ID: 1143861612

View in Genome Browser
Species Human (GRCh38)
Location 17:9895392-9895414
Sequence GGGAAGAACCTGTCTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143861606_1143861612 9 Left 1143861606 17:9895360-9895382 CCTGGATCTGCTGGTGACCGTCC No data
Right 1143861612 17:9895392-9895414 GGGAAGAACCTGTCTGAGAATGG No data
1143861609_1143861612 -8 Left 1143861609 17:9895377-9895399 CCGTCCTGCCAGCATGGGAAGAA No data
Right 1143861612 17:9895392-9895414 GGGAAGAACCTGTCTGAGAATGG No data
1143861604_1143861612 24 Left 1143861604 17:9895345-9895367 CCATGAAGAAGGCAGCCTGGATC No data
Right 1143861612 17:9895392-9895414 GGGAAGAACCTGTCTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143861612 Original CRISPR GGGAAGAACCTGTCTGAGAA TGG Intergenic
No off target data available for this crispr