ID: 1143858615

View in Genome Browser
Species Human (GRCh38)
Location 17:9871570-9871592
Sequence CTGTCATCTCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143858615_1143858618 9 Left 1143858615 17:9871570-9871592 CCTTCCTCTTTCTGAGATGACAG 0: 1
1: 0
2: 4
3: 18
4: 335
Right 1143858618 17:9871602-9871624 TTCATAGTCAGTCAGATCATAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143858615 Original CRISPR CTGTCATCTCAGAAAGAGGA AGG (reversed) Intronic
901239022 1:7682182-7682204 CTGTCATCTCAGGCAGAGCGGGG + Intronic
902633099 1:17717589-17717611 CTGACATCACAGACAGAGGTGGG - Intergenic
903001406 1:20268694-20268716 CTGTCTTATCATAATGAGGAGGG + Intergenic
903266782 1:22162653-22162675 GTGTCTTCTCAGGAAGGGGATGG + Intergenic
903266887 1:22163078-22163100 GTGTCTTCTCAGGAAGGGGATGG + Intergenic
905006870 1:34716894-34716916 CCTCCATCTCAGAGAGAGGAAGG + Intronic
905766519 1:40606199-40606221 CTGTCATCTCAGCATGAGGCAGG + Intergenic
907427930 1:54392800-54392822 CTTTCATTCCAGAAAGGGGAAGG + Intronic
907856717 1:58310917-58310939 CTGTCATCTCTGCTAGATGAAGG - Intronic
908421676 1:63964619-63964641 CTATCACCTCAGAATTAGGAAGG - Intronic
909516630 1:76515249-76515271 CTGACATCACAGAAATACGAAGG - Intronic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
914920871 1:151846821-151846843 GTGTCATCTCAGCGGGAGGAAGG - Intergenic
915141182 1:153769586-153769608 CTGCCATCTCTGAAGGATGAAGG - Intronic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915970401 1:160351148-160351170 CTTACATCCCAGAAGGAGGAGGG - Intronic
916511948 1:165480112-165480134 CTGCCATCAGAGGAAGAGGAAGG - Intergenic
916888174 1:169090695-169090717 CGGTCAACTTAAAAAGAGGAAGG + Intergenic
917510916 1:175668605-175668627 CTGGCATCTCAAAAAGAGTCAGG + Intronic
917587807 1:176445721-176445743 CTGTCATCATGGAAAGAGGGTGG - Intergenic
917688987 1:177448287-177448309 CTGTCACTTCCGACAGAGGATGG + Intergenic
918905747 1:190490559-190490581 GTGTCATTTTAGAAAGAGAAGGG - Intergenic
919260901 1:195192006-195192028 CTGGCATCCCTGAAAGAGAAGGG + Intergenic
920368477 1:205461524-205461546 CTGTCATCCAGGAAAGTGGACGG - Intergenic
920638512 1:207728669-207728691 CTTTCCTCACAGAAAGAGAAGGG + Intronic
921240287 1:213173637-213173659 CTGTGGTCTCAGAAAGATGTGGG - Intronic
921717850 1:218436683-218436705 ATGTGGTCTCAGTAAGAGGAGGG + Intronic
921787503 1:219248337-219248359 CTCTCATCTCACAAAGAGCCAGG - Intergenic
922349094 1:224721288-224721310 CTCTCCTCTCAGAATAAGGAGGG - Intronic
922536948 1:226388367-226388389 CTGTCATCCCAGTATGAGGCTGG + Intronic
923849567 1:237778787-237778809 TTGTCATTTAAGAGAGAGGAAGG - Intronic
1062962037 10:1579692-1579714 TTATCATGTGAGAAAGAGGAAGG + Intronic
1064498363 10:15940004-15940026 CTTTCATCTGGGAAGGAGGAGGG + Intergenic
1064728982 10:18309823-18309845 CAGTCACCTGAGAATGAGGAAGG + Intronic
1065993960 10:31039143-31039165 CAGTCATGGCAGAAAGAGAAGGG + Intergenic
1066599664 10:37091366-37091388 CTGTCATTACATACAGAGGAGGG + Intergenic
1066694044 10:38062121-38062143 CTCACATGTCAGAAAGGGGAGGG - Intronic
1067470147 10:46530674-46530696 CTGTTGTCTCAGAATGCGGATGG - Intergenic
