ID: 1143870450

View in Genome Browser
Species Human (GRCh38)
Location 17:9954334-9954356
Sequence GGGCCACAGAAGCACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143870446_1143870450 -1 Left 1143870446 17:9954312-9954334 CCTGAAGGCAGCAGGACAGCGGG 0: 1
1: 0
2: 8
3: 21
4: 275
Right 1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 249
1143870443_1143870450 10 Left 1143870443 17:9954301-9954323 CCAAGGTCTGTCCTGAAGGCAGC 0: 1
1: 0
2: 3
3: 26
4: 251
Right 1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143870450 Original CRISPR GGGCCACAGAAGCACCCTGC AGG Intronic
901624824 1:10617888-10617910 GGGCCACAGCAGAACCAAGCGGG - Intronic
902873750 1:19328911-19328933 GGGCCACAGCCACAGCCTGCTGG + Exonic
902911681 1:19603031-19603053 GGGTCACAGAAGCACTAGGCCGG + Intronic
903178674 1:21594846-21594868 GGGTCACAGAAGGGCCCTGTCGG + Intergenic
904895111 1:33811302-33811324 GGTCCACAGCAGCACTCAGCTGG - Intronic
905920265 1:41714597-41714619 GGGACACAGAGGGTCCCTGCTGG + Intronic
905956278 1:41999812-41999834 AGGTCACAGAAGTACCTTGCTGG + Intronic
906113745 1:43341657-43341679 GGACCACAGAAGCCCTGTGCTGG - Intronic
907351849 1:53838335-53838357 AGGCCCCAGGAGGACCCTGCTGG + Exonic
907822051 1:57979783-57979805 GGGACACATAACCAACCTGCAGG - Intronic
911428993 1:97759101-97759123 GTCCCACAGAAGTACACTGCAGG - Intronic
912512961 1:110200934-110200956 GGGCTCCCGAAGCACCCTGCCGG - Exonic
912710955 1:111949438-111949460 GAGCCAGAGAAGAGCCCTGCAGG + Intronic
916769039 1:167890452-167890474 GGGTCACACAAGCACCCTTGTGG + Intronic
919788789 1:201276904-201276926 GGGCCACAGAACAGCACTGCTGG + Intergenic
920278719 1:204827800-204827822 GGGCCACAGAGGGATGCTGCAGG + Intergenic
924564297 1:245183705-245183727 CTGTCACAGAAGCAACCTGCAGG + Intronic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1064099483 10:12451228-12451250 GGGCCAGAGGAGGAGCCTGCAGG - Intronic
1064179054 10:13099608-13099630 GAGCCCAAGAAGCATCCTGCAGG + Intronic
1064874149 10:19974340-19974362 GGGCCACAGAAACCACCAGCTGG - Intronic
1065130392 10:22614018-22614040 GTGCCACAGAAGCACAGAGCAGG + Intronic
1066013793 10:31217769-31217791 TGCCCACAGCAGCACCCAGCTGG + Intergenic
1067046286 10:42987048-42987070 TGCCCACTGAAGCAGCCTGCAGG - Intergenic
1067234812 10:44438599-44438621 GTGACACAGATGAACCCTGCAGG - Intergenic
1067837218 10:49649015-49649037 AGGGCACAGAGGAACCCTGCTGG - Intronic
1067840104 10:49668907-49668929 AGGCCTCTGAAGCTCCCTGCGGG + Intergenic
1069690423 10:70348200-70348222 GTTCCACAGAAGGGCCCTGCTGG + Intronic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1070702841 10:78616036-78616058 AGGCCACAGAAGGAAACTGCAGG - Intergenic
1070758377 10:79007636-79007658 GTGACACAGAAGCACCTGGCAGG + Intergenic
1070948965 10:80415523-80415545 TAGCCACAGAAGCACCCAGAAGG - Intronic
1073543891 10:104333458-104333480 GTGAAACGGAAGCACCCTGCAGG - Exonic
1074507469 10:114084426-114084448 TGGGCACAGAAGCATCGTGCAGG - Intergenic
1075980173 10:126731615-126731637 AGGCCACATAAGCAACATGCAGG + Intergenic
1076245501 10:128944698-128944720 GGGCCCCCTAAGGACCCTGCAGG + Intergenic
1077053858 11:580491-580513 GGGACTCAGCAGCACCCTGGTGG + Intronic
1077866229 11:6223822-6223844 GGGCCACACAAACACACAGCTGG + Exonic
1078925462 11:15870750-15870772 GGGCCACAGAAGCAAATTGGAGG + Intergenic
1081609593 11:44552745-44552767 GGGCTCCAGAAACAGCCTGCAGG + Intergenic
1081991321 11:47339179-47339201 GGGCCCCACAGGGACCCTGCTGG + Intronic
1083626349 11:64073957-64073979 GGGCCTCCAAAGCACCCTGGGGG - Intronic
1083954467 11:65975985-65976007 GGGCCACCTCACCACCCTGCGGG + Intronic
1084182891 11:67455472-67455494 GGCCGTCAGAAGCCCCCTGCGGG + Exonic
1084413199 11:69015603-69015625 AGGCCACAGAAGCACCTGGCAGG - Intergenic
1089384086 11:118056674-118056696 GGGCCACAGAGGAACCCCTCGGG + Intergenic
1090713318 11:129407866-129407888 GGGTCAGAGAAGCACCCTGGAGG + Intronic
1090829104 11:130408676-130408698 TGAGCACAGAAGCAGCCTGCCGG + Intronic
1095955469 12:47803265-47803287 TGGACACAGAAGCGCTCTGCTGG + Intronic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1096673780 12:53215457-53215479 GGGCCTCTGAAGCACAATGCTGG + Intronic
1097189035 12:57210752-57210774 GGGCCCCAAATGCACCCAGCAGG + Exonic
1097357188 12:58614897-58614919 TGGGCACAGAAGCACCATGTAGG + Intronic
1102217615 12:111172559-111172581 GGGACACTGAACCACCCTCCCGG - Intronic
1102219970 12:111187721-111187743 GGGCCACAGAAACCCCAGGCTGG - Intronic
1102561730 12:113766966-113766988 AGGCCACAGAAGCAGCTTGATGG + Intergenic
1102627333 12:114245624-114245646 GGGCCCCAGAAGGACACTGATGG + Intergenic
1102826597 12:115952249-115952271 AGGCCACAGGAGCCCCCTGCAGG - Intergenic
1104410418 12:128553231-128553253 GGGCCACACACGCAGCCTGTGGG + Intronic
1104674849 12:130705457-130705479 GGGCCACAGAAGCCTCCTGGGGG + Intronic
1106284450 13:28306742-28306764 GGGCGACAGCAGCACTCTGTTGG - Exonic
1113468364 13:110527560-110527582 GGGCGACAGAGCCACCCTGTTGG + Intronic
1115172897 14:30528945-30528967 TGGCCACTGAAGCTCCCTGTGGG - Intergenic
1116310203 14:43315738-43315760 GGGCCACTGAAGCCCTCTGTAGG + Intergenic
1117454362 14:55882983-55883005 GGGTCACAGACACACACTGCAGG + Intergenic
1121017186 14:90555962-90555984 GGTCCACATGAGCTCCCTGCCGG + Intronic
1122204588 14:100142246-100142268 GGTCTACAGAAGCACCTTCCAGG + Intronic
1122242976 14:100381516-100381538 GAGCCACAGGGGCCCCCTGCAGG + Exonic
1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG + Intergenic
1122397348 14:101442621-101442643 GGGCCACAGGAGGAGGCTGCTGG - Intergenic
1122548344 14:102537303-102537325 GGGCCCCAGAAGTGCCTTGCCGG - Intergenic
1122597488 14:102903453-102903475 GGGGCCCAGATGCACACTGCTGG - Intronic
1122650010 14:103220936-103220958 GGGCGCCAGATGCAGCCTGCGGG + Intergenic
1122882185 14:104695129-104695151 AGGCCCCAGACGTACCCTGCAGG - Intronic
1122952657 14:105054199-105054221 GGGCCACAGCAGCCCCGGGCGGG + Intronic
1123125735 14:105944831-105944853 GGGCCACAGCAGCATCCCCCGGG + Intergenic
1123451042 15:20358782-20358804 GGGCGACTGAAGCCCCCTGGAGG + Intergenic
1123714232 15:23014565-23014587 GGGCCTCAGAAGCAGCCTCATGG + Intronic
1125681206 15:41531337-41531359 GGGCCACAGGAGCACCCAGAAGG - Intronic
1125827513 15:42688919-42688941 GGACCTCAGAATCACCTTGCTGG + Exonic
1125921623 15:43528716-43528738 GGGCCCCCGGAGCCCCCTGCAGG - Exonic
1127849051 15:62897205-62897227 GCGCCACAGAAGGAGCATGCGGG + Intergenic
1129543061 15:76366980-76367002 GGTCCACAGAGGAACCCTGTAGG + Intronic
1129694049 15:77730624-77730646 GGGCCACAGCATCAACCTGGGGG + Intronic
1129949902 15:79576414-79576436 TGGCCACAGAAGCCTCCTGGGGG - Intergenic
1130531431 15:84749665-84749687 CCGCGACAGAAGCACCCTACAGG - Intronic
1130622622 15:85479467-85479489 GTGCCATGGAAGTACCCTGCAGG + Intronic
1131007523 15:88990551-88990573 GGGCCACAGGAGCAGCTGGCCGG + Intergenic
1131561310 15:93443630-93443652 GGGACACAGAAGCACACAGAGGG + Intergenic
1131640024 15:94282867-94282889 GGGCCAGAGAACCAAGCTGCTGG - Intronic
1132155501 15:99492863-99492885 GGGCCACACAAGCACAGTGAAGG - Intergenic
1132674218 16:1114998-1115020 GGGCCTCAGGTGCACCCTGAAGG + Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1133310907 16:4846654-4846676 GGGACACAGAAGCAGACCGCGGG + Intronic
1134487113 16:14667426-14667448 GGGGCAAAGAAGCTCCCTGTAGG + Intronic
1135613409 16:23888418-23888440 AGGCCACAGGAGCAGACTGCTGG + Intronic
1137607071 16:49793926-49793948 GGGCTACAGAACCCCACTGCTGG - Intronic
1137668138 16:50263609-50263631 GGGCCCCATAAGCTCCCAGCAGG + Intronic
1140940832 16:79720383-79720405 GGGCCACAGAGGCAACCAGGGGG + Intergenic
1141988261 16:87594045-87594067 GGGCAACCCAAGCCCCCTGCAGG + Intergenic
1142172061 16:88628065-88628087 GGGCCACAAATGTGCCCTGCTGG - Exonic
1142630971 17:1226214-1226236 TGGCAACAGAAGCACCCGGGCGG - Intronic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1145862532 17:28222480-28222502 GGCCTACAGAAGGACCCTGCAGG - Intergenic
1145879975 17:28345783-28345805 GAGCAACCGAAGCACCCTGAAGG + Exonic
1146418243 17:32656969-32656991 AGGCCACAGAAGCACACTGGGGG + Intronic
1146601913 17:34224648-34224670 GGGCCACACAAACACACTTCTGG - Intergenic
1147264211 17:39225337-39225359 GGCCCACAGGAGGACCCCGCCGG + Intronic
1147927778 17:43955884-43955906 GGCCTAGAGAAGGACCCTGCAGG + Intronic
1148086530 17:44996947-44996969 GGGCAACAGAACCAACTTGCAGG + Intergenic
1148759680 17:49993304-49993326 TGGCCACTGAAGGGCCCTGCGGG - Intronic
1151348232 17:73516311-73516333 GGGCCACAGCAGCCTCCTCCTGG - Intronic
1151420344 17:73992999-73993021 GTGCCACGGAAGCTTCCTGCTGG - Intergenic
1151815219 17:76468386-76468408 GGGGCTCAGAAGCACCCAGACGG + Intronic
1151954211 17:77372694-77372716 GGGCCACCGCTGCACCCTCCTGG - Intronic
1152609378 17:81308144-81308166 GGTCCTCACAGGCACCCTGCAGG + Intergenic
1152699832 17:81813339-81813361 GAGCGACACAAGCTCCCTGCTGG - Intronic
1152879608 17:82807680-82807702 TGGCCGCAGAAGCACCCCGGGGG + Intronic
1153882803 18:9435285-9435307 AGGTCACAGAAGCTCACTGCAGG - Intergenic
1159619415 18:70620168-70620190 GGTCCACAGACCCACCCTGCTGG - Intergenic
1160149057 18:76385654-76385676 GGACCCCAGGAGCGCCCTGCTGG + Intronic
1160820906 19:1057364-1057386 GGGCCACATATGCCCTCTGCTGG - Exonic
1160859258 19:1230794-1230816 GGACCACAGCAGAACCCTTCAGG + Exonic
1161064561 19:2231291-2231313 GTGCCACAGATCCACCCTCCAGG + Exonic
1162420992 19:10565993-10566015 GGGCCACAGAACCGCCATGCCGG - Exonic
1162692909 19:12448854-12448876 GGGTGACACAAGCACCCTGGTGG + Intronic
1165394174 19:35555319-35555341 CGGCCACAATCGCACCCTGCAGG + Exonic
1165973996 19:39658278-39658300 GGGGCACAGCATCTCCCTGCAGG + Intronic
1167358454 19:49017724-49017746 GGGCAAGACACGCACCCTGCGGG - Intergenic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
925246145 2:2385045-2385067 GGGCCACTGAATCAGGCTGCTGG - Intergenic
925834221 2:7928524-7928546 TGGCCTCACAGGCACCCTGCTGG - Intergenic
926101990 2:10123540-10123562 GGACCCCAGAAGACCCCTGCAGG + Intronic
926120110 2:10237232-10237254 GGGGCACAGGAGCAGCCTGCAGG - Intergenic
927207351 2:20618795-20618817 GGGCCAAAGTAGAAGCCTGCGGG - Exonic
927498750 2:23567669-23567691 GGGCCCCAGAAGCACACAACAGG - Intronic
929754875 2:44756149-44756171 GGACCACAGAAGGACCATGTGGG + Intronic
932374309 2:71222002-71222024 AGCCCACAGCAGCAACCTGCTGG + Intronic
934040860 2:88126468-88126490 GGGCCACAGAAACTCACTGGGGG + Intronic
934926975 2:98388879-98388901 GGAGCACAGGAGCACTCTGCAGG + Intronic
935942407 2:108254384-108254406 GGGTCACAGAAGCTTCCTGTAGG - Intronic
936615310 2:114042277-114042299 GTGCCACTGAAGTATCCTGCTGG + Intergenic
938116999 2:128608904-128608926 AGGCCAGACCAGCACCCTGCTGG - Intergenic
942294170 2:174501561-174501583 GGGCCACAGAATGACCCAGGAGG + Intergenic
947748881 2:232522798-232522820 GAGCCCCAGGAGCCCCCTGCCGG + Exonic
1170552019 20:17486381-17486403 GAGACAAAGAACCACCCTGCTGG - Intergenic
1171349193 20:24490062-24490084 GGGCCAGAGAGGCACCCTCCAGG + Intronic
1171978012 20:31607585-31607607 GGGCCACAGAACCACACTGTGGG + Intergenic
1173161160 20:40653451-40653473 GGTCCACAGAAGATCCCTGAAGG - Intergenic
1173956984 20:47040988-47041010 GGGGGCCAGAAGCACCCTGTGGG + Intronic
1174666103 20:52259367-52259389 GGGCCACAGCATCACACTCCAGG + Intergenic
1175807064 20:61835576-61835598 GGCCCACAGAGGCAGCCTCCTGG + Intronic
1175899877 20:62355738-62355760 GGGCCTCAGCAGCCCCCTGTGGG + Intronic
1176107524 20:63396396-63396418 GGCCCACAGCATCAACCTGCTGG - Intergenic
1176143427 20:63554896-63554918 GGGCCACAGCTGCACTCAGCCGG + Exonic
1176973107 21:15289212-15289234 TGGCCACAGAAGTTCCCGGCTGG - Intergenic
1179356203 21:40662784-40662806 GGCCCTCACCAGCACCCTGCGGG + Intronic
1179423156 21:41252036-41252058 GGAGCACAGCAGCACTCTGCAGG - Intronic
1179488984 21:41728160-41728182 CGGGCACAGAAGCACTCTGTGGG - Intergenic
1179536501 21:42056088-42056110 GGGCTACAGGCGCACCCTCCAGG - Intergenic
1179978868 21:44886202-44886224 AGCCCCCAGAAGCACCCGGCCGG + Exonic
1180241468 21:46509857-46509879 GGGCCACAGGGGCCCCATGCTGG + Intronic
1181402980 22:22662591-22662613 GGACCACAGATGCACCCAGAGGG + Intergenic
1181464150 22:23101851-23101873 AGCCCACAGCAGCACCCTGATGG + Intronic
1181585361 22:23849923-23849945 GGGACACGGAGGCACCCCGCTGG + Intergenic
1181910235 22:26232896-26232918 GAGCTTCAGAAGGACCCTGCAGG + Intronic
1182350398 22:29696007-29696029 GGGCCACAGAACCACCCCCACGG + Exonic
1182462131 22:30490566-30490588 GGGCCACAGCTCCTCCCTGCAGG - Intronic
1182718544 22:32378786-32378808 GGGCCACAGAACCCCAGTGCAGG + Intronic
1183272659 22:36871789-36871811 GGCACACAGCAGCACCCAGCAGG - Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184538583 22:45104418-45104440 GGGCCACAGAGGGACCCAGGTGG - Intergenic
1184895353 22:47403466-47403488 GGGCCAAAGCAGCACCGGGCAGG + Intergenic
1184901259 22:47447961-47447983 GGGCTACAGTTACACCCTGCAGG + Intergenic
949098241 3:112280-112302 GGGCCATGCAAGCTCCCTGCCGG - Intergenic
949102993 3:168511-168533 GCTCCAGAGAAGCACACTGCAGG + Intergenic
949848849 3:8400699-8400721 AGGACCCAGAAGCACCCTTCAGG + Intergenic
950435121 3:12974804-12974826 GAGCCACAGCAGCACCCTCAGGG + Intronic
952221180 3:31325726-31325748 TGGCCACTGATTCACCCTGCAGG - Intergenic
953655190 3:44845875-44845897 GGGTCACAGAAGCTCAGTGCAGG - Intronic
953735571 3:45491531-45491553 GGGCTAGAAAAGCATCCTGCCGG - Exonic
953920353 3:46947352-46947374 GGGCCACTGCAGCCCCATGCCGG + Intronic
954408321 3:50357871-50357893 GGGAGCCAGAAGCAACCTGCTGG - Intronic
954753152 3:52824826-52824848 GGGCCACAGGACCTACCTGCTGG + Exonic
954856195 3:53645990-53646012 GGGCCAAAAACGCACCCAGCGGG - Intronic
955116334 3:56008290-56008312 GGGCTTTAGAAGCACCTTGCTGG - Intronic
956212742 3:66818408-66818430 GAGCCACAGTATCCCCCTGCAGG + Intergenic
960914609 3:122682693-122682715 GGGCCACTGGAGCAGCCTGGGGG - Intronic
961434328 3:126906262-126906284 GGGCCACTGCAGCATCCTCCAGG + Intronic
961570928 3:127798397-127798419 GGGGCTCCGAAGTACCCTGCTGG + Intronic
962391852 3:134978777-134978799 GAGCCACAGGAGCAACCTGGAGG - Intronic
964908775 3:161751751-161751773 GGGCTACAGAAGCATGCTGCTGG + Intergenic
968775012 4:2535562-2535584 GGGCCACGGGGGGACCCTGCCGG - Intronic
975096259 4:70460728-70460750 GGGCCATAGCAGCACAGTGCTGG - Intronic
975112425 4:70642645-70642667 GGGCCAAATAAACACCCTGTAGG + Exonic
975508038 4:75161070-75161092 GGACCAGAGAGGCACCCAGCTGG + Intergenic
978200424 4:106018744-106018766 TGGCCACATCAGCAACCTGCAGG + Intergenic
985850772 5:2387664-2387686 GGGCCACAGGGCCAGCCTGCCGG + Intergenic
988020479 5:25614635-25614657 AGGCCACAGGAGCCCACTGCAGG + Intergenic
988216831 5:28286175-28286197 GGGGCACAGAAGTTCCCAGCTGG + Intergenic
991290380 5:65028265-65028287 GTGCTTCAGAATCACCCTGCAGG + Intergenic
992748615 5:79842254-79842276 GGGCCACAGAAGGAGCAGGCAGG + Intergenic
995400273 5:111733341-111733363 GTGCTACTGAAGCACCCTGAGGG + Intronic
997572804 5:134945191-134945213 GGGCAAAAAAAGCACACTGCTGG - Intronic
998249846 5:140545079-140545101 GGGCCTCAGAAACACACTTCAGG - Intronic
1002805087 6:566344-566366 GGGCCACTGCAACATCCTGCTGG - Intronic
1003093696 6:3125642-3125664 TGGCCACGGAAGTACCCTGAAGG - Intronic
1003393183 6:5730966-5730988 GGGACACAGACCCACACTGCTGG + Intronic
1005526625 6:26657846-26657868 GGGCAAGAGAAGCATCCTGAAGG - Intronic
1006035402 6:31207607-31207629 GGGCCACTGTTGCACCCAGCTGG - Intergenic
1006385695 6:33729575-33729597 GGGCCACAGAGGAACACAGCAGG - Intronic
1007074184 6:39056390-39056412 GGGACACAGTGGCACCCTGGGGG - Exonic
1007293313 6:40802965-40802987 GAGCCAAAGAAGCTCCCTGAAGG - Intergenic
1007827306 6:44610239-44610261 GGGCCACAGCAGCAACCTTGGGG + Intergenic
1010217957 6:73421566-73421588 GGGCCACAGGACAACCCTGAGGG - Intronic
1016704278 6:147088827-147088849 GGGCCACAGAACCAACTGGCAGG - Intergenic
1017076858 6:150626584-150626606 GGGCTTCAGATGTACCCTGCTGG + Intronic
1018872755 6:167795998-167796020 TGGCCAGAGATCCACCCTGCAGG + Intronic
1019139818 6:169936170-169936192 TGGCCTCAGCAGCACCCTGGAGG - Intergenic
1019421391 7:952907-952929 GGACCACTGAAGGACCCAGCAGG + Intronic
1019540391 7:1548580-1548602 GGGCCGCAGGAGCTCCCTGGTGG + Exonic
1019544922 7:1569626-1569648 GGACCACAGGCGCGCCCTGCTGG - Exonic
1019650498 7:2155087-2155109 AGGCCACAGAAGCCCCAAGCCGG - Intronic
1022129242 7:27388933-27388955 GGGCCACTGTGGCACCCTGGGGG + Intergenic
1024598414 7:50959578-50959600 GGGCCCCAGAAGCACAGAGCAGG - Intergenic
1024646607 7:51376190-51376212 GGGGAACAGAAGCTACCTGCCGG + Intergenic
1025243593 7:57298306-57298328 AGGCCACTGAAACAACCTGCTGG - Intergenic
1025929285 7:65981794-65981816 GGGGAACAGGAGCACCCTGGAGG - Intronic
1026038243 7:66845168-66845190 GACCCACAGAAACACCGTGCTGG - Intergenic
1031235412 7:119169148-119169170 GGGCTACAGTAGCACAGTGCTGG - Intergenic
1032658179 7:133954628-133954650 TGGCCACAGAGGCTTCCTGCTGG - Intronic
1034277862 7:149831491-149831513 GGGCCACAGAAGACCTCTGTGGG - Intergenic
1035051636 7:156002154-156002176 GGGCCACAGCAGCCCCGGGCTGG + Intergenic
1035382061 7:158446550-158446572 GGGCCACAGCCGCCCCCGGCGGG + Intronic
1036648195 8:10625299-10625321 GGGTCACAGAAGCTCCCAGGAGG + Intronic
1037916414 8:22775891-22775913 GGCCCAGAGAAGCTCACTGCCGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038648576 8:29381810-29381832 GGACTACAGAAGCAGCCTCCAGG - Intergenic
1039785945 8:40834242-40834264 GGACCAGAGAACCGCCCTGCAGG - Intronic
1041817012 8:61984989-61985011 TGGCCTCAGAAGCTCTCTGCTGG + Intergenic
1045315801 8:101042327-101042349 GGGACACAGCGGCACCCTGCAGG + Intergenic
1047788367 8:128176711-128176733 GGGCCACACAAGGAAGCTGCAGG + Intergenic
1048547738 8:135403436-135403458 TGGCCACAGAAGCTTCCAGCTGG - Intergenic
1048753884 8:137713132-137713154 GGGACCCAGAAGGACCCTGATGG - Intergenic
1049003224 8:139839087-139839109 TGGCCAAAGATGCACCCTGAGGG - Intronic
1049431970 8:142569444-142569466 AGGCCATTTAAGCACCCTGCTGG + Intergenic
1049475546 8:142795500-142795522 GTGCTAAAGAAGCACTCTGCAGG - Intergenic
1049775277 8:144401135-144401157 GGGCCACAGAACCCAGCTGCAGG + Intronic
1051164946 9:14251668-14251690 GGGCCACTGGAGCCTCCTGCAGG + Intronic
1052530171 9:29673079-29673101 GGGCCACAGAAATTCCCTGAAGG + Intergenic
1052691596 9:31821915-31821937 TGGCCACAGAAGCTTCCAGCTGG + Intergenic
1053393703 9:37753713-37753735 CGGCCCCACGAGCACCCTGCAGG + Intronic
1053819146 9:41948361-41948383 GGATCACAGAGCCACCCTGCCGG + Intronic
1059494506 9:114698538-114698560 GGGCCAGAAAAGCAGCCTCCAGG - Intergenic
1060201273 9:121652784-121652806 GGGCCACATTCCCACCCTGCAGG + Intronic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1061327084 9:129870342-129870364 GAGCCGCAGAAGGACCCTGAAGG - Intronic
1061601545 9:131673676-131673698 GGGCTACAAAAGCACCCCCCCGG + Intronic
1062137176 9:134935374-134935396 GCTCCACGGAAGCACCCTGCTGG + Intergenic
1062141176 9:134959942-134959964 AAGCCACAGACACACCCTGCAGG + Intergenic
1185750705 X:2608452-2608474 GGGCCCCTGACGCAGCCTGCTGG + Intergenic
1187636931 X:21239040-21239062 GGGTGACAGAAGCACCCTGGTGG - Intergenic
1192215522 X:69155623-69155645 GGGCCTCAGAAGCACCAAACAGG - Intergenic
1193497570 X:82233154-82233176 GGGCAACAGCAGCACAATGCTGG - Intergenic
1196942742 X:120793524-120793546 GGGACACAGAAGGATCTTGCTGG + Intergenic
1197378552 X:125710843-125710865 TGGCCACAGAAGCTTCCAGCTGG + Intergenic