ID: 1143852952

View in Genome Browser
Species Human (GRCh38)
Location 17:9826215-9826237
Sequence CAGCAGGACCAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 1, 2: 9, 3: 60, 4: 518}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143852952 Original CRISPR CAGCAGGACCAGAGTGAGGA AGG (reversed) Exonic
900111186 1:1006271-1006293 CAGCAGGACCTGAGACAGGGCGG - Intergenic
900630704 1:3633685-3633707 CAGCAGGACACGAGAGAGGGTGG - Intronic
900682119 1:3922690-3922712 CAAAAGGACCAAAGTGAGGCAGG - Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900912635 1:5612437-5612459 CAGCAGGAACAGTGTGATTAGGG + Intergenic
900934992 1:5759391-5759413 CAGCAGGACCACTGTGCTGAGGG + Intergenic
901195753 1:7438990-7439012 CACCAGGGCCAGAGTGAGCAGGG + Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
902127381 1:14227305-14227327 CAGAAGGAGCACAGTGAGAATGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903076510 1:20772373-20772395 GAGCAGCATCATAGTGAGGATGG - Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
904384077 1:30130282-30130304 CAGCAGGAGCTGGCTGAGGAGGG + Intergenic
904395597 1:30219390-30219412 CAGCAGGACCAAGGTCAGCAAGG + Intergenic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
908478040 1:64508096-64508118 CAGGAGGACAAGAGAGAGAAGGG + Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
914948370 1:152087006-152087028 CAGCAGTCCCACAGAGAGGAAGG - Exonic
914984824 1:152447543-152447565 CAGCACGATAAGTGTGAGGAAGG + Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915287015 1:154859532-154859554 CAGATGGACCAGAATGAGCAAGG + Intronic
915366716 1:155320979-155321001 CAGGAGGACCCTGGTGAGGAGGG + Exonic
917026220 1:170645361-170645383 GAGCAGGGCGAGAGTGAGAAAGG + Intergenic
917043056 1:170827810-170827832 GTGCAGGACTGGAGTGAGGAAGG + Intergenic
917832520 1:178908089-178908111 GAGCATTACCAGAGTGGGGAGGG - Intronic
918379669 1:183941356-183941378 CAGCTGGACGAGTGTGAGGCAGG - Intronic
919579151 1:199349615-199349637 CAGCAGGAAGAGAGTGAAGTGGG - Intergenic
919939504 1:202276541-202276563 CAGCAGGACCCCACTGGGGATGG - Intronic
920249947 1:204616946-204616968 GACAACGACCAGAGTGAGGAAGG - Intergenic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922541095 1:226420530-226420552 CTGCTGGGCCAGTGTGAGGAAGG - Intergenic
922574700 1:226654065-226654087 CAGCCGGACCAGGGTGAGGGAGG + Intronic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
923718608 1:236448252-236448274 CAGCACAGCCAGAGTGAGGAAGG + Intronic
1063112158 10:3046752-3046774 AAGCAGGACATGAGTGGGGAGGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070331047 10:75417577-75417599 CACCTGGCTCAGAGTGAGGAGGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1071087137 10:81876469-81876491 CAGCAGGTCTGCAGTGAGGAGGG - Intronic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072753595 10:98001989-98002011 GAGCAGGGCAAGAATGAGGAAGG + Intronic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074203282 10:111258602-111258624 CAGCGGGGCCAGACTGTGGAGGG - Intergenic
1074287942 10:112115995-112116017 CAGCAGGTCCCCAGTGAGGAGGG - Intergenic
1074338161 10:112599223-112599245 CTGCAAGGCCAGAGTGAGGTAGG + Intronic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075221230 10:120586582-120586604 CAGGAGGACCAGAATGGGAAAGG + Intronic
1075340423 10:121643385-121643407 CAGCAAGGGCAGGGTGAGGATGG - Intergenic
1075532333 10:123240288-123240310 CAGCAGTCCCAGAGTATGGAGGG + Intergenic
1075996243 10:126878517-126878539 CAGCATGTCCAGTCTGAGGAAGG - Intergenic
1076254715 10:129012812-129012834 CAGAAGGACCCCAGTGAAGAGGG + Intergenic
1076316653 10:129546613-129546635 AAGAAGGACCAGAGAGAGAATGG + Intronic
1076336648 10:129711104-129711126 CAGCAGGACAGGCCTGAGGAAGG - Intronic
1076365109 10:129916633-129916655 CAGCAGGGCCAGCGAGAGGCTGG + Intronic
1077102703 11:829224-829246 CAATAGGACCAGAATAAGGAAGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078016062 11:7616063-7616085 CTGCATGACCAGTGTCAGGAAGG + Intronic