1067734119 10:48835999-48836021 GTTTCATCTCAGCAAAAGGAGGG - Intronic
1068339144 10:55678386-55678408 AGGTCACCTCAGAAGGAGGAAGG + Intergenic
1069087921 10:64163221-64163243 CTGTCATGTCAGACAGACCAAGG - Intergenic
1069589612 10:69633809-69633831 CTGGCATCTCAGAGTGAGGCTGG - Intergenic
1069772672 10:70909620-70909642 CTGTGATCTCAGAAAGACATGGG - Intergenic
1070987691 10:80702406-80702428 CCAGCAGCTCAGAAAGAGGAAGG - Intergenic
1071429364 10:85594423-85594445 TTGTCAGCTGAGACAGAGGAAGG - Intergenic
1071995831 10:91148332-91148354 CTGTCATCTCAGGAACTTGAAGG + Intergenic
1074006275 10:109427709-109427731 CTGTTATCTTATACAGAGGATGG - Intergenic
1074279438 10:112037051-112037073 CAGTCATCTAAGCAAGAGTAAGG - Intergenic
1076350010 10:129809233-129809255 CTTTCCTCTCAGAAAGTGTATGG + Intergenic
1077608891 11:3631717-3631739 TGGTCATCTAAGACAGAGGAAGG - Intergenic
1078712129 11:13803622-13803644 CTGTAATCTCACACAGTGGAAGG - Intergenic
1078884345 11:15485107-15485129 TTGTCCTCCCAGGAAGAGGAAGG + Intergenic
1079140167 11:17803355-17803377 CCTTCATCTCAGAAAGCAGAGGG - Intronic
1079549772 11:21680460-21680482 ATGTCAGCTCAGTAAGAGCAGGG + Intergenic
1079633763 11:22710697-22710719 AAGACTTCTCAGAAAGAGGAAGG - Intronic
1080208428 11:29756883-29756905 CTGCCAACTCAGAAAGGGGCAGG + Intergenic
1080456541 11:32424726-32424748 CTGTCACCTGAGAGAAAGGAGGG + Intronic
1083706507 11:64520079-64520101 AAGTCATCTCATAAAGAGGTTGG + Intergenic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1085654896 11:78304988-78305010 CTGTCCTCCCAGAGAGAGTAAGG - Intronic
1086922262 11:92601035-92601057 ATGTCATCAGAGAAGGAGGAAGG + Intronic
1087629267 11:100631474-100631496 GTGGCATTTCAGAAAGGGGAGGG - Intergenic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1089307918 11:117538389-117538411 ATGTCATCTCAGGAAGATGAAGG + Intronic
1089782936 11:120886798-120886820 CTGTTTTCTCACAAAGAGCAAGG + Intronic
1090255431 11:125280528-125280550 CAGTCTACTCAGAAAGAGAATGG + Intronic
1090875268 11:130783461-130783483 CTGCCATTTAAGAAAGAGGTGGG + Intergenic
1092907313 12:13113512-13113534 CTGTTACCTTAGAAAGATGATGG + Intronic
1094072138 12:26429161-26429183 CTAACATCTCAGAAATAGGCAGG + Intronic
1097340541 12:58432575-58432597 TTGTCAGCTCAGAAAAATGATGG + Intergenic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1099049875 12:77768755-77768777 CTGCAATCTCAGAATGAGGTAGG + Intergenic
1101221541 12:102646534-102646556 CTGTGATCTGATAAAGAGTATGG + Intergenic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1102370684 12:112381035-112381057 ATGTCATCCCACAAAGTGGAAGG + Intronic
1103359679 12:120346323-120346345 CTGGCAACCCAGAAAGAAGACGG + Intronic
1103532943 12:121615043-121615065 CTGTCATAGCACCAAGAGGATGG + Intergenic
1104231014 12:126884035-126884057 CTGCCAGCTCAGACACAGGAAGG - Intergenic
1104768856 12:131347351-131347373 CATTCATTTCAGAAAGTGGAGGG - Intergenic
1105752230 13:23432043-23432065 GTGTCATCTCTGACACAGGAGGG + Intronic
1105821379 13:24084070-24084092 CCTTCTTCTCAGAAAGAGAAAGG + Intronic
1106188403 13:27428355-27428377 CTGTCATTCCAGCCAGAGGAAGG - Intronic
