 TTGTTTTTTGAGATGGAGCCTGG - Intergenic
922950546 1:229555307-229555329 CAGGTGCTTGAGGAGGAGCAGGG - Intronic
923107636 1:230867122-230867144 CTGTTTCTTGGGCTAGAGGAAGG - Intronic
924441408 1:244088312-244088334 CTGTTTTTTGTGCTAGAGCAGGG + Intergenic
1063094637 10:2898830-2898852 CTGTTCTTGGAGGTGGAGCCAGG - Intergenic
1063424776 10:5942456-5942478 CTGTTTCTGGAGGTGGGGAAGGG - Intronic
1063610090 10:7554403-7554425 CTGCTTCTGGAGGTGAAGAAAGG + Intergenic
1065986474 10:30958449-30958471 ATTTTGCTTGAGGTGGATCATGG - Intronic
1069630845 10:69896236-69896258 CTGTGTCTTGGGGTGGAGCAAGG - Intronic
1070202720 10:74223188-74223210 CAGATTCCTGAGGTGGTGCAGGG + Intronic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071125626 10:82331735-82331757 CTGTTTATTAAAGTGGACCATGG + Intronic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1071513565 10:86282472-86282494 CTGTTCCCTGAGATGGACCACGG - Intronic
1072494483 10:95942536-95942558 CTTTTTCTTAAGGTGAAGAAGGG - Intergenic
1073288654 10:102402737-102402759 CTCTTGCTGGAGGTGGAGGAAGG - Exonic
1073926388 10:108521173-108521195 CTCTTTCTCAAGGTGGATCATGG + Intergenic
1074186541 10:111103341-111103363 CTGCTTTTTGGGGTGGAGCTGGG + Intergenic
1076282596 10:129261123-129261145 CTGACTCTTGAGATGGAGCTTGG - Intergenic
1076415636 10:130286192-130286214 CTGATCTTTGAGTTGGAGCAAGG - Intergenic
1076944073 10:133632060-133632082 CTGTTCTTTGAGTTGAAGCAAGG + Intergenic
1076965840 11:83372-83394 CTCTTTCCTGAGTTAGAGCAGGG + Intergenic
1077768185 11:5184482-5184504 TTGTTTTTTGAGGTGGCACAGGG + Intronic
1078004638 11:7523314-7523336 CTGTTTCTTGAGGAAGAGCCAGG + Intronic
1078292322 11:10025248-10025270 CAGTTTCTTGAGTTGGATTAAGG - Intronic
1081355486 11:42107391-42107413 CTGTTGCTTGGGCTGGAGTACGG - Intergenic
1081385157 11:42463544-42463566 CTGTTTCTTTAGGTGTAAAATGG - Intergenic
1083303055 11:61748745-61748767 CTGTCCCTTGAGTGGGAGCAGGG - Intergenic
1084043927 11:66558203-66558225 CTGTCTCTTGGGGTGGAGATTGG + Intronic
1084270157 11:68024986-68025008 CTGCTTCTGGAGTTGGAGCAGGG - Intronic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1085938156 11:81175378-81175400 CTGTTTCTTGAATTAAAGCATGG + Intergenic
1088017845 11:105081888-105081910 CTGCTTCTTGAGGTGGGACCGGG + Intronic
1090277610 11:125430959-125430981 CTGCTTCCTGAGATGGGGCAGGG + Intronic
1090366727 11:126212335-126212357 CTTTTTCTTTAGGAGGAGTAGGG - Intronic
1090412210 11:126517054-126517076 TTGTTTTTTGAGATGGAGCCTGG - Intronic
1090429937 11:126637182-126637204 CTATTTTTGGAGGTGGAGAATGG + Intronic
1090694336 11:129222439-129222461 CTGTGTCTTGTAGTGTAGCAGGG - Intronic
1094125969 12:27022655-27022677 CTCTTTCTTGAGGTAAAGCAAGG + Intronic
1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG + Intergenic
1100119806 12:91356312-91356334 CTGTGAGTTGGGGTGGAGCAGGG + Intergenic
1101714538 12:107298985-107299007 CAGTTTCTTGATGTGTAACATGG - Intergenic
1101796132 12:107975856-107975878 CTGACTCTGGAGGTGGAGCTTGG - Intergenic
1102005324 12:109586010-109586032 CTGTGTCTTCAGGTGGACCAAGG + Exonic
1102428005 12:112859703-112859725 CTGTTTCTTAAAGTGTAGCCAGG + Intronic
1105603404 13:21907684-21907706 CTGTTTCTTGCAGAGGAGTATGG + Intergenic
1107827739 13:44344784-44344806 CTGTAGCTTGAGGTTGAGTATGG - Intergenic
1109627205 13:64991650-64991672 GTGTTTCTTGAGGAGGACCCTGG - Intergenic
1111437334 13:88227400-88227422 CTCTTACTTGGGGTGGAGTAGGG + Intergenic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112737256 13:102434748-102434770 TTGGTTCTTGAGGGGTAGCAGGG - Intergenic
1113305736 13:109076593-109076615 GGATTTCTTGAGATGGAGCATGG - Intronic
1115096593 14:29644959-29644981 CAGTTTCTTTAGGTGTAACATGG - Intronic
1115186732 14:30697197-30697219 CTGATTCCAGAGGTGGGGCAGGG + Intronic
1116809361 14:49524441-49524463 TTATTTCTTGTGGTGGGGCATGG - Intergenic
1117351840 14:54888968-54888990 CTGTTTACTGTGGTGGAGGAGGG + Intronic
1117532875 14:56676250-56676272 CTGGTTATTAAGGTGGAGCTTGG + Intronic
1117599725 14:57362829-57362851 CTTATTGTTGAGATGGAGCAGGG - Intergenic
1118161050 14:63290957-63290979 CTTTTTCTTGGGGTGGAAAATGG - Exonic
1119029353 14:71179576-71179598 CTGTTCCTGGAGGGTGAGCAAGG + Intergenic
1119420353 14:74504533-74504555 TTGTTTCTGGAGGTGCAGCTTGG + Intronic
1121455475 14:94036097-94036119 GTATTTCTTCAGGTGGAGAAAGG + Intronic
1122608997 14:102968706-102968728 CTTTGTCTTCAGGTGAAGCAAGG - Exonic
1122861918 14:104586628-104586650 CTGATTCCTGGGGTGGAGGATGG - Intronic
1124391598 15:29263791-29263813 CGGTTTCTTTTGGTGGAGAATGG - Intronic
1124932636 15:34137014-34137036 CCTTTTTTTGAGGTGGAGCCTGG - Intergenic
1127937541 15:63656652-63656674 CTGTTTCTTGATCTGGAGGGCGG - Intronic
1128326672 15:66728416-66728438 TTGTTTTTTGAGGTGGAGTCTGG + Intronic
1130239602 15:82174653-82174675 ATGTTTCTTGAGGTTAACCAAGG + Intronic
1130537350 15:84796966-84796988 CTGTCTCTTGGGGGGGAGCGGGG - Intronic
1130857716 15:87855893-87855915 CAGTTTCTTGAGGCAGAGCCAGG - Intergenic
1131532078 15:93202343-93202365 CTGGTTTTAGGGGTGGAGCAAGG - Intergenic
1132442293 15:101880153-101880175 CTCTTTCCTGAGTTAGAGCAGGG - Intergenic
1134030492 16:10988661-10988683 CTGCCTCTGGAGGTGGAACATGG - Intronic
1136037190 16:27549536-27549558 CTGTTGATTGAGTTGGGGCACGG - Intronic
1136502773 16:30681463-30681485 TTGTTTCTAGAGGTAGAGAACGG + Intergenic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137699574 16:50487257-50487279 CTGTTTCTTGAGCTGGAAGCTGG + Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141927595 16:87179338-87179360 CTGTTTGTGGGGGTGGGGCAGGG - Intronic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1145292935 17:21564133-21564155 TTGTTGCTTGGGGTGGAGCATGG + Intronic
1145376609 17:22355317-22355339 CTGTTTCTTTAGGCCGGGCACGG + Intergenic
1145387032 17:22421799-22421821 TGGTTGCTTGGGGTGGAGCATGG - Intergenic
1146253464 17:31372525-31372547 CTGTTTCTTGATGTAGATGATGG - Intronic
1148634896 17:49141493-49141515 ATGGTACTTGAGGAGGAGCAAGG - Intronic
1149735364 17:58988625-58988647 CTGTTTCTTGAAGTGTAACGGGG - Intronic
1151286364 17:73114432-73114454 CAGAGTCTTGAAGTGGAGCAGGG - Intergenic
1152117058 17:78394843-78394865 CTGTTTCTTCAGGCTGGGCACGG - Intronic
1153683306 18:7521677-7521699 CTGCCTCAAGAGGTGGAGCAAGG - Intergenic
1155302192 18:24440337-24440359 TTGATTCCTGAGTTGGAGCAAGG - Intronic
1155681750 18:28495201-28495223 TTGTTTCGTGAGCTTGAGCATGG - Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156416730 18:36901881-36901903 CTGTTTCTTGAGGAGTTGCCAGG + Intronic
1156937614 18:42729858-42729880 CTGTTTCATGAGCTAGGGCATGG - Intergenic
1158090768 18:53710363-53710385 TTGTTTTTTGAGGGGGAGCATGG + Intergenic
1160642644 19:153002-153024 CTCTTTCCTGAGTTAGAGCAGGG + Intergenic
1162379384 19:10322783-10322805 GTGTTTCGTGAGGTGGGGCAGGG - Intronic
1162487315 19:10969151-10969173 CTGGTTCTTGAGGTAGAGGGTGG - Intronic
1164525963 19:29014044-29014066 CTGTTGCTTCAGGTGGAACGTGG - Intergenic
1164732044 19:30513762-30513784 CTTGTTTTGGAGGTGGAGCAAGG + Intronic
1164876782 19:31696446-31696468 CAGAGTCTTGAGGTGGTGCAGGG + Intergenic
1166791800 19:45403089-45403111 CTGTTTCCTCATGTGGACCATGG + Intronic
1168688290 19:58361848-58361870 ATGTTTCTTAAGGCGGAGCCAGG + Intronic
925798392 2:7571395-7571417 CTGTTTATTTTGGTGGAGGAAGG + Intergenic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
929593983 2:43164429-43164451 CGGTTTCTTTAGGCAGAGCAGGG - Intergenic
930973793 2:57429753-57429775 ATGTTTCTTAATGTGGAGAAAGG + Intergenic
930978057 2:57488647-57488669 CTGTTTCCTCAAGTGGAGGAAGG - Intergenic
931432374 2:62218464-62218486 CTGTTTCCTGAGGTGGGGCTGGG + Intronic
932118200 2:69072967-69072989 GTGTTTCCTTGGGTGGAGCAGGG + Intronic
932670154 2:73730332-73730354 CTCTTTCTTAATGTGGAGAATGG + Intronic
932771965 2:74505512-74505534 AGGTTTCTTGAGGGGGAGAAGGG - Intronic
934722957 2:96594625-96594647 CAGTCTCTGGAGGTGAAGCAGGG - Exonic
934853425 2:97715175-97715197 CTGTACCTTGGGGTGGGGCAGGG - Intronic
934991093 2:98921950-98921972 TTGTTTTTTTAAGTGGAGCAAGG - Intronic
935078817 2:99772084-99772106 TTGTTTTCTGAGGTGGAGGATGG - Intronic
937730981 2:125228884-125228906 CTGTTTCTTGATATGGGGAAAGG - Intergenic
937897558 2:126990099-126990121 TTGTTTCTTGATCTGGTGCATGG + Intergenic
942624651 2:177887014-177887036 CAGTTTCTTGGGGTGAAGCTGGG - Intronic
945588837 2:211702136-211702158 CTGTTGCTTGAGGATAAGCAAGG + Exonic
948498314 2:238370019-238370041 CTGATTCTGGGGCTGGAGCAGGG - Intronic
948877425 2:240837095-240837117 CTGTGTCTGGAGCTGCAGCATGG + Intergenic
1169003596 20:2188110-2188132 TTGTTTCTTAAAGTGGAACATGG + Intergenic
1169245751 20:4023222-4023244 CTCTTTCTGGAGGTGGAAAAAGG - Intergenic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1169641479 20:7757222-7757244 AGGCTTCTTGAGGTGGAACAGGG + Intergenic