1079370552 11:19848440-19848462 GAGGAGGACCAGAGAAAGGAGGG - Intronic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081222836 11:40483217-40483239 CAGCAGGAGCTGACTGAGGCTGG + Intronic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081866926 11:46365292-46365314 CATCAGGAGCAGAGTCAGAAGGG + Intronic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1082904542 11:58292012-58292034 CAGCAGGACCACGGTGAGGTGGG + Intergenic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083621987 11:64053728-64053750 CAGCAGTCCCAGAGAGCGGAAGG - Intronic
1083669773 11:64293115-64293137 CAGCAGGCCCAGAGGGAGCTGGG + Exonic
1084360063 11:68663461-68663483 CAGCAGGGCCAAAGATAGGAAGG + Intergenic
1084459159 11:69286643-69286665 CAGCGTGACGAGAGTGGGGATGG + Intergenic
1084613022 11:70216050-70216072 CAGCTGGATCAGAGAGATGAAGG + Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1089330920 11:117688405-117688427 CAGCAGGACAAGAGTTGGGAAGG + Intronic
1089406687 11:118203353-118203375 CGCCAGGACTAGAGTGAGGCCGG - Intronic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090057100 11:123432718-123432740 CAGCAGGAAAAGAATGAGGTTGG + Intronic
1090157591 11:124458082-124458104 CAGTGGGACCAGAGTCCGGAGGG - Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1091219687 11:133922697-133922719 CAGCCGGACCTGACCGAGGATGG - Exonic
1091356629 11:134942424-134942446 GCGTAGGACTAGAGTGAGGAGGG + Intergenic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1091673748 12:2472208-2472230 CAGCAAGAGAAGAGTGAGAATGG - Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1094773889 12:33698952-33698974 CTTCATGACCAGAGTGATGAAGG + Intergenic
1095402474 12:41830811-41830833 AAGCAAGACCAGAGGGAGGGAGG + Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096452512 12:51756186-51756208 CAGCATGAGCAGGGTGACGAGGG - Intronic
1096862882 12:54542591-54542613 CAGCATGTCCAGGGTCAGGAAGG - Exonic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097017521 12:55997879-55997901 CAGCAGGGCCAAAGTGAGGAGGG - Intronic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1097879159 12:64671417-64671439 CAGAAGGCTCAGAGTGAGTAAGG - Intronic
1100237146 12:92672419-92672441 GAGCAGGACAAGGGGGAGGAGGG + Intergenic
1101718510 12:107331771-107331793 GAGCAGGACGAGGGTGGGGAGGG - Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1103163943 12:118754075-118754097 CAGCATGTCCTGAGTGAGCAGGG + Intergenic
1103424989 12:120825995-120826017 AAGCAGGGCAAGAGTTAGGACGG + Intronic
1103485863 12:121282239-121282261 GAGCAGGAACAAAGTGGGGAAGG + Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104863515 12:131938642-131938664 AACCAAGAGCAGAGTGAGGAAGG - Intronic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1106176745 13:27338231-27338253 TAGTGGGACCAGAGTGAGTAGGG - Intergenic
1106938495 13:34750330-34750352 CTGCAGGACCACAGGGAGGGAGG + Intergenic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107126999 13:36856765-36856787 CAGCAGGTCCAGGGTGAGGCCGG + Intronic
1108026887 13:46187396-46187418 CAGCAGGACCGAACAGAGGAAGG - Intronic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1111046728 13:82823504-82823526 CAGCAGCACCAGACTAAGGGTGG + Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112119520 13:96394431-96394453 ATGCAGGACAGGAGTGAGGATGG - Intronic
1112261613 13:97882673-97882695 GAGCAGGGTCAGGGTGAGGAGGG - Intergenic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1112703094 13:102034712-102034734 GACCAGGACTAGGGTGAGGAGGG - Intronic
1113362706 13:109645674-109645696 CAGAAAGACCTGAGTCAGGAGGG - Intergenic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1116804700 14:49481524-49481546 CAGATGGACCAGGTTGAGGAAGG - Intergenic
1117562709 14:56958610-56958632 CAGGAGGACCAGCCTTAGGAAGG + Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1120758415 14:88265333-88265355 CAGGAGGGCCAGAGAGAGAAGGG + Intronic
1121013638 14:90535522-90535544 CAGCAGGGCAGGCGTGAGGAAGG - Exonic
1121270082 14:92632095-92632117 CGACAGGACCAGACTGAGGTTGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122267850 14:100554965-100554987 GAGCAGGACCAGGCTGAGCAGGG + Intronic
1122307572 14:100775668-100775690 CAGCAGGAGAAGAGTGGGCAGGG - Intergenic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124941285 15:34220904-34220926 CATCAGGACTAGGCTGAGGATGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127267111 15:57371336-57371358 CAGCAGGCCCAGAGTGTGGATGG + Intergenic
1128064447 15:64755685-64755707 CAGCCACACCAGAGTGAGGAGGG + Intronic
1128221276 15:65970374-65970396 CTGCAGGCCGAGGGTGAGGAGGG + Intronic
1128242410 15:66109995-66110017 CAGCAGGACAAGGGTGCAGAGGG + Intronic
1128292639 15:66489858-66489880 CAGCTGGACCACAGTGGGCAGGG - Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1128696090 15:69764030-69764052 GGTCAGTACCAGAGTGAGGAGGG + Intergenic
1129152768 15:73699496-73699518 CTCCTGGACCAGAGTGGGGAAGG - Intronic
1129244610 15:74271807-74271829 CAGGTGGACCTGGGTGAGGAGGG + Intronic
1129701654 15:77771854-77771876 TGCCAGGACCAGAGTCAGGAAGG - Intronic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130965329 15:88693446-88693468 CAGCAGGCCCTGGGTCAGGAAGG - Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1132093038 15:98960926-98960948 CAGCAGGACCAGGGAGACGGAGG - Exonic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1133186930 16:4106585-4106607 CAGCTAGTCCAGAGTCAGGAGGG + Intronic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1133813143 16:9176890-9176912 CAGCAGGATCAGAGCTAGCAAGG - Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135343756 16:21670242-21670264 TATCAGGGCCAGAGTGAGTAGGG - Intergenic
1135507987 16:23055613-23055635 CAGCAGGAACAGACTAAAGATGG + Intergenic
1135856353 16:26014500-26014522 CACCAGGACCTATGTGAGGATGG - Intronic
1135974037 16:27095514-27095536 AACCAGGACTAGAGTGAGGTAGG - Intergenic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1136634435 16:31510647-31510669 CAGCATGTCCTGAGTGGGGAGGG + Intergenic
1137447121 16:48538668-48538690 CAGCAGGACCAGTAAGAGGCCGG - Intergenic
1137579684 16:49626412-49626434 CAGCTCTACCAGACTGAGGAAGG + Intronic
1137595904 16:49723623-49723645 CAATAGTATCAGAGTGAGGAAGG - Intronic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1138246069 16:55468093-55468115 CACCAGGACATCAGTGAGGAAGG - Intronic
1138577635 16:57918552-57918574 CAGCACGACCAGAGTGAAAAAGG + Intronic
1138828560 16:60351369-60351391 CAGCAGTGGCAGGGTGAGGATGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140280521 16:73550410-73550432 CAGTAGGCCCAGTGTGAGGCTGG + Intergenic
1141667340 16:85472676-85472698 CAGCAGGGTCAGACTGAGCAAGG - Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1142058368 16:88014681-88014703 ATGCAGGACCAGTGCGAGGATGG - Intronic
1142272263 16:89096285-89096307 CACCAGGAGCACAGTGTGGAGGG - Intronic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1143190025 17:5034129-5034151 CACCAAGGCCAGAGTTAGGAAGG + Exonic
1143490808 17:7284290-7284312 CAGCAGGACCAGCTGCAGGAGGG - Exonic
1143581721 17:7831478-7831500 CAGAAGGACCACATTGAGGGGGG - Exonic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144304701 17:13957732-13957754 CAACAGGCCCAGAGAGGGGATGG - Intergenic
1144466170 17:15499370-15499392 CAGAAGGGCCAGAGTGAGCCTGG - Intronic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1144673582 17:17146731-17146753 AAGCAGGAAGGGAGTGAGGATGG - Intronic
1145883970 17:28370165-28370187 CAGCAGGGCCAGTATGAGAAGGG + Exonic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145898630 17:28475341-28475363 AGACAGGACCAGAGTCAGGATGG - Intronic
1146017656 17:29246882-29246904 CAGCAGGAGCTGGGTGAGTAAGG + Exonic
1146305266 17:31725549-31725571 CACCAGGACCAGAGAGGAGAAGG + Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1148105932 17:45118871-45118893 CTGGAGGACCAGGGCGAGGAGGG - Exonic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149862730 17:60132640-60132662 CAGGAGCACCAGAGTTAAGAAGG - Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152234922 17:79133626-79133648 CAGCAGGACTTGAGCAAGGATGG - Intronic
1152239282 17:79153111-79153133 CAGCTGGACCAGGGTGAGGCAGG - Intronic
1152256778 17:79244561-79244583 CAGCAAGCCCAGAGTGAGTAGGG - Intronic
1152313564 17:79566378-79566400 CTGCAGGACCATGGTGATGAAGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152367215 17:79863243-79863265 CACCAGGAACAGGGTTAGGATGG - Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1153448157 18:5196806-5196828 CAGCGGGACGAGGGCGAGGAAGG + Intronic
1156599965 18:38594365-38594387 CAACATGACCAGTGTGAGGTAGG - Intergenic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1157710055 18:49843986-49844008 CAGCAGCACCGGGGTGGGGAAGG - Intronic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1159328065 18:66949573-66949595 CAGCAGGACCAGACGGAGTTTGG - Intergenic
1159801067 18:72899740-72899762 CAGCAGTGCCAGAGAGAAGATGG - Intergenic
1160004791 18:75061787-75061809 GAGCAGGACGAGAGTGAGGAGGG - Intronic
1160006917 18:75074850-75074872 CTCCAGGCCAAGAGTGAGGATGG + Intergenic
1160143298 18:76345484-76345506 CAGCAGGACCCTGGTGATGAAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160344950 18:78124698-78124720 CATCAGGACCAGATTCTGGAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160934286 19:1585789-1585811 CAGCAGGGCCAGACTGGGAAGGG + Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161671569 19:5614489-5614511 CAGCAGTACCAGACTGAGAAAGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1162084459 19:8240225-8240247 CAGCAGGGCCAGAATGTAGAGGG + Intronic
1162138517 19:8571158-8571180 TCGCAGGACCTGGGTGAGGAAGG - Intronic
1162373696 19:10293130-10293152 CAGCAGGCCCAGAGCCAGCACGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163737462 19:18990260-18990282 CTGCCTGACCAGGGTGAGGAGGG - Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165060271 19:33201724-33201746 CAGATGGACCAGCGTGGGGAAGG + Intronic
1165135451 19:33665683-33665705 CTGCTGGACCAGGGTGAGGCTGG + Intronic
1165452261 19:35890422-35890444 CAGCTGAACCAGAGTGGGGTTGG + Exonic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1168215590 19:54923028-54923050 GAGCAGAACCAGCGTGAGGCAGG + Intergenic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168724333 19:58572552-58572574 CAGAAGGAACAGCGCGAGGAGGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
926933175 2:18061037-18061059 CAGCAAGTCCACAGTGAGCAAGG - Intronic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
927606273 2:24490195-24490217 CAGCAGGACAGGATTGAGGAAGG + Intergenic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
929502841 2:42504920-42504942 CAGCATGACTGGAGTGAGGCTGG - Intronic
931236106 2:60413713-60413735 CACCAGGACCTGAGTGTGCATGG - Intergenic
931618718 2:64188545-64188567 CAGAAGGACCAAACTGAGGTGGG + Intergenic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933277828 2:80302485-80302507 CACCAGGACCACGATGAGGAAGG + Exonic
933917853 2:87014591-87014613 CAGCAGGACAAAGGTGAAGAGGG + Intronic
934005142 2:87755323-87755345 CAGCAGGACAAAGGTGAAGAGGG - Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934869973 2:97854710-97854732 CAGCCAGACCAGAGTGAGCATGG - Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935768099 2:106389415-106389437 CAGCAGGACAAAGGTGAAGAGGG - Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939642706 2:144660181-144660203 AAGCAGCACAAGAGAGAGGAAGG - Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940243525 2:151589304-151589326 CCGCAGGGCCAGACTAAGGAAGG + Intronic
940244481 2:151599857-151599879 CCGCAGGGCCAGACTAAGGAAGG + Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940996781 2:160158346-160158368 CAGCAGTAACAGAGTGATAAGGG + Intronic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
942059559 2:172215658-172215680 CAGCAGGCCCAGAGCCAGTAAGG - Intergenic
