ID: 1143861894

View in Genome Browser
Species Human (GRCh38)
Location 17:9897268-9897290
Sequence CGGGGTGGCTGGAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2172
Summary {0: 1, 1: 0, 2: 3, 3: 201, 4: 1967}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143861894_1143861904 1 Left 1143861894 17:9897268-9897290 CCTTCTACCCTCCAGCCACCCCG 0: 1
1: 0
2: 3
3: 201
4: 1967
Right 1143861904 17:9897292-9897314 CCTTCTCCTGGAACTCGAGATGG 0: 1
1: 0
2: 1
3: 11
4: 130
1143861894_1143861906 19 Left 1143861894 17:9897268-9897290 CCTTCTACCCTCCAGCCACCCCG 0: 1
1: 0
2: 3
3: 201
4: 1967
Right 1143861906 17:9897310-9897332 GATGGTCATTCATGCCTCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 128
1143861894_1143861907 30 Left 1143861894 17:9897268-9897290 CCTTCTACCCTCCAGCCACCCCG 0: 1
1: 0
2: 3
3: 201
4: 1967
Right 1143861907 17:9897321-9897343 ATGCCTCAGCGGCTCTGTGTTGG 0: 1
1: 0
2: 1
3: 6
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143861894 Original CRISPR CGGGGTGGCTGGAGGGTAGA AGG (reversed) Exonic
Too many off-targets to display for this crispr