1106367412 13:29095402-29095424 CTGTCAACCCAGAATGAAGAGGG - Intronic
1106907784 13:34426936-34426958 CTGAGATTTCAGAAAGAAGAAGG - Intergenic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1109585621 13:64398627-64398649 TTGGCATCTGAGAAAGAGAATGG + Intergenic
1109831592 13:67798184-67798206 TTGTCTTCTCCCAAAGAGGAAGG + Intergenic
1110670373 13:78169784-78169806 CTGCCATCTCAGAAGGAGTGGGG + Intergenic
1110678013 13:78273362-78273384 CTGGTAGTTCAGAAAGAGGATGG - Intergenic
1111408734 13:87845774-87845796 CTGTCATCTCACAAGGCAGAGGG - Intergenic
1111668443 13:91299211-91299233 GTGTCATCAAAGAAAAAGGATGG - Intergenic
1113555180 13:111228134-111228156 CTGGCATCCAAAAAAGAGGAGGG + Intronic
1115283900 14:31696270-31696292 CTGTCATCTTTGGAAGAGGAAGG + Intronic
1116767222 14:49087360-49087382 AGGTCCTCTCATAAAGAGGATGG - Intergenic
1117839456 14:59844045-59844067 CTGTATTCTCACAAAGAGGCAGG - Intronic
1117904501 14:60570062-60570084 CTTTCATCTCTCAGAGAGGAAGG - Intergenic
1118050512 14:62021367-62021389 CCTACATCTGAGAAAGAGGAAGG - Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1121477018 14:94218210-94218232 TCGGCATCTCAGAAAGAGAAAGG + Intronic
1121735382 14:96214354-96214376 CTGTCATTCCTGAGAGAGGACGG + Intronic
1123189258 14:106552098-106552120 CAGTCATCACAGAAAGTGAAGGG - Intergenic
1123228398 15:17073734-17073756 GTTTCATCTCACAAAGATGAAGG - Intergenic
1124076936 15:26455089-26455111 CAGTCATCTCAGAGAGTGCAGGG - Intergenic
1124340648 15:28887339-28887361 CTGTCCTTTCTCAAAGAGGAAGG - Intronic
1124514901 15:30359129-30359151 TTATAATCTCAGAATGAGGAAGG + Intergenic
1124722154 15:32119785-32119807 CTGACATCTCAGCAAGAGGAAGG + Intronic
1124728021 15:32171633-32171655 TTATAATCTCAGAATGAGGAAGG - Intronic
1124880770 15:33640470-33640492 CTGACATCTTAGAGAGAGGGAGG - Intronic
1124966441 15:34436268-34436290 CTGTCCTTTCTGAAACAGGAAGG + Intronic
1126361260 15:47848327-47848349 CTGTCTTCTCAGAATTAGGAAGG + Intergenic
1127351548 15:58157854-58157876 CAGTCATCTCTGAGAAAGGAAGG + Intronic
1127579638 15:60326238-60326260 ATGTCATCTCAGAAGGTGGGAGG + Intergenic
1128418416 15:67467941-67467963 GTCTCATCTCAGAAACAGGTGGG + Intronic
1128965132 15:72051337-72051359 CTGTCAACTCAGAAGGTGGCAGG - Intronic
1129294932 15:74594992-74595014 CTTCCCTCTCAGAATGAGGAAGG + Intronic
1129303661 15:74642344-74642366 CTGACATTTCAGAAAGAGGTGGG - Intronic
1129782155 15:78279688-78279710 CTGTCACCCCACAAAGAGGCAGG + Intronic
1130024827 15:80261999-80262021 CTGTCACCTTCTAAAGAGGAAGG + Intergenic
1130448952 15:84031415-84031437 CTGTGATGACAGAAAGAGGTAGG + Exonic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1132620360 16:863822-863844 CTGAGATTTTAGAAAGAGGAAGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133700755 16:8306266-8306288 CTGTCATCTAAGAAGCAGAAAGG + Intergenic
1134374092 16:13654078-13654100 CTGTCATCTAAGAAAATGCAAGG - Intergenic
1137901236 16:52271564-52271586 ATGACATCACAGAAGGAGGATGG + Intergenic
1138136526 16:54528141-54528163 CTCTCATCTCAGAAAAGGGGAGG + Intergenic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1138733149 16:59218538-59218560 CTGTCACCTAAGAAAAATGATGG + Intergenic
1140809772 16:78566122-78566144 CTCTCATGGCAGAGAGAGGAAGG + Intronic
1140826439 16:78711048-78711070 CAGGCATCTTAGAAAGTGGAGGG + Intronic
1143068606 17:4269998-4270020 ATGACATCTCCGACAGAGGAAGG + Exonic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1144016919 17:11204981-11205003 CTGGTATTTCAGAAAGTGGATGG - Intergenic
1144263950 17:13550282-13550304 CTGTGTTCTCAGGAAGAAGAGGG - Intronic
1148484010 17:47978921-47978943 CTGTCATCTCTGGAAGATGCAGG + Intronic
1149226023 17:54472241-54472263 GTGTGATCTCCCAAAGAGGATGG + Intergenic
1149538556 17:57451546-57451568 CTCTGCTCTCAGAAAAAGGATGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1151726891 17:75890654-75890676 CTGTTAACTCAGAAAGAGATGGG - Exonic
1152567747 17:81107714-81107736 CTGTTATCTCGGAAAAAGGTGGG - Intronic
1154236709 18:12612724-12612746 ATGTCATCTCAGTTAGAGGCAGG - Intronic
1155208902 18:23584610-23584632 CTGTAATCCCCAAAAGAGGAGGG + Intronic
1155792638 18:29993706-29993728 CTGACATGTTAGAAAGTGGAGGG + Intergenic
1156345717 18:36255549-36255571 CTTTCCTCTGTGAAAGAGGAAGG + Intronic
1156388377 18:36626916-36626938 CTGTTATCCCAGGAGGAGGAGGG + Intronic
1158163580 18:54513949-54513971 ATTTCATCTCAGAAAGAGCTTGG + Intergenic
1158819475 18:61142587-61142609 ATGTCATGGTAGAAAGAGGATGG + Intergenic
1160008175 18:75083773-75083795 AAGTCCTCTCAGAAAGAGGGAGG - Intergenic
1160058286 18:75507018-75507040 CAGTCATCCCTGAGAGAGGAAGG + Intergenic
1164562792 19:29304402-29304424 CTGACATCTCTTAAAGTGGAGGG - Intergenic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1165956277 19:39503785-39503807 CTGTGCTCTTGGAAAGAGGATGG - Intronic
1167255893 19:48428483-48428505 CTGTAATCTCAGCTACAGGAGGG - Intronic
1167472337 19:49682258-49682280 CGGTGAGCCCAGAAAGAGGATGG + Exonic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
1167771548 19:51523370-51523392 CTGGGATCCCAGAAAGGGGAAGG + Intronic
1168187674 19:54710053-54710075 GTGTCAGCTCAGAACGAGGTGGG + Intergenic
926045852 2:9709049-9709071 AAGTCATTTCAGAAAGAGGGAGG + Intergenic
926348354 2:11970586-11970608 CATTCATCTCAGTAAGAAGAGGG - Intergenic
926986142 2:18626237-18626259 CTAACATCTCAGAAATAGGAAGG + Intergenic
927225625 2:20763288-20763310 CTGACATCACAGAAAGACCAAGG + Intronic
928115568 2:28543247-28543269 CTGGCATCTCTGGAATAGGATGG + Exonic
928392624 2:30921063-30921085 CTGTCATGTGAAAAAGGGGAGGG - Intronic
929969825 2:46564501-46564523 CTGCCATCTGAGGACGAGGATGG - Intronic
930216433 2:48701941-48701963 CTGTCATCTCACTAAGGGCAAGG + Intronic
930337012 2:50060798-50060820 CATTCATGTCAGAAAGACGAAGG - Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930509001 2:52321202-52321224 ATGGCATCTAAGAAAAAGGAAGG - Intergenic
931219107 2:60273305-60273327 ATGTCATCACAGAATGGGGACGG - Intergenic
933254391 2:80064151-80064173 ATGTCAGCTTAGAATGAGGAAGG - Intronic
936614215 2:114032430-114032452 CTGACTTCTCAGAAATTGGATGG + Intergenic
937129037 2:119493422-119493444 CTGTCATCTAAGGATAAGGAGGG - Intronic
937259986 2:120579181-120579203 TTGTCATCTCAAAGGGAGGAAGG + Intergenic
937921299 2:127133467-127133489 CAGTCCCATCAGAAAGAGGAGGG + Intergenic
938069611 2:128301374-128301396 CTGTCATTGCAGACACAGGAAGG - Intronic
938639420 2:133264841-133264863 CTGCCATCCCAGAAAAGGGAAGG + Intronic
940246927 2:151628952-151628974 CTGCCATCTCTGAAAGAGGTGGG - Intronic
941548841 2:166889277-166889299 CTGTCATCTCTGAGATAGAAAGG - Intronic
942215000 2:173710174-173710196 CTGTGATATCAGTAAGAGAATGG - Intergenic
942603741 2:177668070-177668092 CTGTCTTCTCACAAAGACTACGG - Intronic
943588013 2:189763171-189763193 CTTTCATCGGAGAAATAGGATGG + Intronic
943752715 2:191526279-191526301 CAGTCATCACAGAAAGAGGAAGG - Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946195407 2:218029932-218029954 CTCTCATCTCACAGAGAGGGTGG - Intergenic
947254623 2:228148396-228148418 CAGTCATCTAAGATAGAAGAAGG + Intronic
947464064 2:230325967-230325989 CAGCCATCTCAGCAAGGGGAAGG - Intergenic
948465023 2:238148155-238148177 CAGGCCTCTCACAAAGAGGAGGG + Intronic
1169815533 20:9652239-9652261 ATGACATCTCAGAAAGGGGATGG - Intronic
1170976050 20:21165709-21165731 CTGTCATGTGACAAAGATGAAGG + Intronic
1172601871 20:36189631-36189653 CTGTCATCTAAGGAAGAGCAGGG - Intronic
1172874912 20:38158362-38158384 CTCTGGTCTCACAAAGAGGATGG - Intronic
1173585877 20:44182660-44182682 GAGTCGTCTCAGAAGGAGGATGG - Intronic
1174662458 20:52225941-52225963 TTGTCATATGAGATAGAGGATGG - Intergenic
1174974617 20:55317831-55317853 CAGTAATCTCATAGAGAGGAGGG + Intergenic
1175455558 20:59109976-59109998 CTTTCATCACAAAACGAGGAGGG - Intergenic
1178185688 21:30217433-30217455 CTGTCTTCTAAAAAAGAGGCAGG + Intergenic
1179551360 21:42146018-42146040 CTGTCCTCCCAGAAACGGGAAGG - Intergenic
1180719518 22:17896982-17897004 CTGTCTCCAGAGAAAGAGGAGGG + Intronic
1182114164 22:27745426-27745448 CTGTCAACTCAGGACGAAGAAGG + Intergenic
1183025093 22:35058819-35058841 CTGCCAACTCCGAAAGGGGAGGG + Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
956166066 3:66399222-66399244 ATTTCATTTCAGAAAGGGGAAGG - Intronic
956464027 3:69500797-69500819 CTGTCATCTCCCACAGGGGAGGG + Intronic
957842080 3:85685004-85685026 CTGTAATCCCAGCAAGAGGAGGG + Intronic
958834176 3:99124537-99124559 CTGAGGTCTCACAAAGAGGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
960260503 3:115562846-115562868 CTCTCTACTCAGAAAGAGGATGG + Intergenic
960945336 3:122962469-122962491 CTGTCCCGTGAGAAAGAGGACGG + Intronic
961244928 3:125442738-125442760 CTGTCATCATAAAAAGAGGTGGG + Intergenic
963049594 3:141129614-141129636 CTGTCATTTCAGAGAGACGCTGG + Intronic
964821243 3:160772374-160772396 CTTTCCTCTCAAAAATAGGATGG + Intronic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965550555 3:169960920-169960942 CTTCCATCTCAGCAAGTGGAAGG - Intergenic
966143420 3:176783263-176783285 CTTTCATCTCAGAAAATAGAAGG + Intergenic
967439041 3:189485652-189485674 CTTTATTCTAAGAAAGAGGAGGG - Intergenic
968462722 4:733319-733341 CTGTCTTCTGTGAAAGCGGAAGG - Intronic
969953030 4:10858800-10858822 CTCTCATAGCAGAAAGTGGAAGG - Intergenic
971379378 4:26083088-26083110 CTGTCATGGAAGTAAGAGGAGGG + Intergenic
971884991 4:32433020-32433042 CTGGCATCTCTGAAAGAGATGGG + Intergenic
972348262 4:38211821-38211843 CTGACATCTAAGAAGGTGGATGG + Intergenic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
976647212 4:87399352-87399374 CTGCCAACTCAGAAAGGGGGTGG - Intergenic
976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG + Intronic
977635261 4:99291099-99291121 CTGTCAAATCATAAAGAAGAGGG + Intergenic
978760190 4:112348977-112348999 CTGACACCTCAGACAGAGGCAGG + Intronic
979266706 4:118711981-118712003 ATTTCATCTTAGAAAGAGGTAGG + Exonic
979325138 4:119370490-119370512 CCTACATCCCAGAAAGAGGAAGG - Intergenic
979937356 4:126715040-126715062 CTGTTTTCTCAGCATGAGGAAGG - Intergenic
980423175 4:132591359-132591381 CTGTCATTTGATAAAGATGAAGG - Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
981029042 4:140105535-140105557 CTGTTTTGTCAGACAGAGGATGG - Intronic
981033358 4:140148085-140148107 CTGACATCTCTGGAAGAAGAAGG - Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
982499261 4:156132394-156132416 CTGGCATCTCAGAAAGGGAGAGG + Intergenic
983243043 4:165255514-165255536 CCTACATCCCAGAAAGAGGAAGG - Intronic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
984682259 4:182624012-182624034 CTTACATCTCAGACAGAGAACGG - Intronic
985493990 5:194223-194245 ATGTCAGCTCAGAAAGCAGACGG - Intronic
988156415 5:27456818-27456840 TGGTAATCTCAGAAAGAAGAGGG + Intergenic
989213558 5:38880850-38880872 CCAGCATCTCAGAAAGATGAAGG + Intronic
990725811 5:58753631-58753653 CTGTCTTCACAGGAAGAGGAGGG + Intronic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
992503938 5:77367107-77367129 TTGTAAACTTAGAAAGAGGAGGG + Intronic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
994012840 5:94926905-94926927 ATGTAATCTCAGTGAGAGGATGG - Intronic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
996543601 5:124654618-124654640 TTGTGAGCTCAGAAAGGGGAGGG - Intronic
997944245 5:138184973-138184995 CTGTCACCTGAGACAGAGGGTGG + Intronic
998040783 5:138949929-138949951 CTGTCCTCCCTGAAAGAAGAGGG + Intronic
998220655 5:140275901-140275923 TTTTCATCTCTGAAAGAGTAAGG - Intronic
999815005 5:155167329-155167351 CTGTGATCTCAGAAGAGGGAAGG + Intergenic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1001650660 5:173313644-173313666 CTGGCTTCTCAGAAAGGTGATGG + Intergenic
1002306692 5:178287713-178287735 CTGGGATGTCAGAAAGAGTAGGG - Intronic
1003140796 6:3469639-3469661 CTGTCCTCTCAGCAAGAGTTGGG + Intergenic
1003992286 6:11498213-11498235 CTGTCACCTGTGAAAGGGGAGGG - Intergenic
1004542566 6:16565005-16565027 ATGTCTCCTGAGAAAGAGGATGG - Intronic
1005678320 6:28179592-28179614 TTGGCATTTAAGAAAGAGGAAGG + Intergenic
1006677027 6:35771758-35771780 CTGTCCTCACAGACAGAGCAGGG + Intergenic
1007487421 6:42191114-42191136 CTGTCTACTCAGGAATAGGATGG + Intronic
1009405477 6:63307231-63307253 TTCTCATCTCTGAAATAGGATGG - Intronic
1009534439 6:64861601-64861623 CTGCCATCTCAGAAAAGGGCAGG + Intronic
1012078426 6:94725422-94725444 AATTCATCACAGAAAGAGGAAGG + Intergenic
1012758381 6:103263424-103263446 CTTTCATCTCATAAAAAGAATGG - Intergenic
1013520380 6:110927252-110927274 CTGTGATCACAGAAAAAGCAAGG - Intergenic
1013680008 6:112514636-112514658 CCATCATCTGAGAAAAAGGATGG + Intergenic
1014078879 6:117266263-117266285 CTTGCATCTCAGAAAGAGGCTGG - Intronic
1014734726 6:125078940-125078962 CTGCCATTTCAGAGAGAAGATGG + Intronic
1015093407 6:129385801-129385823 CTCTGATCTGAGAAACAGGAAGG - Intronic
1015481973 6:133722396-133722418 CTGTCATGGCAGAAAGGCGAAGG + Intergenic
1016199887 6:141394571-141394593 CTGCCAACTCAGAAAGGGGAGGG - Intergenic
1016389547 6:143561237-143561259 CTGTCATCACAGGGTGAGGAGGG - Intronic
1017185755 6:151598675-151598697 TTATCATCTCAGAAAGAAGGAGG + Intronic
1017725269 6:157272644-157272666 CTGTCACCTGGGAAATAGGAGGG + Intergenic
1018949709 6:168371131-168371153 CTGTCATCTTTGAAAGAAGGAGG + Intergenic
1020382080 7:7557619-7557641 CTGTCATGTGTGAACGAGGATGG + Intergenic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1025718021 7:63982100-63982122 CTGCCATCCCTGACAGAGGAGGG - Intergenic
1026237359 7:68538937-68538959 CTGTCACCAAAGAAAGAAGAAGG - Intergenic
1027548970 7:79567256-79567278 CTGTCATCTGAAGAGGAGGAGGG - Intergenic
1028025193 7:85828493-85828515 CTGCCACCTTAGAAAGAGAAAGG - Intergenic
1028245922 7:88477184-88477206 CTCTCATCTCAGCAGGTGGAAGG - Intergenic
1028295018 7:89118447-89118469 CTGTCATTTCTAAAAGAAGATGG - Intronic
1029509000 7:100981532-100981554 GTGAGATTTCAGAAAGAGGAAGG + Intronic
1030171171 7:106604240-106604262 CAGTCAGATCATAAAGAGGAAGG - Intergenic
1031377565 7:121046919-121046941 CTGTCTTCTAAGAAAGCAGAAGG + Exonic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032933083 7:136696663-136696685 CAGCCATCACAGGAAGAGGAAGG - Intergenic
1033446443 7:141426565-141426587 GTGTCATCATGGAAAGAGGAAGG + Intronic
1033919640 7:146374025-146374047 GTGTCAACCAAGAAAGAGGAAGG + Intronic
1034746084 7:153525007-153525029 CTGTCATCTCAGAAAGTCTTTGG + Intergenic
1035455440 7:159005988-159006010 CTGCTTTCTCAGGAAGAGGACGG + Intergenic
1035455511 7:159006292-159006314 CTGCTTTCTCAGGAAGAGGACGG + Intergenic
1036700323 8:11008947-11008969 CTTCCAACTCAGAAAGAGCAAGG + Intronic
1036712591 8:11091035-11091057 CTCTCACCTAAGAGAGAGGATGG - Intronic
1038309830 8:26437832-26437854 CAGTCATCTCAGAAAGTGAGAGG + Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038418766 8:27418521-27418543 CTGTCAAACCAAAAAGAGGAGGG - Intronic
1038945902 8:32359851-32359873 ATGTCATGCCAGAAAGATGAAGG + Intronic
1039102543 8:33956661-33956683 CTATCATCTCTGAAAGAGACAGG - Intergenic
1040937146 8:52793265-52793287 GTGTCAACTCTGAAGGAGGATGG + Intergenic
1041480084 8:58310472-58310494 GTGGCATCTCAGAAAGAGATGGG - Intergenic
1041861675 8:62520989-62521011 CTGTCATCTGAGATGGAGAAGGG - Intronic
1041942125 8:63399947-63399969 ATGTCCTTCCAGAAAGAGGAAGG + Intergenic
1042849891 8:73206161-73206183 CTGCAATCCCAGCAAGAGGAGGG - Intergenic
1043082207 8:75781080-75781102 CTCTTATCTCAGAAGGATGAAGG - Intergenic
1044506320 8:93024250-93024272 CTGACATCTCCGAAAGGAGAGGG + Intergenic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1047229523 8:122984553-122984575 ATGTCCTTTCAGAAAGATGAGGG + Intergenic
1048977114 8:139679292-139679314 CTGCCTTCTCGGCAAGAGGAGGG - Intronic
1050373560 9:4947464-4947486 CTGTAATCTCAGAAACTGGAAGG - Intergenic
1050581074 9:7057747-7057769 CTGTCATCTCCGAGGGAGCAGGG + Intronic
1050687070 9:8183794-8183816 CTGTGATCTCACATAGGGGAAGG + Intergenic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051119544 9:13737028-13737050 CAGTCATCTTTGAAAGGGGATGG + Intergenic
1051758268 9:20430365-20430387 CTATCATTTCATAAAGAGGTTGG - Intronic
1052446161 9:28564443-28564465 CTGTAATCTAAGATAGAGGTAGG - Intronic
1052541948 9:29822795-29822817 CTGTCATCTAAAACAGAGTAAGG - Intergenic
1053229721 9:36397568-36397590 CTGTGCTCTCAGAAAGAGATGGG - Intronic
1053519344 9:38762561-38762583 CTGTCATTTGAGACAGAGCAGGG + Intergenic
1053553842 9:39113148-39113170 TTGTCATCACACAGAGAGGAAGG - Intronic
1053817951 9:41933303-41933325 TTGTCATCACACAGAGAGGAAGG - Intronic
1054108204 9:61076965-61076987 TTATCATCACAGAGAGAGGAAGG - Intergenic
1054612653 9:67254160-67254182 TTATCATCACAGAGAGAGGAAGG + Intergenic
1055171944 9:73269253-73269275 CTGTCACCGAACAAAGAGGAAGG + Intergenic
1056203925 9:84302318-84302340 CGGTGATCACAAAAAGAGGAAGG + Exonic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1058539384 9:105995695-105995717 CTGGAATCTCAGAAAAAGAAAGG + Intergenic
1059438929 9:114291915-114291937 CTTTCACCTCCCAAAGAGGAAGG - Intronic
1060999068 9:127892210-127892232 CTGTGAGGTCAGAAACAGGATGG - Intronic
1062299049 9:135853925-135853947 CAGTCATCTCAGTAAGGGCAGGG - Intronic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1187360128 X:18618120-18618142 CTGCCATCTCAGAATGTGAATGG - Intronic
1187766171 X:22644761-22644783 CTGGCATCTCAGGAAGAAGGAGG + Intergenic
1188061117 X:25603230-25603252 AGGTCATCACAGAAAGAGGGGGG + Intergenic
1188252628 X:27916839-27916861 CTATGATCTTAGAAAGAGTATGG + Intergenic
1189425953 X:40900140-40900162 CTGACACCTCAGGGAGAGGATGG - Intergenic
1190369391 X:49726829-49726851 CTGCCAACTCAGAAACAGCAGGG - Intergenic
1190373053 X:49761517-49761539 CTGCCATCTTATAAAGAGCATGG - Intergenic
1190738662 X:53272920-53272942 CTGTCAGCTCTAGAAGAGGAGGG - Intronic
1191612106 X:63127954-63127976 CTGTCATCTTCTAAAGTGGAAGG - Intergenic
1191711121 X:64150942-64150964 CAGTCATTTCAGAAAGTGAAAGG + Intergenic
1193211559 X:78811731-78811753 CTGTCATCTCAGAAAGGGGCAGG + Intergenic
1193221734 X:78934826-78934848 CTGGCATTTGAGAATGAGGAGGG - Intergenic
1194084717 X:89511197-89511219 CAGTCATCACAGAAAGTGAAGGG + Intergenic
1194762737 X:97813804-97813826 CTGTTATCTCAGAATGGGCACGG + Intergenic
1195395851 X:104409563-104409585 CTGGCCTCTCAGAAAAAGGTGGG + Intergenic
1195798117 X:108675668-108675690 CTGGCATATGAGAAAGAGGAAGG - Intronic
1197866578 X:131025441-131025463 CTGTTATTTCACAAACAGGAAGG + Intergenic
1198327476 X:135587565-135587587 CTCTCAGCTAAGAAACAGGAAGG + Intergenic
1198730476 X:139722550-139722572 CTGGCAGTTCTGAAAGAGGAAGG + Intergenic
1199063250 X:143384633-143384655 CTGGCATCCCAGAAAGAGATAGG - Intergenic
1199305609 X:146264058-146264080 ATGTCATGACAGAAAAAGGAGGG + Intergenic
1199907853 X:152252905-152252927 GTGTCAGCTCTGAGAGAGGATGG - Intronic
1201601285 Y:15730975-15730997 CTCTCATTTGTGAAAGAGGAAGG + Intergenic