ID: 1143872006

View in Genome Browser
Species Human (GRCh38)
Location 17:9963926-9963948
Sequence TCTAGGGGGTGGAGGGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1202
Summary {0: 1, 1: 2, 2: 20, 3: 153, 4: 1026}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143872006 Original CRISPR TCTAGGGGGTGGAGGGCAAG GGG Intronic
900171373 1:1270781-1270803 TCAAGGGGCTGGCAGGCAAGAGG - Intronic
900573911 1:3373666-3373688 TCCTGGGGGTGCTGGGCAAGCGG + Intronic
900811105 1:4801939-4801961 TCCAGTGGGTGGTGGGCAAGAGG - Intergenic
901160081 1:7170460-7170482 TGTCGGGGTTGGAGGGCAAGGGG - Intronic
901942368 1:12673058-12673080 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
902102507 1:14003199-14003221 GTTAGGGGGTCGGGGGCAAGAGG + Intergenic
902715739 1:18271606-18271628 CCTAGGGGAGGGAGGGCAAGAGG - Intronic
902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG + Intergenic
903183898 1:21618973-21618995 TCTAGGGGGTGGAGGGGGTCCGG - Intronic
903305175 1:22408203-22408225 TAGAGGGGGTGGAGGGTGAGGGG + Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904458718 1:30662889-30662911 TGTAGGGGGTGGAGTGGAACTGG - Intergenic
904593089 1:31626193-31626215 TCAAGGGGGAGGAGGGAAGGAGG - Intronic
904605032 1:31693347-31693369 TCTTGGGGTGGGAGGGCATGTGG - Intronic
905194590 1:36265825-36265847 TTTAGGGGGTAGGGGGCAAAGGG - Intronic
905312521 1:37059867-37059889 TCACGGGGGTTGAGGGAAAGTGG - Intergenic
905463338 1:38135266-38135288 TCTGGTGGGGGGAGGGAAAGAGG - Intergenic
906183077 1:43838321-43838343 TCTAGGCAGTGGAGGGAAACAGG - Intronic
906842682 1:49157229-49157251 TCTGGGGGGTGGGGGACAAGGGG - Intronic
907574585 1:55514634-55514656 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
908283463 1:62567543-62567565 GTTGGGGGGTGGAGGGCTAGGGG + Intronic
908330090 1:63062750-63062772 TCTCAGGGGTGGAGGGGAGGGGG + Intergenic
908558423 1:65281417-65281439 GCTAGGGGGAGGAGGAAAAGGGG - Intronic
908672795 1:66566856-66566878 GTTAGGGGGTGGGGGGCAAGGGG - Intronic
908807858 1:67949344-67949366 CCTACTGGGTGCAGGGCAAGGGG - Intergenic
908868861 1:68584486-68584508 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
908902186 1:68968447-68968469 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
908909082 1:69051891-69051913 TTTGGGGTGTGGGGGGCAAGAGG - Intergenic
909053448 1:70795534-70795556 TGTTGGGGGTAGGGGGCAAGGGG - Intergenic
909212037 1:72836258-72836280 GTCAGGGGTTGGAGGGCAAGGGG + Intergenic
909340258 1:74523919-74523941 TGTCGGGGGTGGGGGGAAAGGGG - Intronic
909343548 1:74558417-74558439 TGTGGGGGGTTGGGGGCAAGGGG + Intergenic
909456556 1:75856433-75856455 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
909471572 1:76034730-76034752 TTTGTGGGGTGCAGGGCAAGGGG - Intergenic
909698054 1:78489699-78489721 GTTAGGGGGTGGGGGGCAGGGGG + Intronic
909861365 1:80609910-80609932 CCGGTGGGGTGGAGGGCAAGGGG - Intergenic
910632006 1:89364943-89364965 GTCAGTGGGTGGAGGGCAAGGGG - Intronic
910791355 1:91054398-91054420 TCTGGGGGTTGGAAGGTAAGGGG + Intergenic
911058413 1:93727556-93727578 CCTCGTGAGTGGAGGGCAAGAGG - Intronic
911724854 1:101232556-101232578 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
911962109 1:104318670-104318692 TCCAGGTGGTGGATGACAAGAGG + Intergenic
912170022 1:107088262-107088284 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