1169796659 20:9469873-9469895 ATGTTCCTTGAGGTGGATGATGG - Intronic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1171163776 20:22952938-22952960 CTGCTTCTCGGGGTGGAGCGGGG - Intergenic
1171322356 20:24257660-24257682 TTGTTTCTTTAGGTGGTTCAAGG - Intergenic
1171781432 20:29422174-29422196 CTGTTCTTTGAGTTGAAGCAAGG + Intergenic
1176686362 21:9851714-9851736 TTTTTTTTTGAGGTGGAGCTTGG + Intergenic
1178369317 21:32014138-32014160 CTGATTCTAGGGCTGGAGCAAGG - Intronic
1179246572 21:39638576-39638598 CTGATTCTTCAGGTACAGCAAGG + Intronic
1179432754 21:41335351-41335373 CTGTTGTTGGAGGTGGGGCATGG + Intronic
1179639745 21:42739321-42739343 CTCTGGATTGAGGTGGAGCAGGG + Intronic
1180657992 22:17440580-17440602 CTGTCTCTTGAAGTGAAGCTGGG + Intronic
1181063403 22:20293070-20293092 CTGTCTCCTGAGCTGGAGAACGG + Intergenic
1182078207 22:27509578-27509600 GTGTTTCTCCAGGTGGAGAAGGG - Intergenic
1182764430 22:32748534-32748556 CCTTTTCTTGGAGTGGAGCATGG + Intronic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
949133697 3:536430-536452 CTCTTTCTTGAGGATGAGAAGGG - Intergenic
949325443 3:2858245-2858267 CTTATTCTGGAGGTGGAACAGGG - Intronic
949597226 3:5560855-5560877 CTGTTTCTTGATCTGGAGTCTGG - Intergenic
950453191 3:13077267-13077289 CTGTTTCTTGTAGTGGGTCAGGG - Intergenic
950952018 3:17010439-17010461 ATGTTTCTTGAGGCAGAACAGGG + Exonic
951231774 3:20187353-20187375 CTGTTTCTTGAAGTTGAATAAGG + Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
951600726 3:24371928-24371950 CTGTTTCTTGAGGGAAAACAGGG + Intronic
953224020 3:40999910-40999932 CTGTGTCTGGAGGTGGGGAAGGG - Intergenic
953407041 3:42664699-42664721 CCACTTCTGGAGGTGGAGCAGGG - Exonic
953810391 3:46107802-46107824 CTGTGACTTGAGGTGGAGGATGG + Intergenic
955240588 3:57174582-57174604 ATTTTGCTAGAGGTGGAGCAAGG + Intergenic
956170365 3:66428962-66428984 CTGTTTATTCAGGTGGAGACTGG + Intronic
956618662 3:71198702-71198724 TTTTTTTTTGAGATGGAGCACGG + Intronic
957298787 3:78364300-78364322 CTTTTTTTTAAGGTGGAGAAAGG - Intergenic
958028768 3:88081756-88081778 CTGATTCCAGAGGTGGAACAGGG - Intronic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
960162312 3:114363951-114363973 CTGTATCTTGAATTGGAGGAAGG - Intronic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
961318104 3:126054345-126054367 CTGTACCTTGAGGTGGTCCATGG + Intronic
962715115 3:138119013-138119035 CTATTTCCTGAGGTGTAGGAGGG - Intergenic
963085610 3:141433033-141433055 CTATTTCTTGAGTTTGAACATGG - Intronic
964981264 3:162684198-162684220 CACTTTGTGGAGGTGGAGCAAGG + Intergenic
965948830 3:174278746-174278768 CTGTTTCTTGAGCTGTATCTGGG + Intronic
969062615 4:4449976-4449998 CTGATTCTTAAACTGGAGCAGGG - Intronic
970921436 4:21399854-21399876 CTATTTCTAGACGTGGAGCAGGG + Intronic
971159054 4:24114468-24114490 CTGTCTGGTGAGGTGGAGCAAGG - Intergenic
972305260 4:37824701-37824723 CTGTTTCTTGACCTGGACGATGG - Intergenic
974747227 4:66091449-66091471 CTGTTGCCTCAGGTGGTGCAGGG + Intergenic
975200284 4:71579875-71579897 ATGTTTCTTGAAATAGAGCATGG - Intergenic
975514949 4:75236727-75236749 CTGCTTCCAGAGCTGGAGCAAGG + Intergenic
976093751 4:81485738-81485760 CTGTTGCTTGAAGTGGAGTTTGG + Intronic
976527867 4:86114915-86114937 CTGCTTCTTTAGGTGGAACCTGG - Intronic
976664661 4:87577658-87577680 CAGTTTCTTGAGGCTGGGCACGG - Intergenic
976666157 4:87594902-87594924 TTTTTTCTGGAGGTGGAGGAGGG + Intergenic
976717528 4:88138586-88138608 CAGTTTCTGGAGGTAGAGGAAGG - Intronic
977122573 4:93121265-93121287 CTGTTTCTTGATCTGGATGATGG - Intronic
980989394 4:139726036-139726058 CTGTTTCTTGATGTGGGGGCTGG - Intronic
981219258 4:142212713-142212735 CTGGTTCTTGTGGTGGAGTCAGG - Intronic
983567688 4:169171866-169171888 CTGGATCTAGAGGTGGGGCAGGG + Intronic
984041153 4:174735570-174735592 TTATTTTTTGAGATGGAGCATGG + Intronic
985447429 4:190032517-190032539 CTGTTCTTTGAGTTGAAGCAAGG + Intergenic
985973643 5:3397429-3397451 CTGATTCATGGGGTCGAGCAGGG + Intergenic
986205151 5:5617186-5617208 CTGTCTCTGGAGGTGGAGGCAGG - Intergenic
986500769 5:8397021-8397043 CTGTTTCTTCATGTGGTTCATGG + Intergenic
987844547 5:23265642-23265664 CTCTTTCTTGAAGTTTAGCAAGG - Intergenic
988927634 5:36005557-36005579 CCAGTTTTTGAGGTGGAGCATGG - Intergenic
989108517 5:37885853-37885875 CTGATTTTTTAGGTGCAGCAAGG + Intergenic
989999129 5:50872569-50872591 CTGTTTCTTGAGCTGCAAAACGG - Intergenic
992559801 5:77939801-77939823 TTTTTTCTTGAGATGGAGCCTGG - Intergenic
992933948 5:81681506-81681528 TTTTTTTTTGAGGTGGAGCCTGG - Intronic
993016845 5:82544279-82544301 CAGTGTCTTGAGGCTGAGCAGGG - Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
994007814 5:94860732-94860754 CTGGTTCTTGAGCTGGGGCGGGG + Intronic
996575498 5:124973045-124973067 CTGTCTACTGAGGTGGAGCCTGG + Intergenic
999134073 5:149306203-149306225 CTCTTCCCTGAGGTGGAGCAGGG + Intronic
999780469 5:154845724-154845746 CTGTTTCTTCAGTTGGAAAATGG - Intronic
999851326 5:155542498-155542520 CTGTTTCTTGATCTGGATTATGG - Intergenic
1000253365 5:159515813-159515835 CTGTTTCGTGAAATGCAGCAAGG - Intergenic
1001363167 5:171108217-171108239 TTTTTTCTTGAGGTGGGGGAGGG + Intronic
1001720279 5:173851538-173851560 CTTTTTTTTGACTTGGAGCAAGG + Intergenic
1002734229 5:181371483-181371505 CTCTTTCCTGAGTTAGAGCAGGG - Intergenic
1002750311 6:102642-102664 CTCTTTCCTGAGTTAGAGCAGGG + Intergenic
1003616421 6:7659045-7659067 CAGTGTCCTGAGGTGGTGCAGGG + Intergenic
1003628355 6:7764288-7764310 CTTTTTCTGGAGGTGGTGGAAGG + Intronic
1005307565 6:24528711-24528733 TTTTTTCTTGAGATGGAGGATGG + Intronic
1005908212 6:30284161-30284183 CAGTTTCCTGAGGTTGTGCAGGG + Intergenic
1006003055 6:30981472-30981494 CTGTTGCTAAAGGTGGAGAATGG - Intergenic
1006125452 6:31834969-31834991 CTGTTGAGTGAGGGGGAGCAGGG + Exonic
1006947190 6:37792533-37792555 CTGTATCTTGATGTGGAGGGCGG - Intergenic
1007340532 6:41188499-41188521 CTGTGTCCTGAAGTAGAGCACGG - Intergenic
1009427466 6:63530049-63530071 CTGTTTCTCGAGATAGGGCAAGG + Intronic
1009501734 6:64421943-64421965 ATGTTTCTTGATGGGGAGGATGG - Intronic
