ID: 1143852250

View in Genome Browser
Species Human (GRCh38)
Location 17:9821800-9821822
Sequence ATTCAGCGGGGGTTCCATGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143852250_1143852260 20 Left 1143852250 17:9821800-9821822 CCCACATGGAACCCCCGCTGAAT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1143852260 17:9821843-9821865 CCCAAATGTACAGGACAGCCTGG 0: 1
1: 1
2: 0
3: 12
4: 116
1143852250_1143852256 11 Left 1143852250 17:9821800-9821822 CCCACATGGAACCCCCGCTGAAT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1143852256 17:9821834-9821856 CACCCAGCTCCCAAATGTACAGG 0: 1
1: 0
2: 0
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143852250 Original CRISPR ATTCAGCGGGGGTTCCATGT GGG (reversed) Exonic
900433513 1:2614372-2614394 GTTCAGCTGGGATCCCATGTAGG - Intronic
901272237 1:7961521-7961543 ATTCGTGGGGGGTACCATGTGGG + Intronic
903857713 1:26346502-26346524 CTTCTGCGGGGCTTCCATCTGGG + Exonic
913404458 1:118474086-118474108 AATCAGCTGAGGTTGCATGTGGG + Intergenic
920433369 1:205932954-205932976 ACTCAGCGGGGGATCCATCCAGG - Exonic
1068309426 10:55259149-55259171 ATACAGCAGGGGTACCATCTGGG - Intronic
1071859566 10:89658474-89658496 ATTCAGAGGGGATTTCATCTGGG - Intergenic
1076325954 10:129623309-129623331 GTTCAGCGGGGATACCAAGTTGG + Intronic
1091219411 11:133921115-133921137 CTTCAGCGAGGGCTCCATCTCGG + Exonic
1104544118 12:129695727-129695749 ATTCAGCAGGGGCTGCATGGAGG + Intronic
1111774270 13:92639812-92639834 CTTCAGCTGGGCTTCGATGTGGG - Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1129204100 15:74025166-74025188 GTTCAGTGGGGGTTAGATGTGGG + Intronic
1129206790 15:74041992-74042014 ATTCATGGGAGGTTCCAAGTTGG + Intronic
1133319986 16:4907378-4907400 ATTCAGCAGACGTTCCTTGTAGG + Intronic
1141771212 16:86090679-86090701 ATCTACCGGGGGCTCCATGTGGG + Intergenic
1143383302 17:6509636-6509658 ATGCAGGGGAGGCTCCATGTTGG - Intronic
1143474460 17:7194765-7194787 AGTCAGCTGGGATTCCAGGTGGG - Intronic
1143852250 17:9821800-9821822 ATTCAGCGGGGGTTCCATGTGGG - Exonic
1148094649 17:45043925-45043947 ATGCACCGGGGGCTCCTTGTGGG - Intronic
1148404731 17:47400769-47400791 ATTCAGAGGGGACTCCATTTAGG + Intronic
1148856568 17:50582211-50582233 ATTCAGGGAGGGCTCCGTGTAGG + Intronic
1148887298 17:50783211-50783233 ATTGAGAGGGGCTCCCATGTTGG - Intergenic
1151134990 17:71937928-71937950 ACTCATCACGGGTTCCATGTTGG + Intergenic
1152432931 17:80259900-80259922 ATTCAGCTGGGGTTCCGCGCCGG + Intergenic
1153761702 18:8337994-8338016 ATTCAGGGGAGGCCCCATGTGGG + Intronic
1160336432 18:78044404-78044426 ATTCAGTGGAGATTCCTTGTTGG - Intergenic
1161016736 19:1987088-1987110 GTTCAGCCAGGGTTCCATGGAGG + Intronic
1167209145 19:48122293-48122315 AGTCAGTGGGGGTTCCGTGCCGG - Intronic
1167389131 19:49182597-49182619 ATTCAGCAGGGCGTCCATGAGGG - Exonic
945830724 2:214781557-214781579 ATTCTTCGGGAGCTCCATGTGGG - Intronic
1172419914 20:34807489-34807511 ATTCAGCAGGATTTCCATGTAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1178617479 21:34146461-34146483 TTTCAGCAGGAGTTCAATGTGGG + Intergenic
955315088 3:57931907-57931929 ATAGAGATGGGGTTCCATGTTGG + Intergenic
961975537 3:131020917-131020939 ATTCAGTTGGATTTCCATGTGGG + Intronic
962076784 3:132090491-132090513 ATTCAGAGTGGGATCCCTGTGGG - Intronic
969919558 4:10524749-10524771 TTTAAGCTGGGGTTCCATGGAGG + Intronic
979758765 4:124374117-124374139 ATCCAGCTGGGGATCCAGGTTGG + Intergenic
993146593 5:84101706-84101728 ATTCAGCTGTGAATCCATGTGGG - Intronic
993502619 5:88680213-88680235 ATTCAACCGGGGTTCCATATGGG - Intergenic
994982013 5:106887670-106887692 ATTGAGAGAGGGTTCAATGTAGG + Intergenic
998006865 5:138662892-138662914 ATCCAGCACGGGTTCCATGCAGG + Intronic
1003427907 6:6009348-6009370 AGTCAGCGGGGGTTCCCTCCCGG - Intergenic
1017928564 6:158932102-158932124 AATCAGAGGGTGTTCCATTTTGG - Intergenic
1018937316 6:168282276-168282298 AATCAGAGGGAGTTCTATGTAGG - Intergenic
1025285194 7:57654911-57654933 TTTCAGCGGCGGTTCCACTTTGG - Intergenic
1026352067 7:69526226-69526248 TTACAGCAGAGGTTCCATGTTGG - Intergenic
1030115148 7:106057282-106057304 AATCAGGGAGGTTTCCATGTGGG + Intergenic
1031575403 7:123410064-123410086 ACTCAGATGGGGTTCCATGGTGG + Intergenic
1035395229 7:158530539-158530561 AGGCGGGGGGGGTTCCATGTGGG + Intronic
1045101976 8:98853878-98853900 ATTCAGTGGGGATAACATGTGGG - Intronic
1060724364 9:125997325-125997347 ATTCAGCACGTGTTCCATGAGGG - Intergenic
1188735445 X:33708387-33708409 TTTCAGTGGTGTTTCCATGTGGG - Intergenic
1189002207 X:36958530-36958552 ATGCTGCGGGGGTTCTCTGTTGG + Intergenic
1194204965 X:91001949-91001971 TTTCATTGGGGGTTCCCTGTAGG - Intergenic
1195427013 X:104745335-104745357 ATTCAGCAGGGGCTCCCTGCAGG - Intronic