912749834 1:112277544-112277566 GGCAGGGGGTGGAGGGAAAGTGG + Intergenic
914405066 1:147362407-147362429 TGTGGGGGTTGGAGGGCTAGGGG + Intergenic
914440389 1:147700354-147700376 TCTAGAGGGCGGAGGCCAAAGGG + Intergenic
915041194 1:152969530-152969552 TCTTTGGGGTAGAGGGCTAGAGG + Intergenic
915066814 1:153231701-153231723 TCTGGGGGGTGACGGGGAAGAGG - Intergenic
915833062 1:159148874-159148896 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
916614297 1:166423601-166423623 GTCAGGGGGTGGAGGGCTAGGGG - Intergenic
917019941 1:170575204-170575226 TGTTGGGGGTGGGGGGCAAAGGG + Intergenic
917037345 1:170763243-170763265 TTTTGGGGGTGGGGGGCTAGGGG + Intergenic
917070859 1:171149211-171149233 TCGGGGGGATGGAGGGCTAGGGG - Intronic
917248047 1:173025757-173025779 ACTTGAGGGTGTAGGGCAAGAGG - Intergenic
917710448 1:177679217-177679239 ACTAGGGGGTGGGGGACAAGGGG - Intergenic
917715191 1:177728191-177728213 TCGGGGGGGTCGGGGGCAAGGGG + Intergenic
918353218 1:183679382-183679404 TGTCGGGGGTGGGGGGCAAGGGG - Intronic
918448732 1:184639364-184639386 TCTAGGTGGTGGGGGGCTGGGGG - Intergenic
918766164 1:188486492-188486514 CTCAGGGGGTGGTGGGCAAGGGG + Intergenic
919082339 1:192881374-192881396 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
919266360 1:195271629-195271651 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
919901382 1:202046465-202046487 TCTTGGGGGTGGAGAGCGGGTGG + Intergenic
920055699 1:203189794-203189816 TGTAGGGGACGGTGGGCAAGGGG - Intergenic
920584376 1:207143331-207143353 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
920994059 1:210970260-210970282 TGTTGGGGGTGGGGGACAAGGGG - Intronic
921753065 1:218819916-218819938 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
923011643 1:230092837-230092859 TTTAGGGGGTAGAGGGGATGAGG + Intronic
923418153 1:233785350-233785372 TTTAGGGGGTGGGAGGCAAGGGG + Intergenic
923469328 1:234276932-234276954 TGAAGCAGGTGGAGGGCAAGAGG + Intronic
923727050 1:236515560-236515582 TTTTGGGGGTGGAGGGGCAGTGG + Intergenic
924388845 1:243528469-243528491 ACTTGAGGGTGGAGGGCAGGAGG - Intronic
924496642 1:244596604-244596626 TGTCTGGGGTGGGGGGCAAGGGG + Intronic
924649914 1:245916747-245916769 GCTAGAGGGTGGAGTGCAGGGGG - Intronic
924837070 1:247660950-247660972 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1063291304 10:4752490-4752512 TCGAGGGGGTGGGGGGCTACAGG + Intergenic
1063912101 10:10840836-10840858 GTTAGGGGGTGGGGGACAAGGGG - Intergenic
1064046167 10:12017887-12017909 TCTGGGGGTTGGAGGGCCAGGGG - Intronic
1064236111 10:13577377-13577399 TGCAGGGGGTGGAGGGCTAGGGG - Intergenic
1064254031 10:13729057-13729079 AGTAGGAGGTGGAGGGCATGGGG - Intronic
1064729882 10:18319443-18319465 CTCAGGGGGTGGGGGGCAAGGGG + Intronic
1064733761 10:18359748-18359770 GCTGGGGGGTGGGGGGCTAGAGG - Intronic
1064788929 10:18933705-18933727 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1064816618 10:19272678-19272700 TGTGGTGGGTGGAGGGCAAGGGG - Intronic
1064978442 10:21142864-21142886 TGTTGGGGGTGGGGGGCAGGAGG - Intronic
1065862683 10:29885101-29885123 ACTGGAGGGTGGAGGGCAGGAGG - Intergenic
1066150437 10:32610566-32610588 TTGTGGGGGTAGAGGGCAAGGGG - Intronic
1066187011 10:33019981-33020003 TCACGGGGGTGGGGGGCAAGGGG - Intergenic
1066256951 10:33689407-33689429 GTTAGGGGGTGGGGGGCAAGGGG - Intergenic
1066499813 10:35981701-35981723 TTCAGGGGGTGGGGGACAAGGGG - Intergenic
1066719790 10:38325419-38325441 GCTGGGGGATGGGGGGCAAGGGG + Intergenic
1067226932 10:44382684-44382706 CCCAGGGGGTGGAGGGGGAGAGG - Intronic
1067266907 10:44754346-44754368 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1067677662 10:48398833-48398855 GCTAGGAGTTGGGGGGCAAGGGG + Intronic
1068034511 10:51742876-51742898 TTCAGGAGGTGGGGGGCAAGGGG + Intronic
1069914030 10:71776203-71776225 TCTTGGGGGTGGAGGGCATTGGG - Intronic
1070349851 10:75581780-75581802 TTTAGGGGGTGGGGGGCTAGGGG + Intronic
1070774858 10:79103582-79103604 TCTAGGGGAGGGAGGGCAAGGGG + Intronic
1071108324 10:82124561-82124583 GTCGGGGGGTGGAGGGCAAGAGG + Intronic
1071494068 10:86155752-86155774 TCTAGTGGGTGTAGGGGAATAGG + Intronic
1072045442 10:91650132-91650154 TCCAGGGGGTGGGGGGCAAGGGG + Intergenic
1072372562 10:94779110-94779132 TTGAGGGGTTGGGGGGCAAGGGG + Intronic
1072393001 10:95008285-95008307 GTCAGGGGGTGGGGGGCAAGAGG - Intergenic
1072617520 10:97059591-97059613 TCTAGGAGGTGGAGGGGACTGGG - Intronic
1073300069 10:102465760-102465782 TTGAGGGTGGGGAGGGCAAGTGG + Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1073885415 10:108033939-108033961 TTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1073968949 10:109024726-109024748 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1074083328 10:110185589-110185611 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
1074737808 10:116453931-116453953 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1075058741 10:119239676-119239698 ATTAGGGGGTGGGGGGCTAGGGG - Intronic
1075357722 10:121797491-121797513 GCTAGGGGCTAGGGGGCAAGGGG - Intronic
1075683873 10:124350589-124350611 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
1076396769 10:130144453-130144475 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1076884267 10:133254433-133254455 TCAAGGGGCTGGTGGGCCAGGGG + Intergenic
1077776378 11:5276409-5276431 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1077901659 11:6494969-6494991 TCTAGGGGGTGGGGGGTGTGGGG - Intronic
1077971314 11:7193970-7193992 GTCAGGGGGTCGAGGGCAAGGGG + Intergenic
1078059799 11:8035830-8035852 TCTAGGGGGAGGACAGCATGAGG + Intronic
1078392322 11:10946434-10946456 TCTTGGGGGTGGTGGGTTAGGGG - Intergenic
1078458270 11:11492742-11492764 TTCGGGGGGTGGGGGGCAAGGGG + Intronic
1078560954 11:12371931-12371953 TTTGGGGGGTGGGGGGCTAGGGG + Intergenic
1078998918 11:16733573-16733595 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1079263170 11:18903423-18903445 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1079286107 11:19134703-19134725 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1079362457 11:19780354-19780376 ACTAGGGTGTGGAGGGAAGGTGG - Intronic
1079426617 11:20348625-20348647 TTTGGGGGGTGGCAGGCAAGGGG + Intergenic
1079550597 11:21692699-21692721 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1079863547 11:25705896-25705918 TGTTGGGGGTGGAGGTCAAGGGG - Intergenic
1080038790 11:27737155-27737177 GCCAAGGGGTGCAGGGCAAGAGG - Intergenic
1080040688 11:27756608-27756630 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1080164356 11:29219143-29219165 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1080670716 11:34374133-34374155 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1081452976 11:43191112-43191134 ACTTGAGGGTGGAGGGCGAGAGG - Intergenic