1009705143 6:67239641-67239663 CTGTTTCTTTCTGTGGACCATGG + Intergenic
1010292556 6:74154993-74155015 CTGTTTCTTCAGGTGAAGAATGG + Intergenic
1010524198 6:76880333-76880355 CTGTTTCTTCAGGCTGGGCATGG - Intergenic
1011109484 6:83821183-83821205 CTTTTTCTTGTGGTAGAGAAGGG + Intergenic
1012127400 6:95448189-95448211 CTGTTTCTTCAGGTGGTATACGG + Intergenic
1014031029 6:116704623-116704645 CTGTTGCCCAAGGTGGAGCAAGG + Intronic
1015376546 6:132516460-132516482 CTGATTCTAGAGCTGGAGCAGGG - Intergenic
1015666771 6:135639605-135639627 CATTTTTTTGAGGTGGAGTATGG - Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1018428429 6:163703926-163703948 CTGGTGGTGGAGGTGGAGCAAGG - Intergenic
1018482963 6:164210544-164210566 CTACTTCCTGAGGTGTAGCAGGG + Intergenic
1019238479 6:170643798-170643820 CTCTTTCCTGAGTTAGAGCAGGG - Intergenic
1020129292 7:5550501-5550523 CTGTGTCTTGGGATGGATCAGGG - Intronic
1020372821 7:7452960-7452982 TTTTTCCTTGAGGAGGAGCATGG - Intronic
1022097203 7:27148324-27148346 CGAGTTCTTGAGCTGGAGCAAGG + Intronic
1022219578 7:28299420-28299442 CTGTTTCTGGAGGTCCAGTAAGG + Intronic
1023319697 7:38980894-38980916 CTGTGTCCTGAGCTGGATCATGG - Intronic
1023448996 7:40261885-40261907 CTTTTTCTTGAAGAGCAGCATGG + Intronic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1025147895 7:56520805-56520827 CTGTTATTTGAGCAGGAGCAAGG + Intergenic
1027476612 7:78639823-78639845 AAGTTTCTTGAGGGGGAGCCAGG - Intronic
1029890495 7:103924320-103924342 CTGTTCTTTGAGGGGGAGAAAGG + Intronic
1031055691 7:116990958-116990980 CTGTTTCTTGATCTGGGACACGG - Intronic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1033349651 7:140551789-140551811 CTATTTCTAGGCGTGGAGCAAGG - Intronic
1034102012 7:148458139-148458161 CTGTTTATTGAGGTTGGCCAAGG - Intergenic
1034512352 7:151546451-151546473 GTGATTGCTGAGGTGGAGCAAGG + Intergenic
1034933200 7:155180385-155180407 TTGTGTCTTGAGCTGGAGCTGGG + Intergenic
1035509289 8:162809-162831 CTCTTTCCTGAGTTAGAGCAGGG + Intergenic
1036339465 8:7903125-7903147 ATGTGTCTTGAGGCTGAGCAGGG + Intergenic
1036376388 8:8204041-8204063 CTTTTTCTTCAGGTTGGGCAGGG - Intergenic
1036853144 8:12219097-12219119 CTTTTTCTTCAGGTTGGGCAGGG + Intergenic
1036874519 8:12461619-12461641 CTTTTTCTTCAGGTTGGGCAGGG + Intergenic
1037300294 8:17444215-17444237 CTGATTCTAGAGCTGGGGCAAGG - Intergenic
1037313125 8:17577119-17577141 CGGTTTCTTCAGGAGGAACAAGG - Exonic
1037901197 8:22690560-22690582 CTTTTGCTTGAGGTGGATCTTGG + Exonic
1039237812 8:35522070-35522092 ATGTTTGTTGATGGGGAGCATGG - Intronic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041973429 8:63769219-63769241 CTGTCACTTGTGGTGGTGCAGGG - Intergenic
1042152204 8:65799913-65799935 CTGTTTTTTGAGACAGAGCAGGG + Intronic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043201913 8:77381074-77381096 CTGTTTCTTTAGGTGGTTCTAGG - Intergenic
1043474546 8:80593453-80593475 CTGTTTGTTTAGGTGGATGATGG + Intergenic
1044255513 8:90055949-90055971 CTGTTTCTTGACCTGGAGAATGG - Intergenic
1044316155 8:90751666-90751688 TTGTTTGGTGAGGAGGAGCAGGG + Intronic
1044317874 8:90770677-90770699 CTGTGTCTTGCTGTGCAGCAAGG - Intronic
1044899537 8:96929169-96929191 CTGTTTATTGGGGTGGGACAGGG + Intronic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1045518130 8:102879137-102879159 CAGTGTCCTGAGGTGGTGCAGGG - Intronic
1046049703 8:109008657-109008679 CTGTTTATTGAGGTGTGGAAGGG + Intergenic
1046063137 8:109163204-109163226 CTGTTTCTTGATGTGGGTGATGG + Intergenic
1046484064 8:114862083-114862105 CTGGTTCATGAGCTGGTGCATGG + Intergenic
1046737920 8:117796904-117796926 CTGTGTCTTAATGTGGAGCTGGG + Exonic
1047093105 8:121595001-121595023 CTGTTTCTTCTTGTGGAACATGG - Intergenic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1049402343 8:142434041-142434063 CTGTGCCTTCAGGTGGGGCAGGG + Intergenic
1052296017 9:26896585-26896607 ATATTTCTTCAGGTGGACCAAGG + Intergenic
1052301949 9:26962002-26962024 CTGTTTCAAGAGGTGGAGTTGGG + Exonic
1052489621 9:29149309-29149331 TTATTTCTTGAGGTGGAGTTTGG - Intergenic
1054458609 9:65450022-65450044 CTGTTTCCTGCCGTGGAGCTTGG - Intergenic
1056134196 9:83615197-83615219 CTTATTCTTGTGGTGGAGGAAGG - Intergenic
1056527818 9:87459569-87459591 CTATTTCTAGAAGTGCAGCATGG - Intergenic
1056945062 9:90987683-90987705 CTGTTTCTGCAGGTAGAGGAGGG - Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1057757618 9:97850351-97850373 CAGTTTCTTGAGAAGGAACATGG - Intergenic
1060014970 9:120079102-120079124 CCATGTCTTGGGGTGGAGCAGGG + Intergenic
1060036504 9:120260479-120260501 CTGGTACTGAAGGTGGAGCATGG - Intergenic
1060725645 9:126003928-126003950 CTGTTGCCTGAGTTGGAGTATGG + Intergenic
1062758682 9:138324090-138324112 CTCTTTCCTGAGTTAGAGCAGGG - Intergenic
1185686841 X:1936166-1936188 CTGTTTGTTGAGGAAGAACAAGG - Intergenic
1186471825 X:9827747-9827769 CTGTGTGGGGAGGTGGAGCAAGG + Intronic
1188450182 X:30300960-30300982 CTGTTTCCAGGGCTGGAGCAAGG + Intergenic
1189857038 X:45233858-45233880 CTGTTTCTTATTTTGGAGCAAGG + Intergenic
1191194294 X:57704982-57705004 CTGATTCTTGAGGTTTAGGATGG + Intergenic
1192565373 X:72158923-72158945 CAGCGTCCTGAGGTGGAGCAGGG + Intergenic
1192929269 X:75787749-75787771 CTGTTTCTTGAGTGGCATCATGG - Intergenic
1194872631 X:99152229-99152251 CAGTTTCTTAAGCTGGAGCAGGG + Intergenic
1196657138 X:118230067-118230089 CTTTTTTTTGAGGGGGAGGAGGG - Intergenic
1196685164 X:118504445-118504467 GTGGTTCTTGACGTGGAGCATGG - Intronic
1197409547 X:126098363-126098385 CTGTTGCCTGAGGTAGTGCAGGG + Intergenic
1197813622 X:130474047-130474069 CTGTTTCTTTAGTTGCAGTAAGG + Intergenic
1198011252 X:132557161-132557183 TAGTTTCTTTAGGTGGAGAATGG - Intergenic
1198201037 X:134419021-134419043 TTGTTTTTTGAGGAGGAGGAAGG + Intronic
1200324839 X:155225506-155225528 CTTTCTCTTCAGGTGAAGCAGGG + Intronic
1201245035 Y:11995127-11995149 CTGGTTCTTCAGATGGTGCAGGG + Intergenic