943309459 2:186308602-186308624 CAGCAGGCCCACAGGGTGGAAGG + Intergenic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
944105500 2:196075486-196075508 GGCCAGGACCATAGTGAGGAAGG + Intergenic
944192489 2:197018339-197018361 CAGCTGGAACAGAGTGAGTGAGG - Intronic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
946112979 2:217436504-217436526 CAGCATGGCCTGAGTGAGGGCGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947375362 2:229489812-229489834 CAGCAGGATAAGGATGAGGAAGG + Intronic
947464257 2:230326958-230326980 CTGCAGGACCAGGGAAAGGAGGG - Intergenic
947496746 2:230643264-230643286 CTGCAGGACTAGAGTGGGCAGGG - Intergenic
948080056 2:235198491-235198513 CAGCAGCCCCAGCCTGAGGAGGG - Intergenic
948220779 2:236268011-236268033 CAGCTGACCCAGAGTGGGGAGGG - Intergenic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170018201 20:11806745-11806767 CAGGAGGAAAAGAGTGAGAAGGG - Intergenic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1171126057 20:22603072-22603094 CAGAAGGTCTGGAGTGAGGAGGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175367645 20:58466954-58466976 CACGCGGACCAGAGTGGGGAGGG + Intronic
1175577806 20:60075673-60075695 CAGCAGGACCCAGGTGAGAAGGG - Intergenic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176134340 20:63514655-63514677 CAGCAGGAAGAGAGTGAAGGGGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1176988195 21:15462323-15462345 CAGTAGGTCCTGAGTGGGGAGGG - Intergenic
1178908281 21:36653960-36653982 CAGCAGGCCCAGGCTGGGGAGGG - Intergenic
1179514723 21:41898778-41898800 GAGCAAGCCCAGACTGAGGAAGG + Intronic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1181065687 22:20304829-20304851 CAGCAGGTCCACAGTGCTGAGGG - Intergenic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183827042 22:40396738-40396760 CAGGAGGACCAGAGTGAATGGGG + Intronic
1184047757 22:41982083-41982105 AAGCAGGATCAGAGTGGTGAAGG - Intronic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184387049 22:44182264-44182286 CATCAGGACCAGAGAGGGCAGGG + Intronic
1184637713 22:45848246-45848268 CAGGAGGAAGAGAGTGAGGGTGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185182259 22:49370126-49370148 CCGCATGGCCAGGGTGAGGAAGG + Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
949937345 3:9126209-9126231 GAACAGGACCATTGTGAGGAGGG - Intronic
950494282 3:13324376-13324398 CGGCAGGAGCACTGTGAGGAAGG - Intronic
950627744 3:14260529-14260551 GAGCAGGAGCAGAGAGAGAAGGG + Intergenic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952333694 3:32387021-32387043 CCACAGGAGCTGAGTGAGGAAGG - Intergenic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953140013 3:40220796-40220818 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
953480986 3:43251927-43251949 CAGCAGGAGCAGAGAGAGACTGG - Intergenic
953540898 3:43817219-43817241 GAGCAGGGCCAGGGTGGGGAAGG + Intergenic
954137914 3:48590616-48590638 AACCAGGACCAGAGTGAGGCAGG + Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954787398 3:53104041-53104063 CAGCAGGGCCAGCTTGAGCAGGG + Exonic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
958991625 3:100852616-100852638 CAGCAGGACCAGAAACAGCAGGG + Intronic
960319895 3:116221736-116221758 CTCCAGGGCGAGAGTGAGGATGG - Intronic
961319712 3:126064220-126064242 CCACAGGAGCAGAGTCAGGAGGG - Intronic
961372384 3:126439647-126439669 GGGCAGGTCCACAGTGAGGAAGG + Exonic
961449370 3:126995506-126995528 CAGCAGGACCAGAGCAGGGCTGG - Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
962298377 3:134214583-134214605 CAGCAGGAGTAGAGTAAGAAGGG - Intronic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
963604915 3:147405723-147405745 AGGCAGGACCAGGGTGAGGGAGG + Intronic
963703261 3:148653629-148653651 CACAAGGACAAGAGGGAGGAGGG - Intergenic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966754226 3:183353590-183353612 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967216091 3:187211813-187211835 CAGTAGGACCAGAGTGGTAACGG + Intergenic
967509814 3:190296960-190296982 CAGTAGGACCACAGTCAGAATGG + Intergenic
968360651 3:198144582-198144604 CAGAAGGCCCAGGGAGAGGAGGG + Intergenic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
968883105 4:3311251-3311273 CAGCAGGCCCCGAGCGAGGCAGG - Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969596238 4:8150831-8150853 CAGCAGGACCAGAGAAGGGGAGG + Intronic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
971372418 4:26029307-26029329 CAGCAGGGCCAGCCTGGGGAGGG - Intergenic
971405031 4:26314598-26314620 CAGCAGGACCAAGGCGGGGAAGG - Intronic
972572736 4:40325857-40325879 GGCCAGGACCAGAGTGAGGCAGG + Intergenic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973576251 4:52292335-52292357 CAGCAGGAGCAGAGTCACTAGGG - Intergenic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974368968 4:60989117-60989139 AAGCAGGGCCTGGGTGAGGATGG - Intergenic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
980418801 4:132531525-132531547 CCCCAAGACCAGTGTGAGGAGGG + Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981919125 4:150067741-150067763 GAACAGGACCAGAGGTAGGAAGG + Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
984828698 4:183951352-183951374 GAGCAAGACTAGAGAGAGGAAGG + Intronic
985061277 4:186081836-186081858 CTGCAGGAACCGAGTAAGGAAGG + Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985581444 5:697459-697481 ACGGAGGACCAGAGAGAGGATGG + Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991293904 5:65061021-65061043 CAGCAGGAGAACAGTGTGGATGG + Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
994187466 5:96831193-96831215 GAGCAGGAGAAGAGAGAGGAGGG + Intronic
994300619 5:98142702-98142724 CAGCTGGGACAGAGTGAGCATGG - Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995835970 5:116399846-116399868 CACCAAGACCAGAGTGTGGATGG + Intronic
996552289 5:124743705-124743727 AAGCAGGACAAGAGTCAAGAGGG + Intronic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999279278 5:150354356-150354378 AAGCAGGAACAAAGAGAGGATGG - Intergenic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001702049 5:173713802-173713824 CAGCAGGACCTGTGTGACGTGGG - Intergenic
1001855332 5:175005507-175005529 CAGCAGGAGCGGAGTCAGGCAGG + Intergenic
1002184809 5:177449369-177449391 CAGTAGGACCAGGGTGCCGAGGG - Intronic
1002956857 6:1874014-1874036 CAGACGGACCAGTGGGAGGAAGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003007924 6:2398610-2398632 CTGCAAGACCAGAGTGACGGAGG + Intergenic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1003603582 6:7541170-7541192 GACTAGGACCACAGTGAGGAGGG - Intergenic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1005726770 6:28656928-28656950 CATTAGGAGCAGAGTGGGGACGG + Intergenic
1006054997 6:31377675-31377697 CAGCAGGCCTTGAGTGAGGGAGG - Intergenic
1006514284 6:34537500-34537522 ATGCAGGACCGGAGTGGGGAAGG - Intergenic
1006516875 6:34550181-34550203 CAGCAGGGCAAGAGAGAGGCTGG - Intronic
1006834766 6:36991195-36991217 AAGGAAGACCAGAGTGAGGCTGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1013604199 6:111732828-111732850 CAGCAGGACCACAGGATGGAAGG + Intronic
1014701933 6:124699615-124699637 CAGCAGCAAGAGAGTGGGGAAGG - Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1016642537 6:146365820-146365842 GACGAGGACCAGAGTGAGGCAGG + Intronic
1017328341 6:153166279-153166301 GAGCAGGACAAGAAAGAGGAAGG + Intergenic
1017649646 6:156569064-156569086 CAGCTGGCCCAGAGTCAAGACGG + Intergenic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018128943 6:160709589-160709611 CAGCAGGACAAAGGTGAAGAGGG - Intronic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1019259353 7:72050-72072 CAGAAGGCCCAGGGAGAGGAGGG - Intergenic
1019664351 7:2243957-2243979 CAGCAGGAGCAGAGTGGGTGGGG + Intronic
1020219759 7:6226733-6226755 CAGCAGAACCTGAGCAAGGAAGG + Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1023081974 7:36534341-36534363 CAGCTGGACCTGATTGAGAATGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023521113 7:41050832-41050854 CATCAGGACCACGGTGAGGATGG - Intergenic
