ID: 1143862946

View in Genome Browser
Species Human (GRCh38)
Location 17:9904635-9904657
Sequence CGAGATGCTGATATTGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143862946_1143862948 3 Left 1143862946 17:9904635-9904657 CCTCTATCAATATCAGCATCTCG 0: 1
1: 0
2: 0
3: 8
4: 177
Right 1143862948 17:9904661-9904683 CACCACGCTCTCAGAGCCAGTGG 0: 1
1: 0
2: 1
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143862946 Original CRISPR CGAGATGCTGATATTGATAG AGG (reversed) Intronic
901275802 1:7990108-7990130 GGAGATGGTGATAGTGATTGTGG - Intergenic
901553841 1:10016220-10016242 GCAGATGGTGATATTGACAGGGG + Intergenic
901670597 1:10853979-10854001 TGATATGCTGATAGTGGTAGTGG - Intergenic
905906505 1:41621928-41621950 GGAGATTCTGAGCTTGATAGAGG - Intronic
907384672 1:54118302-54118324 TGAGATGCTTATATTGTTTGTGG - Intergenic
907726810 1:57027581-57027603 GGAGTTGCAGATATTGAAAGTGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
919294187 1:195673198-195673220 CAAGATAATTATATTGATAGAGG - Intergenic
920522990 1:206643013-206643035 GGAGAAGATGATATTGATGGTGG + Intronic
921309716 1:213830893-213830915 CAAGATGCTGCTGTTGACAGTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923785012 1:237058085-237058107 GGAGAAGCTGATATTGCTGGCGG + Intronic
924214499 1:241806832-241806854 GGAGATGCTGATATTGGGAAAGG + Intergenic
1065767192 10:29040853-29040875 GGAGGTCCTGATATGGATAGTGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067945554 10:50686127-50686149 AGGGATGCTGATAATGATGGGGG - Intergenic
1068817006 10:61327926-61327948 CAAGATGGAGATATTGATAATGG - Intergenic
1071268899 10:83989058-83989080 TGAGAAGCTGAAGTTGATAGAGG + Intergenic
1071822845 10:89295576-89295598 GGTGATGCTGATATTGCTGGTGG + Intronic
1072440478 10:95449596-95449618 CGAGAGTTTGATATTGGTAGTGG - Intronic
1072474503 10:95746784-95746806 AGAGAGGTTGTTATTGATAGTGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1075006097 10:118831262-118831284 AGAGATGTTGTTATTAATAGTGG - Intergenic
1077293837 11:1814866-1814888 AGAGATGCTGATGTTGAACGGGG + Intergenic
1081091670 11:38876791-38876813 TGAAATACTGATATTTATAGAGG - Intergenic
1087493577 11:98860189-98860211 CCAGTTGAGGATATTGATAGTGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1092315941 12:7413550-7413572 CGAGATGCATAGATTGATGGGGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1104342563 12:127964928-127964950 TCACATGCTGATATTGATTGAGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1110061687 13:71048228-71048250 AGAGATTCTTATATTGAAAGAGG + Intergenic
1114181379 14:20370913-20370935 CAAGATGCTATTATTCATAGGGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1118042252 14:61930116-61930138 CAAGATGCTTATATTCATAAAGG + Intergenic
1119491298 14:75035935-75035957 CGAGATGCTGATGGTGCTAATGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121567817 14:94923818-94923840 TAAGATGCTGCTATTGACAGGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1129654405 15:77514426-77514448 GGAGATACTGAAATGGATAGTGG + Intergenic
1133324727 16:4936035-4936057 GGAGATGCTGAGATTGACGGAGG - Intronic
1135909012 16:26542355-26542377 AGAAATGGTGATATTGATGGTGG - Intergenic
1138499851 16:57433946-57433968 TGAGATGGTGATATTTTTAGAGG - Intronic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139141255 16:64265267-64265289 ATACATGTTGATATTGATAGAGG - Intergenic
1140834860 16:78783964-78783986 GGTGATGATGATAATGATAGTGG + Intronic
1143862946 17:9904635-9904657 CGAGATGCTGATATTGATAGAGG - Intronic
1144775335 17:17782268-17782290 CGAGAGGCAGATATAGAAAGGGG + Intronic
1152004829 17:77673714-77673736 ATAGATGTTGATATTGATACAGG - Intergenic
1155323581 18:24643744-24643766 TGAGATGATGATAATGATGGTGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156641537 18:39106917-39106939 CCAAAGGCTGATATTGATGGTGG + Intergenic
1159081284 18:63738912-63738934 CCAGATGCTCATATTTATAACGG + Intergenic
1159708296 18:71720031-71720053 TGAGCGGCTGAAATTGATAGGGG + Intergenic
1160029636 18:75247625-75247647 CGATTTTCTGATATAGATAGAGG + Intronic
1160065366 18:75569072-75569094 AGAGATGGTGATGGTGATAGTGG - Intergenic
1163040117 19:14595876-14595898 TGAGATGGTGATGATGATAGTGG + Intronic
1163127530 19:15252327-15252349 CCAGATGCTGAAATTGTCAGGGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
927435311 2:23061318-23061340 GGAGGTGCTGATATTGGCAGGGG - Intergenic
930779746 2:55212408-55212430 GGTGATGCTGATGTTGATACAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
935103189 2:100016179-100016201 GGCGATGCTGATAATGATTGTGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
941435479 2:165465799-165465821 TCACAGGCTGATATTGATAGAGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
944400377 2:199319443-199319465 CCAGATGGTGATAATGAAAGGGG - Intronic
945144011 2:206716819-206716841 CCAGATGCTGCTCTTGGTAGAGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1172612279 20:36261018-36261040 CGAGATGCTGCAATTTAAAGGGG + Intronic
1174086346 20:48010775-48010797 GGTGATGGTGATATTGATGGTGG - Intergenic
1174086353 20:48010820-48010842 GGTGATGGTGATATTGATGGTGG - Intergenic
1174558112 20:51410988-51411010 GGTGATGGTGATAATGATAGTGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177810007 21:25915481-25915503 CGAGAGGCTGAAATAGATAGGGG - Intronic
1178892476 21:36531597-36531619 CCAGAGGCTGTTATTGATTGAGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180750018 22:18118058-18118080 AGCGATGCTGAGATTGATCGCGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951612315 3:24504196-24504218 GGTGATGCTGATACTGCTAGAGG - Intergenic
951757133 3:26103280-26103302 CAAGATGATAATATTGATTGGGG - Intergenic
952819844 3:37476843-37476865 CCAGATGCTGAGAATGAAAGTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958981529 3:100726040-100726062 AGAGAAGCTGATGCTGATAGTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
961587821 3:127948576-127948598 CGAGATGCTGATCTTGACTAGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963608191 3:147431800-147431822 CCAGAGGCTGATAATGGTAGCGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967504340 3:190237279-190237301 CGATATGCTTATATTAATAGAGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971518134 4:27514147-27514169 GGAGATGATGATATTGAAACTGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974185089 4:58435211-58435233 AGAGATGCTGATACTGATATTGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978082400 4:104610000-104610022 CCAGAGGCTGATAGTGATGGGGG - Intergenic
978959189 4:114655107-114655129 TTAGATGCTGAAATTGATGGAGG + Intronic
979882574 4:125980233-125980255 GGAGATGCTGATAATGAGAAAGG + Intergenic
980368339 4:131835457-131835479 CCAGATGCTAAAATTGAGAGTGG - Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
982350718 4:154412324-154412346 GGACATGCTGAAATTGATGGGGG - Intronic
982376193 4:154693523-154693545 GGAGATGCTGATATTGGGAGAGG - Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988290770 5:29282768-29282790 GGAGATGTTGATAATGATGGAGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991144716 5:63286859-63286881 GGAGAGGCTGAAAGTGATAGAGG + Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000662461 5:163952467-163952489 TGAAATGCTGGTATTGATTGTGG + Intergenic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011789027 6:90878234-90878256 TTAGATGCTGATAGTGATACTGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1017569895 6:155732634-155732656 GGAGATGCTTATCTTGATTGTGG - Intergenic
1018654840 6:166025181-166025203 CAAGGTGATGGTATTGATAGAGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019765996 7:2850783-2850805 AGTGATGCTGATAGTGATGGTGG - Intergenic
1022520272 7:31001841-31001863 TGAGATGCTGATAGTGACTGGGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024644907 7:51362871-51362893 CATGGTGGTGATATTGATAGTGG - Intergenic
1028988265 7:97024389-97024411 CGTGATACTGATACTGGTAGGGG + Exonic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1033794874 7:144835403-144835425 CGAGAGGCTGATATGCTTAGCGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035342431 7:158172495-158172517 GGGGATGCTGCTATTGATGGTGG - Intronic
1035342437 7:158172531-158172553 GGAGATGCTGTTGTTGATGGTGG - Intronic
1035342444 7:158172591-158172613 GGAGATGCTGTTGTTGATGGTGG - Intronic
1035342496 7:158172904-158172926 GGGGATGCTGCTATTGATGGTGG - Intronic
1035342546 7:158173196-158173218 GGGGATGCTGCTATTGATGGTGG - Intronic
1038419032 8:27420305-27420327 CGGGATGCTGACAGTGCTAGGGG + Intronic
1038465608 8:27759880-27759902 CCAGATGCTGACATTCACAGAGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044078349 8:87852352-87852374 AGAGATTCTGATAGTGAGAGAGG + Intergenic
1044789751 8:95835284-95835306 AGAGATGCAGATATTGGTAGTGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1049274606 8:141713640-141713662 GGAGATGCTGCTACTGATGGTGG + Intergenic
1050111957 9:2226582-2226604 CGAGGTGCAGATATTGGCAGAGG - Intergenic
1050974440 9:11919265-11919287 TGGGATGTTGATATTGAGAGAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055719598 9:79156775-79156797 CGAGATGATGGTGTTGATAATGG - Intergenic
1058846278 9:108962745-108962767 CATGATGCTGATGCTGATAGAGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059717549 9:116927707-116927729 CGAGATGCTTATGTTTAGAGAGG - Intronic
1059795572 9:117692852-117692874 AGTAATGGTGATATTGATAGTGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185689060 X:2138136-2138158 CGAGATGATGATGATGATAATGG - Intergenic
1186979981 X:14948323-14948345 GGAGATGCTGATGTTGATCCAGG + Intergenic
1187141113 X:16594473-16594495 TAAGATGTTGCTATTGATAGGGG + Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193069505 X:77293564-77293586 GGAAATGCTTATATTGAGAGAGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194566885 X:95499968-95499990 AGAGAAGCAGATATTGATAGAGG + Intergenic
1196231470 X:113227644-113227666 GAAGGTGCTGATATTTATAGTGG + Intergenic
1197465139 X:126795769-126795791 TGAGCTGCTGATGTTGAAAGTGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic