ID: 1143865357

View in Genome Browser
Species Human (GRCh38)
Location 17:9919148-9919170
Sequence AAGGGTGAACAACAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143865357 Original CRISPR AAGGGTGAACAACAGGCGGC AGG (reversed) Intronic
905470643 1:38189086-38189108 AAGCATGAACACCAGGAGGCTGG + Intergenic
908422183 1:63969781-63969803 AAGGGAGAAAGACAGGTGGCAGG - Intronic
909591495 1:77353933-77353955 AAGGATGTACAAAAGGCTGCAGG + Intronic
921664304 1:217849677-217849699 ATGGGTGAACAGCAGGCACCAGG - Intronic
921915992 1:220611145-220611167 ATGGTTGAACAAAAGGCAGCAGG - Intronic
924743862 1:246814633-246814655 AAGGGTCAAAAGCAGGCGGTGGG - Intergenic
924786369 1:247203633-247203655 CAGGATGAACAGCAGGCTGCTGG + Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1071549282 10:86553988-86554010 ATGGGTGAACACCAGGAGGCAGG + Intergenic
1083691223 11:64409977-64409999 GAGGGGGAAGAACAGGCGGGAGG - Intergenic
1084572173 11:69966374-69966396 AAGGCTGAAAACCAGGTGGCAGG - Intergenic
1086869041 11:92015107-92015129 ATAGGTGAACAAAAGGCAGCAGG - Intergenic
1088230619 11:107670302-107670324 AAGAAAGAACAACAGGGGGCAGG - Intergenic
1088764494 11:112962579-112962601 AAGTGTGAACAATAGGGAGCTGG + Intronic
1090880858 11:130830519-130830541 AAGGGTGCAAAAAAGGGGGCAGG - Intergenic
1091088883 11:132750375-132750397 AAGGGACAACCACAGGAGGCAGG + Intronic
1202806684 11_KI270721v1_random:9340-9362 GAGGGAGAACAACACGCGGGCGG - Intergenic
1094071051 12:26413032-26413054 AAGGGTGAGAAACAGGAGGATGG + Intronic
1099664557 12:85611192-85611214 AAGGGTGGACTACAGGAGGAGGG - Intergenic
1099861292 12:88228490-88228512 AAGGGTGGACAGCAGTCTGCTGG - Intergenic
1103178516 12:118886601-118886623 ATGGGTGAGCAACAGGCAGCTGG + Intergenic
1106502829 13:30345859-30345881 AAGGGTGAACACCAGGAGGTGGG + Intergenic
1107011654 13:35676479-35676501 AAGGGTGGAGAGCAGGGGGCAGG - Intergenic
1109264915 13:60187038-60187060 AAATGTGAATAACAGGAGGCAGG + Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1114659078 14:24333523-24333545 TAGGTTGGACAACAGGAGGCTGG - Intronic
1121222076 14:92293433-92293455 AGGGGTGAACTACATGCAGCGGG - Intergenic
1124653281 15:31488154-31488176 AAGGGTAAACACCAGGCAGAAGG + Intronic
1124921031 15:34026814-34026836 AAGGTTGAACAAAAGACCGCAGG - Intronic
1128873390 15:71181825-71181847 AAGAGTTAACAACAGGAGTCAGG - Intronic
1129510840 15:76120842-76120864 AAGGGAGTACAACATGAGGCAGG + Intronic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1132211543 15:100027073-100027095 CAGGGTGAACAACAGTCGGGAGG + Intronic
1134622429 16:15699629-15699651 AAGGGTGAACATCAAGAGTCAGG - Intronic
1141722227 16:85762889-85762911 ATGGGTGAACCAGAGGCTGCAGG + Intergenic
1142002237 16:87670528-87670550 AAGGATAACCAACAGGAGGCTGG - Intronic
1143865357 17:9919148-9919170 AAGGGTGAACAACAGGCGGCAGG - Intronic
1146290095 17:31600637-31600659 AAGGGTGACCAACAGCCGCCAGG + Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1151575206 17:74949679-74949701 AAGGGTGCACCCCAGGAGGCTGG + Exonic
1160903139 19:1439086-1439108 AAAAGTGAACAACGGGGGGCAGG - Intronic
1167112035 19:47468260-47468282 AAGGGGGAACAGCAGGTGCCAGG - Intronic
929613107 2:43286419-43286441 AAGGCTGAAAAACAAGAGGCTGG + Intronic
930215596 2:48693163-48693185 AAGGGTGAAGAAAAGGCCACTGG + Intronic
931868043 2:66432923-66432945 AAGGGTGCAGTGCAGGCGGCTGG + Intergenic
933168375 2:79098417-79098439 AGGGGTGAACAGCAGTCAGCTGG + Intergenic
937246840 2:120499175-120499197 AAAGATGAAGAGCAGGCGGCAGG - Intergenic
940919086 2:159287293-159287315 AAGGCTGAAGAAAAGGCGCCCGG - Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
944676859 2:202040646-202040668 AAGGGTGAATAACAGCCTACGGG + Intergenic
946836141 2:223774461-223774483 AAGGTTAAACAACAGGCTGGGGG + Intronic
948223515 2:236291421-236291443 GAGGGTGGACTACAGGGGGCAGG + Intergenic
1169428309 20:5513099-5513121 AAGGGAGAACAACAGGCAGGTGG + Intergenic
1172195065 20:33085958-33085980 AAGGGTGAGCTCCTGGCGGCTGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1176415466 21:6472062-6472084 AAGGATGGGCAGCAGGCGGCAGG + Intergenic
1179373188 21:40825997-40826019 AAGAGTGACTAACAGGCTGCAGG - Intronic
1179487715 21:41721648-41721670 AAGGGAAAGCAAAAGGCGGCAGG - Intergenic
1179690966 21:43080395-43080417 AAGGATGGGCAGCAGGCGGCAGG + Intergenic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
950892013 3:16412611-16412633 AAGTGTGAACACCAGGAGGTGGG - Intronic
952932166 3:38368821-38368843 AGGGGTGAACACCAGGAGGTGGG + Intronic
954267220 3:49479204-49479226 AAAGGTGAACAACAGGCTGAGGG - Intronic
959814270 3:110657222-110657244 AATGGTTAACAACAGGCTGAGGG + Intergenic
963047942 3:141117094-141117116 CAAGGTGAAAAATAGGCGGCTGG - Intronic
969592505 4:8130071-8130093 AGGGGTGAACAGCAGGCTGGAGG - Intronic
970944417 4:21673125-21673147 AAGGGTGAATACCAGGAGGTGGG + Intronic
973994134 4:56439531-56439553 AAGGGTAAAGAACAGTGGGCCGG - Intronic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
978133715 4:105232046-105232068 GAGGGGGAACAACAGACAGCAGG - Intronic
979104258 4:116664413-116664435 AAGGGTGCCCAACAGCAGGCTGG + Intergenic
982244091 4:153332346-153332368 AATAATGAACAAAAGGCGGCTGG + Intronic
982478121 4:155877674-155877696 AAGGGTGCCCAACAGCAGGCTGG - Intronic
983104080 4:163663633-163663655 AAGAGTGAGCAATAGGTGGCAGG + Intronic
983344897 4:166516055-166516077 AAGGAAGAAATACAGGCGGCCGG + Intergenic
984035514 4:174662970-174662992 AATGGTAAACTACAGGCGTCGGG + Intronic
986518655 5:8590666-8590688 AAGGGTGAATATCAGGTGGTGGG + Intergenic
989436462 5:41418951-41418973 AAGGCTGAGCAGCAGGCAGCTGG + Intronic
993049458 5:82909883-82909905 GAGGGTGCACAACATGCGCCAGG + Intergenic
994213742 5:97113966-97113988 AAAGGAGAACAACAGGAGGGAGG - Intronic
994328758 5:98481617-98481639 AATGGTGAACAACCGGTGGTAGG + Intergenic
996372900 5:122772137-122772159 GAGTGTGAATAACAGGAGGCAGG - Intergenic
1001567109 5:172706912-172706934 AAGGGGGCACAGCAGGGGGCGGG + Intergenic
1004639803 6:17504191-17504213 GTGGGTGCACAACAGGTGGCTGG - Intronic
1007164154 6:39816710-39816732 AAGGGTGATCCAGAGGCTGCTGG - Intronic
1008982606 6:57502308-57502330 AAGGGTGAGCATCAGGTGGTTGG - Intronic
1009170677 6:60395171-60395193 AAGGGTGAGCATCAGGTGGTTGG - Intergenic
1011231787 6:85169983-85170005 AAGGGTGCACAAAAGGTGGTAGG + Intergenic
1011867638 6:91850869-91850891 AATGGTAAGCAACATGCGGCAGG - Intergenic
1013359494 6:109381771-109381793 GAGGGTGAACAACCAGTGGCAGG + Intronic
1018463210 6:164018655-164018677 AAATGTGAACATCCGGCGGCCGG - Intergenic
1019598591 7:1869923-1869945 AACGGGGTCCAACAGGCGGCTGG + Intronic
1022329758 7:29366410-29366432 AAGGGTGAAGACCAGGAGGGTGG + Intronic
1022418898 7:30201956-30201978 AAGGGTGAACAACAGAAGCTGGG + Intergenic
1028267242 7:88741399-88741421 AAGGGTGAACAAAAGGAGAGTGG - Intergenic
1029039290 7:97556069-97556091 AAGAGTGAACTGCAGGCGGATGG - Intergenic
1045554379 8:103201337-103201359 TAGGGTGACCAACAGGTGCCTGG - Intronic
1047724856 8:127675115-127675137 AAGTGTGAACACCAGGAGGGAGG + Intergenic
1049070727 8:140353626-140353648 AAGGATGACCATCAGGCCGCGGG + Intronic
1054761949 9:69012248-69012270 AAGGGTGAAGAAAAGTCTGCTGG + Intergenic
1055901640 9:81245916-81245938 AAGGGTGAACAATAAGGGCCAGG + Intergenic
1058337408 9:103848373-103848395 AAGTGTGAACACCAGGAGGTGGG - Intergenic
1062467909 9:136689296-136689318 AAGGGTGAACACCAGACAGCCGG + Intergenic
1062650841 9:137576439-137576461 AAGGATAAAAAACAGGTGGCCGG + Intronic
1186684243 X:11908047-11908069 AAGGGTGACCCACAGGAAGCTGG - Intergenic
1189570818 X:42294518-42294540 AAGGGAGAACAACAGACGCTGGG - Intergenic
1190437740 X:50443179-50443201 AGGGGTGAACACCAGGAGGCAGG + Intronic
1190549393 X:51563418-51563440 AAGGGTGCCCAACAGCAGGCTGG - Intergenic
1192205229 X:69091404-69091426 AAGGGTGAGCTCCAGGCAGCAGG - Intergenic
1199407323 X:147477681-147477703 GAGGGTAAACGACAGGCAGCAGG + Intergenic
1200142793 X:153910161-153910183 AAGGGTGTACCCCAGGCAGCTGG + Exonic
1200280025 X:154769238-154769260 AAGGGTAAACAACTCGCCGCAGG - Exonic
1200838072 Y:7752475-7752497 AAGTGTGAACACCAGGAGGTAGG - Intergenic