1023628404 7:42139084-42139106 CAGCAGGGCCAGGCTGAGGTTGG - Intronic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1023714024 7:43024880-43024902 CAGCAGCAACACAGTGAGTAGGG - Intergenic
1023905086 7:44516267-44516289 CACCAGGACCAGCGTGGGGCAGG + Intronic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026946746 7:74321049-74321071 CAGCAGGAGCAGGGCTAGGAGGG - Intronic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1029519411 7:101050704-101050726 CAGGAGGGCGGGAGTGAGGATGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030338548 7:108351192-108351214 CAGAAGGGCAAGAGAGAGGAGGG - Intronic
1030451588 7:109719534-109719556 CTGCAAGGCCACAGTGAGGATGG + Intergenic
1034049596 7:147968522-147968544 CATCAAGGCAAGAGTGAGGAGGG + Intronic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1037841974 8:22251267-22251289 CATCAGGCCCAGGGTGAGGACGG - Exonic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039845268 8:41321456-41321478 CATGAGGACCACAGTGACGAGGG - Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1042331727 8:67587597-67587619 CAGCAGGCCCAGGGTTAAGAGGG + Intronic
1043383709 8:79728724-79728746 CAGGAGGAAGAGAGTGAGGGGGG - Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048395782 8:134012645-134012667 CAGCAGGAACAGTGTGTGCAGGG + Intergenic
1048926036 8:139272260-139272282 CCACAGGATCACAGTGAGGATGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049179309 8:141212899-141212921 CAGCAGGGGCTGAGTGGGGAGGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049280451 8:141741460-141741482 CAGCTGGAACATAGAGAGGAAGG - Intergenic
1049471250 8:142775928-142775950 CACCAGGATCAGGGTGAGCAGGG + Exonic
1049580837 8:143409854-143409876 CAACAGGTCCAGAGTGCGGCAGG - Intergenic
1049586583 8:143435262-143435284 CAGCAGGAGCAGGGTGGGGGTGG - Intergenic
1049718635 8:144105354-144105376 CAGCAGCCCCAGGGTGAGCAGGG + Intronic
1049818340 8:144618946-144618968 CTGCAGGACGAGGATGAGGACGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050718446 9:8557064-8557086 AAGGAGGACCAGTGAGAGGAAGG + Intronic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1058366044 9:104209590-104209612 TAGCAGGACCCGTGGGAGGAAGG + Intergenic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059404573 9:114092041-114092063 CAGATGGACCTGGGTGAGGAAGG - Intronic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061718874 9:132539187-132539209 CAGTAGGTCCAGACTGACGATGG + Intronic
1062118849 9:134823123-134823145 CAGCAGGGCCTGAGCTAGGACGG - Intronic
1062468904 9:136693644-136693666 GGGCAGGACCTGGGTGAGGAGGG + Intergenic
1062745352 9:138208413-138208435 CAGAAGGCCCAGGGAGAGGAGGG + Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185554850 X:1013107-1013129 CAGCGGGACGTGAGTGTGGATGG + Intergenic
1185570856 X:1133827-1133849 CAGCCTCACCAGAGTGGGGAGGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187797579 X:23021174-23021196 CAGCATGACCAAAGTCAGAATGG + Intergenic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1189494944 X:41500165-41500187 CAGCTGGACTAGGGTGATGATGG - Intergenic
1189592866 X:42534140-42534162 CAGTAGGATCAGGGTGAGGCAGG + Intergenic
1189994968 X:46629382-46629404 CAGCAGGTCCAAAGTGCTGAGGG - Intronic
1190391464 X:49935775-49935797 CAGCAGGACCATAGTGAATGAGG + Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192121923 X:68464554-68464576 CAGCCAGATCAGAGTGAGGAGGG + Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1193591136 X:83390010-83390032 CAGGAGGACCAGAGTGACCTAGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196708884 X:118742169-118742191 CAGCAGGACAAGGGAGAGGAAGG - Intronic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197896140 X:131317592-131317614 TAGCAGGCCAAGAGTGGGGAAGG - Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198634137 X:138676803-138676825 CAGCAGGACCTGAGCGATGGGGG - Intronic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic