ID: 1143854045

View in Genome Browser
Species Human (GRCh38)
Location 17:9835289-9835311
Sequence CCTAATAGGGAGCAGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143854033_1143854045 13 Left 1143854033 17:9835253-9835275 CCCTGACCTCGTGATCCAGAATC 0: 1
1: 0
2: 3
3: 42
4: 666
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152
1143854036_1143854045 7 Left 1143854036 17:9835259-9835281 CCTCGTGATCCAGAATCCTGGCC 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152
1143854034_1143854045 12 Left 1143854034 17:9835254-9835276 CCTGACCTCGTGATCCAGAATCC 0: 1
1: 1
2: 21
3: 1479
4: 27888
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152
1143854037_1143854045 -2 Left 1143854037 17:9835268-9835290 CCAGAATCCTGGCCATTTTAGCC 0: 1
1: 0
2: 2
3: 11
4: 133
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152
1143854038_1143854045 -9 Left 1143854038 17:9835275-9835297 CCTGGCCATTTTAGCCTAATAGG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152
1143854032_1143854045 14 Left 1143854032 17:9835252-9835274 CCCCTGACCTCGTGATCCAGAAT 0: 1
1: 0
2: 2
3: 45
4: 572
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152
1143854031_1143854045 30 Left 1143854031 17:9835236-9835258 CCAGGATGGTCTCGATCCCCTGA 0: 339
1: 53404
2: 64638
3: 99114
4: 183933
Right 1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143854045 Original CRISPR CCTAATAGGGAGCAGATGGT GGG Intronic
902617101 1:17629811-17629833 CCGAAGAGGGAGCCGAAGGTGGG - Intronic
903750675 1:25618363-25618385 CCTTAGAGGGGGCAGTTGGTGGG - Intronic
906670753 1:47652752-47652774 TCAAATAGAGAGCAGATGGAGGG - Intergenic
908508509 1:64829945-64829967 CCTCAGAGGGAACAGATGATAGG - Intronic
912432914 1:109638978-109639000 CCAACAAGGGAGCAGTTGGTGGG - Intergenic
912837249 1:113007372-113007394 CCCATGATGGAGCAGATGGTTGG - Intergenic
913437971 1:118866715-118866737 CTTAAGAGCAAGCAGATGGTGGG + Intergenic
919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG + Intronic
920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG + Exonic
1063239128 10:4150361-4150383 CCTAATAGAGAGCTCAAGGTGGG - Intergenic
1068683622 10:59846588-59846610 CCTAATAGGGGGCACATTGATGG - Intronic
1073150830 10:101310468-101310490 CCTGAGAGGGGGCAGATGGTGGG + Intergenic
1076442246 10:130488000-130488022 CCTAATTGTGATCAGATGGGGGG - Intergenic
1079119604 11:17672454-17672476 TCTGATAGGGCCCAGATGGTGGG + Intergenic
1079533929 11:21487760-21487782 TCTAATAGGTAGCATATAGTTGG - Intronic
1080373186 11:31676123-31676145 GCTAAAATGGAGCAAATGGTGGG - Intronic
1081904347 11:46657780-46657802 CCTAAGAGGGAGCAGAAAGAAGG - Intronic
1081943403 11:46964980-46965002 GTTAGTAGGAAGCAGATGGTTGG + Intronic
1084662444 11:70554079-70554101 CTTTGTGGGGAGCAGATGGTAGG + Intronic
1085822557 11:79808285-79808307 CCTAACAGGGTGCCGAGGGTGGG - Intergenic
1087112740 11:94488783-94488805 CCTACCAGAGAGCAGATGATAGG + Intronic
1087211910 11:95453609-95453631 CCTATTTGGGAGCAGAGGGATGG - Intergenic
1090109623 11:123892303-123892325 CCTTAGAGAGAGCAGATGGCTGG + Intergenic
1092098267 12:5861963-5861985 CCTCAAATGGAGCAGATGGGAGG - Intronic
1093963166 12:25297819-25297841 GCTCACAGGGAGCAGATGATTGG + Intergenic
1094428952 12:30345749-30345771 CCTGATAAGGAGCAACTGGTTGG + Intergenic
1094535628 12:31320232-31320254 CCAAGTTGGGAGCAGCTGGTAGG - Intronic
1095236187 12:39799000-39799022 GATAATGGGGAGAAGATGGTAGG - Intronic
1095570430 12:43677915-43677937 CCTTGTAGGCAGCAGATAGTTGG - Intergenic
1097068557 12:56338378-56338400 CCTAATAGGGGGCATCAGGTAGG + Intronic
1106549002 13:30755367-30755389 CGTAAAAGGGGGCAGAGGGTAGG - Intronic
1107209959 13:37841239-37841261 GCTAATAGGGAAAAGATGGTTGG + Intronic
1107982060 13:45743430-45743452 CCCAAGATGGAGAAGATGGTGGG - Intergenic
1112976609 13:105327231-105327253 GCTATTAGGGAGCAGGTGGCAGG + Intergenic
1114802801 14:25797497-25797519 CCTTATTGGGAGCAGACAGTGGG + Intergenic
1115279479 14:31645378-31645400 TCTAATAGGCAGCATATAGTTGG + Intronic
1117325513 14:54665616-54665638 CCAAATTCAGAGCAGATGGTGGG + Intronic
1117834430 14:59787629-59787651 CCTCATAGGGAGAAAATGGTGGG + Intronic
1118414021 14:65513353-65513375 CCTAAAAGGGAGCTAATTGTGGG + Intronic
1119263232 14:73250504-73250526 CTTTCTAGGGAGCAGAAGGTCGG - Intronic
1119444756 14:74653900-74653922 CCGAATTGGAAGCAGATGTTTGG + Intronic
1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG + Intronic
1120748112 14:88170652-88170674 TCTTGTAGGCAGCAGATGGTTGG - Intergenic
1122202914 14:100133298-100133320 CCTAACTGGAAGCAGATGTTGGG - Intronic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1127278825 15:57471450-57471472 TCCAATAAGGAGCAGAAGGTAGG + Intronic
1128116612 15:65111403-65111425 CCTATTAGGATGCAGATGCTGGG - Intronic
1133543626 16:6783142-6783164 CCTTATAGGCAGCATATAGTTGG + Intronic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1137862441 16:51859985-51860007 ACTAAGAGGCAGTAGATGGTGGG - Intergenic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1144363643 17:14520915-14520937 CCTAATGGAGGGCAGAAGGTGGG - Intergenic
1146501999 17:33372539-33372561 CCAAGTAGGGAGAAGATGCTGGG - Intronic
1148486816 17:47996126-47996148 CCACCTTGGGAGCAGATGGTGGG - Intergenic
1151263859 17:72938444-72938466 CCTAATAAGGAACAGAAGGCTGG - Intronic
1155624682 18:27820842-27820864 ACTAAGAAGGAGCAGATGTTTGG - Intergenic
1156096045 18:33533352-33533374 TCTGAGAGGGAACAGATGGTTGG - Intergenic
1156787179 18:40929509-40929531 CCTAATGGGGAGCAGATCACAGG - Intergenic
1160110954 18:76029919-76029941 CCTAAGAGTGAGAAGATGCTAGG - Intergenic
1162133795 19:8543431-8543453 CCAAATTGGGATCAGAAGGTGGG + Intronic
1162694388 19:12461397-12461419 CCTAATATCAAGCAGATTGTCGG - Intronic
1164471322 19:28536783-28536805 TCTTATAGGTAGCATATGGTTGG - Intergenic
1168374514 19:55865136-55865158 CCTACTTGAGAGCAGAGGGTGGG - Intronic
926524740 2:13964998-13965020 CCTTATAGGTAGCATATAGTTGG + Intergenic
928020066 2:27697426-27697448 CCTAATGTGGAGCCCATGGTGGG + Intergenic
931825398 2:65995268-65995290 ACTAAGAGGAAGGAGATGGTTGG - Intergenic
932564988 2:72900629-72900651 TCTAAAAGGGAGCATCTGGTTGG + Intergenic
936801833 2:116278863-116278885 CCTAAAAGCCAGTAGATGGTGGG - Intergenic
938122525 2:128644072-128644094 CCTGTAATGGAGCAGATGGTAGG + Intergenic
940489450 2:154339080-154339102 CCTAATATGTAGTAGATGCTTGG - Intronic
940767131 2:157801913-157801935 CCTAATATGTAGCACATAGTAGG - Intronic
943276876 2:185878540-185878562 TCTTCTAGGCAGCAGATGGTTGG - Intergenic
943979913 2:194536123-194536145 TCTCATTGGGAGGAGATGGTTGG + Intergenic
1168836028 20:878018-878040 CCAAATGGGGGACAGATGGTAGG + Intronic
1169659148 20:7958898-7958920 CCTAATTGAGAGCATGTGGTTGG + Intergenic
1169771646 20:9207682-9207704 CCTATTGTGGAGCAGATGGTGGG - Intronic
1173351457 20:42249302-42249324 CTTTATAGGGAACAAATGGTAGG + Intronic
1173863530 20:46299424-46299446 GCTAATAGGGTCCTGATGGTGGG + Intronic
1174032400 20:47640462-47640484 CTCAATAGGCAGCAGGTGGTTGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1175202708 20:57289214-57289236 CCTAATAGGTAGCAGACTTTGGG + Intergenic
1175624198 20:60476880-60476902 GCTAAGTGGGAGCAGATGGGAGG + Intergenic
1175923949 20:62462950-62462972 CCTAATAGGATGCAGGAGGTTGG + Intergenic
1177967517 21:27746514-27746536 ATCAATAGGAAGCAGATGGTTGG + Intergenic
1178717512 21:34979845-34979867 CCTAACAGAGAACAGAGGGTAGG + Intronic
1180191489 21:46166511-46166533 TCTTGTAGGCAGCAGATGGTTGG - Intronic
1183273585 22:36877430-36877452 CCTAAAAGGGAGAAGAGGCTGGG - Intronic
1183287592 22:36977243-36977265 TCTGATAGGGAGGAGAGGGTTGG + Intergenic
1184770644 22:46594755-46594777 CCTAGGAGGGAGGAGAGGGTTGG + Intronic
951160185 3:19409595-19409617 CCTAAAAGAGAGCAGATGAATGG - Intronic
952155714 3:30641468-30641490 ACTAATAGGGAGTCGATGGCTGG + Intronic
964893954 3:161571695-161571717 CCTACTTGGGAGCAGAGGCTAGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
967944693 3:194794726-194794748 CCTTGTAGGAAGCATATGGTTGG + Intergenic
969622069 4:8283672-8283694 CCTGATAGGGATCAGACGGCGGG + Intronic
971115441 4:23640867-23640889 CCTAAAAAGAAGCAGCTGGTAGG + Intergenic
973070662 4:45854555-45854577 CCTTGAAGGCAGCAGATGGTTGG + Intergenic
974925244 4:68290707-68290729 CCTATTATGTAGCATATGGTTGG - Intergenic
974976081 4:68893642-68893664 CCTAATAGAGGGTAGAGGGTGGG - Intergenic
976377174 4:84358833-84358855 TTTAGTAGGGAGCAGATGGCTGG + Intergenic
977590738 4:98823814-98823836 TCTTATTGGCAGCAGATGGTTGG + Intergenic
983419442 4:167499490-167499512 CCTATTGGGGAGTGGATGGTGGG - Intergenic
984301242 4:177920948-177920970 TCTTATAGGTAGCATATGGTTGG + Intronic
986288101 5:6375812-6375834 CCTAATACAGAGCAGATGCTGGG - Intronic
988850775 5:35178501-35178523 CATTATAGGGAAGAGATGGTTGG + Intronic
989360345 5:40594731-40594753 TTGAATAGGGAGCAGTTGGTTGG + Intergenic
989475541 5:41869713-41869735 CCAAATAGGGAGGAGAGGATGGG + Intronic
990343215 5:54845677-54845699 CCTAAGTGGGAGAAGAAGGTGGG - Intergenic
993425779 5:87762641-87762663 CCTCATAGGGAGCAAATACTGGG + Intergenic
994253294 5:97562786-97562808 CCTAATACAGAGCAGATAATAGG - Intergenic
995952039 5:117727593-117727615 CCTAATTTGAAGCAGATGTTAGG - Intergenic
996302482 5:122005542-122005564 TCTTATAGGCAGCATATGGTTGG + Intronic
996324393 5:122256278-122256300 TTTTATAGGCAGCAGATGGTTGG + Intergenic
997242762 5:132320034-132320056 CCTAAAAGAGAGCAGAAAGTAGG + Intronic
998238491 5:140421149-140421171 CCGAAGAGGAAGGAGATGGTTGG + Intronic
1000633781 5:163620432-163620454 TCTAATAGGGTGAAGCTGGTTGG + Intergenic
1002210615 5:177596779-177596801 CTTAATACTGAGCAGGTGGTGGG + Intergenic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006694744 6:35921209-35921231 CCTCCTCGGGAGCAGGTGGTAGG - Exonic
1008638419 6:53435857-53435879 CCTAAGACCGAGAAGATGGTTGG + Intergenic
1011354123 6:86456102-86456124 CCTAATAGGGACCAGACTGAAGG - Intergenic
1011507345 6:88060784-88060806 CCTAACAGGGACGAGATAGTAGG - Intronic
1012927556 6:105282837-105282859 CCCCAAAGGGAACAGATGGTCGG + Intronic
1013470897 6:110463356-110463378 TCTTGTAGGTAGCAGATGGTTGG - Intronic
1016662368 6:146596446-146596468 CCTGACATGGAGCAGGTGGTAGG - Intergenic
1021481063 7:21117586-21117608 TCTTACAGGCAGCAGATGGTTGG + Intergenic
1023023489 7:36031302-36031324 CTAAATAGGGAGCACATTGTGGG - Intergenic
1028752061 7:94393617-94393639 CCTAGTAGGGAGTGGAGGGTTGG + Intergenic
1031170638 7:118288480-118288502 TCTATTAGGCAGCACATGGTTGG - Intergenic
1031412272 7:121454301-121454323 TCTTATAGGGAGAAGATAGTTGG + Intergenic
1033478419 7:141713775-141713797 CCTACTATGTAGCAGATGCTGGG - Intronic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1034885021 7:154792678-154792700 CAGTATGGGGAGCAGATGGTGGG + Intronic
1034991076 7:155548536-155548558 CCTGAGAGAGGGCAGATGGTGGG + Intergenic
1035005681 7:155658361-155658383 TCTAATAGGCAGCATATAGTTGG + Intronic
1037715384 8:21393055-21393077 CCTAATAGAGGGAAGCTGGTGGG - Intergenic
1046069767 8:109236173-109236195 CATAATAGGCTACAGATGGTAGG - Intergenic
1046711776 8:117518967-117518989 CTAAATGGGGAACAGATGGTGGG - Intergenic
1047718890 8:127620386-127620408 ACTAATGGGGAGAAGATGGAGGG + Intergenic
1049252632 8:141597359-141597381 CCTAAAGGGGAGCAGAAGGCCGG - Intergenic
1049664254 8:143835962-143835984 CCTACTTGGGAGCAGGTCGTAGG + Exonic
1049742235 8:144246742-144246764 CTGAAAAGGGAGCAGGTGGTGGG + Intronic
1050924874 9:11251459-11251481 TCTAATAGAGAGCATATTGTTGG - Intergenic
1051258352 9:15236048-15236070 ACTTGTAGGCAGCAGATGGTTGG - Intronic
1057371210 9:94475214-94475236 TCTTATAGGCAGCATATGGTTGG - Intergenic
1058634530 9:107023603-107023625 CCTTATAGAGAACAGACGGTGGG + Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1061054388 9:128214740-128214762 ACTCATTTGGAGCAGATGGTGGG - Intronic
1062705549 9:137938488-137938510 TCTTAAAGGGAGCAGATGGTTGG - Intronic
1188244829 X:27827044-27827066 CCTAATAGGTAATAGATTGTGGG + Intergenic
1191616106 X:63171162-63171184 CCTTGAAGGAAGCAGATGGTTGG - Intergenic
1191620191 X:63207761-63207783 CCTTGAAGGAAGCAGATGGTTGG + Intergenic
1191901590 X:66046307-66046329 CCTCATAGGGTGAAGAAGGTAGG + Intergenic
1194986390 X:100494434-100494456 CAAAAAAGGGAGCAGCTGGTGGG + Intergenic
1195443541 X:104923887-104923909 TCTTATAGGTAGCAGGTGGTTGG - Intronic
1195896950 X:109754978-109755000 CCTGGTAGGCAGCAGATAGTTGG - Intergenic
1196098625 X:111825792-111825814 CCAAGTAGGGAGGAGATGGCTGG + Intronic
1197377479 X:125699160-125699182 CCTATTAGAGAGTGGATGGTGGG - Intergenic