ID: 1143871504

View in Genome Browser
Species Human (GRCh38)
Location 17:9960062-9960084
Sequence AGAGATCCCCAAGCAGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143871504 Original CRISPR AGAGATCCCCAAGCAGGACC TGG Intronic