ID: 1143868564

View in Genome Browser
Species Human (GRCh38)
Location 17:9941567-9941589
Sequence CTATGAGATCCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4043
Summary {0: 1, 1: 0, 2: 3, 3: 198, 4: 3841}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143868551_1143868564 27 Left 1143868551 17:9941517-9941539 CCCAATTCTGAGCCTCAGCTCTC 0: 1
1: 2
2: 4
3: 42
4: 340
Right 1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG 0: 1
1: 0
2: 3
3: 198
4: 3841
1143868552_1143868564 26 Left 1143868552 17:9941518-9941540 CCAATTCTGAGCCTCAGCTCTCA 0: 1
1: 1
2: 4
3: 52
4: 363
Right 1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG 0: 1
1: 0
2: 3
3: 198
4: 3841
1143868554_1143868564 15 Left 1143868554 17:9941529-9941551 CCTCAGCTCTCACCTCTCCTGGC 0: 1
1: 0
2: 5
3: 87
4: 657
Right 1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG 0: 1
1: 0
2: 3
3: 198
4: 3841
1143868558_1143868564 -2 Left 1143868558 17:9941546-9941568 CCTGGCACTAAAGGGCCTTCCCT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG 0: 1
1: 0
2: 3
3: 198
4: 3841
1143868557_1143868564 3 Left 1143868557 17:9941541-9941563 CCTCTCCTGGCACTAAAGGGCCT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1143868564 17:9941567-9941589 CTATGAGATCCCAAGGTGGATGG 0: 1
1: 0
2: 3
3: 198
4: 3841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143868564 Original CRISPR CTATGAGATCCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr