ID: 1143850460

View in Genome Browser
Species Human (GRCh38)
Location 17:9807809-9807831
Sequence ACTCCTACCCAGGTTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143850460_1143850467 17 Left 1143850460 17:9807809-9807831 CCTGTCAGAACCTGGGTAGGAGT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1143850467 17:9807849-9807871 TTCCTAAGAAGATCAGAAATTGG 0: 1
1: 0
2: 1
3: 28
4: 273
1143850460_1143850463 -10 Left 1143850460 17:9807809-9807831 CCTGTCAGAACCTGGGTAGGAGT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1143850463 17:9807822-9807844 GGGTAGGAGTCTCCATGGCCTGG 0: 1
1: 0
2: 2
3: 7
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143850460 Original CRISPR ACTCCTACCCAGGTTCTGAC AGG (reversed) Intronic
900145175 1:1156099-1156121 ACTTCCACCCAGGCTCTGCCGGG + Intergenic
901729239 1:11266830-11266852 GCCCCTACCCAAGTGCTGACAGG - Intergenic
902186015 1:14726060-14726082 ACTCCTCCCCAACCTCTGACTGG - Intronic
905036638 1:34923018-34923040 ACTCCTACCCAGGTTGTCTGAGG - Intronic
906590644 1:47021786-47021808 ACTCCCACCCAGGTTCTTGCTGG - Intergenic
907275209 1:53313218-53313240 GATCCTCCCCAGGTTCTGGCAGG + Intronic
922223371 1:223625835-223625857 ACTCTTAACCAGCTTCTGGCTGG + Exonic
922811566 1:228418066-228418088 AGCCCTGCCCAGGTCCTGACTGG + Intergenic
1067969240 10:50950637-50950659 ACTCCTTCCCAGGTTCCTAAAGG - Intergenic
1072043826 10:91634927-91634949 AAACCTGCCCAGGTTCTCACAGG + Intergenic
1076869316 10:133185794-133185816 ACCCCAACCCAGGCTCTCACAGG - Intronic
1084452160 11:69245584-69245606 ACTCCTCCCCAGGTACCAACAGG - Intergenic
1099009057 12:77269804-77269826 ACTCCTGCCCAAGATCTGAATGG - Intergenic
1099816583 12:87656493-87656515 ACAACTACCCAGGTTCTGCTTGG - Intergenic
1100122738 12:91387878-91387900 ACTCCATGCCAGGCTCTGACAGG - Intergenic
1100609188 12:96177111-96177133 ACTCCAAGCCAAGTCCTGACAGG - Intergenic
1101615129 12:106328899-106328921 ACTCCTTCCCGGGATCTGAGTGG - Intronic
1102008760 12:109605533-109605555 ACTCAAACCCAGGCTCTGAATGG + Intergenic
1107085933 13:36428067-36428089 ACTCATACCCAGCTACTGCCTGG + Intergenic
1108533176 13:51346368-51346390 ACTCCTTCCAAGGGTCTGCCTGG + Intronic
1108901806 13:55419890-55419912 AATCCTTCCCCGGTTCTGAAAGG - Intergenic
1115963821 14:38864834-38864856 ACTCCCACCCAGTTTCTGATTGG - Intergenic
1118674906 14:68173488-68173510 AGTCCTACTCAGGATCTGAGAGG + Intronic
1122862893 14:104590378-104590400 CCTCCAGCCCCGGTTCTGACGGG + Intronic
1123403053 15:20005031-20005053 ACTCCTGCACATGCTCTGACCGG - Intergenic
1123512392 15:21011685-21011707 ACTCCTGCACATGCTCTGACCGG - Intergenic
1128055916 15:64700070-64700092 GCTCCTACCCAGGCCCTGGCAGG + Intronic
1130143627 15:81254555-81254577 ACTGCTACCCAGGTAATTACGGG + Intronic
1132862313 16:2077771-2077793 ACTGCCACCCAGGTGCTCACGGG - Intronic
1135761911 16:25144665-25144687 ACTCCCCACCAGGTTCAGACTGG - Intronic
1138657093 16:58497825-58497847 ACCCCTGCCCAGGTCCTGGCAGG - Intronic
1139825077 16:69750593-69750615 ACTCCAGCCCAGGTGATGACAGG + Intronic
1140798586 16:78464082-78464104 AGCCCTTCCCAGGTCCTGACCGG - Intronic
1141063311 16:80894884-80894906 ACTCCTACCCACGTTGCGAGAGG - Intergenic
1141634437 16:85306479-85306501 ACTCCTACCCACAGTCTGAGGGG - Intergenic
1143850460 17:9807809-9807831 ACTCCTACCCAGGTTCTGACAGG - Intronic
1144545043 17:16186553-16186575 AATTTCACCCAGGTTCTGACAGG - Exonic
1144639788 17:16931024-16931046 TCTCATACCTAGGCTCTGACAGG - Intronic
1145797969 17:27666962-27666984 GCTCCTACCTGAGTTCTGACAGG - Intergenic
1145984137 17:29033047-29033069 ACTCCTACCCAGGCTGTGGTTGG + Intronic
1148053783 17:44781695-44781717 ACTCCTCCCTGGGTTCTGCCAGG - Exonic
1149524189 17:57341135-57341157 ACCCCAGCCCTGGTTCTGACTGG - Intronic
1152061261 17:78077270-78077292 AATCCCACCCAGGGCCTGACTGG - Exonic
1153062948 18:1012967-1012989 CCTCCCACACAGGTTCTGCCTGG + Intergenic
1157300380 18:46474746-46474768 ACTCATCTCCAGGTCCTGACAGG + Intergenic
1158867794 18:61654652-61654674 AGCCCTGCCCAGGTTCTGAAGGG + Intergenic
1162732750 19:12728840-12728862 ACTCCTACCCAGCTTAGGGCTGG - Intergenic
1163494449 19:17637799-17637821 GCCCCTACCCAGGTTCTGATAGG - Intronic
1163494477 19:17638063-17638085 GCCCCTACCCAGGTTCTGATAGG - Intronic
1164748086 19:30630695-30630717 ACTGCTACCCAGGCTCAGTCTGG + Intronic
1165145195 19:33726053-33726075 ACTCAGACCCCGGTTCTTACAGG - Intronic
1165850528 19:38847931-38847953 ACTCACACCCAGGTTCAGTCAGG + Intronic
925434168 2:3821413-3821435 ACTCCTACTCAGCATCTCACAGG - Intronic
927042833 2:19246666-19246688 ATTCTTCCCCAGGATCTGACTGG - Intergenic
927082322 2:19642728-19642750 TCACCTCCCCATGTTCTGACTGG + Intergenic
927218010 2:20680680-20680702 ACTCCTTCCCTGGTCCTGTCAGG + Intergenic
928808525 2:35192606-35192628 ACTCCTAGCTAGGTTCAGATGGG + Intergenic
930675134 2:54192537-54192559 ACAACTTCCCAGGTTCTGGCTGG - Intronic
932800362 2:74736811-74736833 ACTGCTTTCCAGGTTCTGAAAGG - Intergenic
937394126 2:121519894-121519916 ACTTCTACACAGGCTCTCACTGG + Intronic
945270877 2:207938698-207938720 ACTCCTTCCCAAGTTCTTAGTGG - Intronic
947496048 2:230637984-230638006 ACTCCTGCCTAGGTGATGACAGG + Intergenic
1169279580 20:4255617-4255639 GCTGCTAGCCAGGTTCTGAGTGG - Intergenic
1171113077 20:22501885-22501907 ACTCTAACCCAGGTTCTTGCAGG - Intergenic
1175991751 20:62793368-62793390 ACCCCTGCCCAGGTTCCCACTGG + Intergenic
1176860859 21:14011008-14011030 GCTCCTCCCCTGGTTCTCACTGG - Intergenic
1177010224 21:15722863-15722885 ACTCCTACCTTGGTTCAAACTGG + Intergenic
1179911397 21:44450808-44450830 ACACCTGGCCAGGTTCCGACTGG - Intergenic
1181087491 22:20448190-20448212 ACCCCAACCCAGGTTCTACCAGG + Intronic
1184205256 22:42998306-42998328 AATCCAAACCAGGTTCAGACTGG - Intronic
949950817 3:9227351-9227373 ACTCTTACCCAGATTTTGAGGGG - Intronic
957229793 3:77498002-77498024 ACTCTTACCCAAGTTCTGAGAGG - Intronic
962302222 3:134252493-134252515 ACTGCTACCAGGGTTCTGCCAGG + Intergenic
962888755 3:139652545-139652567 GCTCATACCCAGGTCCTGAGGGG - Intronic
965353061 3:167639679-167639701 ACTCTAATCCAGGTTCTGAGGGG + Intronic
973076493 4:45934226-45934248 TCTTCTACCCATGTTCTGGCTGG - Intergenic
978860977 4:113448770-113448792 GCTCCTTCCCAGTCTCTGACTGG - Intergenic
984896408 4:184545161-184545183 ACTTCTACCCAGGATCTCAGAGG + Intergenic
985521451 5:375754-375776 ACCCCTCCCCAGCTTCTGAGAGG - Intronic
985748779 5:1662481-1662503 ACTCCCACCCACGTGCTGAGTGG - Intergenic
985879633 5:2628539-2628561 ACTCCTCCCCAGGTACTCGCTGG + Intergenic
997660110 5:135582789-135582811 GCTCCTCCCCAGGGGCTGACAGG + Intergenic
1000429401 5:161133557-161133579 TCTCCTACCCAGGTTTTTAATGG + Intergenic
1001587097 5:172840362-172840384 ACTCCTAGCCAGTTTTTGTCAGG + Intronic
1003551547 6:7106590-7106612 TCTCCTACCGAGGTTCTGAAAGG - Intergenic
1005031298 6:21511620-21511642 ACTCCATCACAGGTTCTGAATGG + Intergenic
1011336411 6:86266313-86266335 TCTTCTACCCAAGTTCTTACTGG + Intergenic
1019806239 7:3128159-3128181 AGTGCTACCGAGGTCCTGACTGG + Intergenic
1020222115 7:6247308-6247330 CCCTCTCCCCAGGTTCTGACTGG + Intronic
1022534080 7:31085025-31085047 TCTCCTGCCCAGGCTCTGCCTGG - Intronic
1029503061 7:100945776-100945798 GCTCCTACCCAGGCTCTGCAGGG + Intergenic
1030069166 7:105684006-105684028 ACTCCTGCCCAGGGGCTGCCAGG + Intronic
1031003919 7:116450753-116450775 AGTGCTACCCAGGATTTGACAGG - Intronic
1033742435 7:144285131-144285153 ACTCCTTCCCTGGTTCTCACAGG - Intergenic
1033751467 7:144364483-144364505 ACTCCTTCCCTGGTTCTCACAGG + Exonic
1037455194 8:19056316-19056338 ATTCAGACCCAGTTTCTGACTGG - Intronic
1037911149 8:22744364-22744386 GCTCCTGTCCAGGCTCTGACCGG - Intronic
1039294520 8:36135328-36135350 GCTCATTCCAAGGTTCTGACAGG - Intergenic
1039296311 8:36159630-36159652 ACTACTACTCTGGTTATGACTGG - Intergenic
1042208216 8:66350183-66350205 ACTCCTTCCCAAGTCCTGATAGG - Intergenic
1044854885 8:96465796-96465818 ACGCCCAGCCAGGTTGTGACTGG - Intergenic
1047770622 8:128027443-128027465 ACTCCTACCCATGCACTGATGGG + Intergenic
1048057783 8:130885059-130885081 TCTCATACCCAGGTTGTGCCTGG - Intronic
1050004941 9:1119932-1119954 ACTCATACCCAGGCTCCCACTGG - Intergenic
1060800047 9:126538249-126538271 TCTCCTACCCAGGTTGGGTCAGG + Intergenic
1061191153 9:129083479-129083501 CATCCTACCCAGGATCAGACTGG - Intronic
1061227871 9:129291207-129291229 ACCCCTAGCCAGGCTCTGGCCGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1186456567 X:9714476-9714498 TCTCCTTCCCAGGGTCAGACTGG - Intronic
1190264103 X:48817314-48817336 GCTGCTTCCCAGGTTCTGAATGG + Exonic
1192528430 X:71867456-71867478 ACACCTACGCAGGTTCTGGTTGG - Intergenic
1200699364 Y:6389033-6389055 AGTCATACCCAGGAGCTGACTGG + Intergenic
1200744629 Y:6893143-6893165 ATTCCAATCCAGGTCCTGACAGG + Intergenic
1201034747 Y:9775665-9775687 AGTCATACCCAGGAGCTGACTGG - Intergenic
1201966964 Y:19748603-19748625 ACTCCTGCCTATGTTCTGAATGG + Intergenic