1081508951 11:43748456-43748478 ACTAGAGGGTGGAGGGAAAGGGG + Intronic
1081842215 11:46210865-46210887 ACTAGGGGGAGGAGGGAGAGAGG - Intergenic
1081976738 11:47240082-47240104 CCTAGGAGGTGGAGGGAAGGGGG + Exonic
1082304906 11:50560464-50560486 TATAGGGGGTGGGGAGCTAGGGG - Intergenic
1082637793 11:55617675-55617697 TACGGGGGGTGGGGGGCAAGGGG + Intergenic
1082726082 11:56738370-56738392 GTTGGGGGTTGGAGGGCAAGGGG - Intergenic
1082776403 11:57248118-57248140 GGTGGGGGGTGGAGGGCAAGGGG + Intergenic
1082886343 11:58087710-58087732 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1082957824 11:58890094-58890116 ACTAGAGGGTGGAGGGAAAGGGG - Intronic
1082957935 11:58891595-58891617 CCTAGAGGGTGGAGGGAAAGGGG - Intronic
1082973373 11:59047713-59047735 TCTAGAGGGTGGAGGGAAAGGGG - Intergenic
1082977786 11:59091489-59091511 TCTAGAGGGTGGAGGGAAAGGGG - Intergenic
1083072954 11:60005793-60005815 GCTGGAGGGTGGAGGACAAGGGG - Intergenic
1083507563 11:63173213-63173235 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1083792900 11:64997206-64997228 TCTAGGGGAGGGAGGACAGGCGG + Intergenic
1083880854 11:65547598-65547620 TGTAGGAGGCGGCGGGCAAGGGG + Intronic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084084193 11:66847417-66847439 TCTCCGGGGTGGGGGGCAGGGGG + Intergenic
1084360041 11:68663391-68663413 TCTAGGGGGTGCAGGTCAGAGGG - Intergenic
1084408088 11:68990421-68990443 GCTAGGGGTGGGAGGGCTAGAGG - Intergenic
1084587892 11:70073840-70073862 TCTTGGGGGTGGGGGGCGGGGGG - Intergenic
1084722676 11:70917851-70917873 TCAGGGGGGTGGAGGGTGAGAGG + Intronic
1085490330 11:76910119-76910141 GTTGGGGGGTGGGGGGCAAGGGG + Intronic
1086028096 11:82319204-82319226 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1086037568 11:82435333-82435355 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1086256545 11:84883305-84883327 GTTAGGGGGTGGGGGACAAGGGG + Intronic
1086276017 11:85130052-85130074 TTTGAGGGGTGGGGGGCAAGAGG + Intronic
1086277446 11:85147898-85147920 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1086752685 11:90517985-90518007 TATTGGGGGTGTAGGGCATGTGG + Intergenic
1086972853 11:93102305-93102327 TTTTAGGGGTGGGGGGCAAGGGG - Intergenic
1087097351 11:94331843-94331865 TTCAGGGGGTGGGGGGCTAGGGG + Intergenic
1087610378 11:100426908-100426930 TCTAGGGGGTGGGAAGCAAGGGG + Intergenic
1087618300 11:100514046-100514068 TTCATGGGGTGGAGGGCAATGGG - Intergenic
1087686247 11:101268977-101268999 TGTTGGGGGTGGTGGGCAAGGGG - Intergenic
1087710547 11:101544725-101544747 TGTTGGGGGTGGCGGGCTAGGGG + Intronic
1087749818 11:101995019-101995041 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1087937064 11:104046886-104046908 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1088111707 11:106268663-106268685 TGTTGGGAGTGGAGGGCAAGGGG - Intergenic
1088179981 11:107098317-107098339 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1088360031 11:108979980-108980002 ATTGAGGGGTGGAGGGCAAGGGG - Intergenic
1089365627 11:117919242-117919264 TGTAGGAGGTGGAAGGGAAGAGG - Intronic
1089648971 11:119899633-119899655 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1089694202 11:120206637-120206659 TCAAGGGTGTGGTGGGAAAGTGG - Intergenic
1089706079 11:120278760-120278782 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
1089827380 11:121291029-121291051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1090146080 11:124324554-124324576 TCTCAGGGGTGGGGGACAAGAGG - Intergenic
1090261735 11:125326220-125326242 AATAGGGTGAGGAGGGCAAGAGG + Intronic
1090261942 11:125327600-125327622 GCTTGAGTGTGGAGGGCAAGAGG + Intronic
1090324889 11:125876759-125876781 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1090347889 11:126085353-126085375 TGTAGGGGGTGTAGCGGAAGAGG + Intergenic
1090451057 11:126806828-126806850 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1090572265 11:128060313-128060335 TCTAGTGGGTGGAGGACAGAGGG - Intergenic
1090608629 11:128450812-128450834 ACCAGGGGGTGGTGGGCTAGGGG + Intergenic
1091161153 11:133422112-133422134 GCCAGGGGGTGGGGGGCTAGGGG - Intronic
1091166944 11:133486904-133486926 TGTAGGGGGTGGAGGGGAAGAGG - Intronic
1091180866 11:133603357-133603379 AGCAGGGGGTGGAGGGGAAGAGG + Intergenic
1091235894 11:134021803-134021825 TGTTGGGGGTGGTGGGGAAGGGG + Intergenic
1091642930 12:2251221-2251243 TCATGGGGGTGAAGGGCAAAGGG + Intronic
1092023448 12:5221719-5221741 TCTAGGTGGTAGAGGGCAAAAGG + Intergenic
1092045526 12:5430027-5430049 TCTGGAGGGAGGAGGGGAAGGGG - Intergenic
1092236832 12:6815746-6815768 TCTAAGGAGTGGAGGCCAAATGG + Intronic
1092507441 12:9118315-9118337 TCTGGTGACTGGAGGGCAAGTGG + Intergenic
1092550796 12:9496989-9497011 TGTCGGGGGTTGGGGGCAAGGGG + Intergenic
1093977274 12:25437218-25437240 TTTGGGGGGTGGGGGGCAAGGGG + Intronic
1094304415 12:29001449-29001471 CCCAGGAGATGGAGGGCAAGAGG + Intergenic
1094379530 12:29828327-29828349 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
1094407464 12:30132734-30132756 ACTCGAGGGTGGAGGGTAAGAGG + Intergenic
1094521022 12:31189380-31189402 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1094535959 12:31323686-31323708 TCTAGGGGGTGGGGGGAGCGGGG - Intronic
1094598309 12:31885289-31885311 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1095356944 12:41285847-41285869 GTCAGGGGGTGGTGGGCAAGGGG + Intronic
1096113402 12:49041584-49041606 TCTTGAGGGTGGAGGGCCATGGG - Intronic
1096242071 12:49964919-49964941 TCTGTGGGGTGGGGGGCATGTGG + Intronic
1096424909 12:51492835-51492857 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
1096453552 12:51766467-51766489 TCTAGTGGGTAGAGGCCAGGAGG - Intronic
1096706957 12:53428315-53428337 AGTAGCAGGTGGAGGGCAAGTGG - Intronic
1096902389 12:54898631-54898653 TCGGGGGGGTGGAGTGAAAGGGG + Intergenic
1097054355 12:56240956-56240978 ATTAGGTGGTGGGGGGCAAGGGG - Exonic
1097299347 12:58001907-58001929 GCTGGGGGGTGCAGGGCTAGAGG - Intergenic
1097375306 12:58836195-58836217 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1097460285 12:59853863-59853885 TCAGGGTGGTGGAGGGCTAGGGG - Intergenic
1097505883 12:60469242-60469264 ACCAGGGGGTGGAGGGTGAGAGG - Intergenic
1097552055 12:61085284-61085306 GCTAGGGGCTTGAGGGTAAGTGG + Intergenic
1097922987 12:65096860-65096882 TGTTAGGAGTGGAGGGCAAGGGG + Intronic
1098106472 12:67072636-67072658 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1098151301 12:67549860-67549882 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1098287453 12:68921530-68921552 TTTAGGGGGCTGAAGGCAAGGGG + Intronic
1098308759 12:69127161-69127183 TCTTGGGGGTGGAGGGTGGGAGG - Intergenic
1098780704 12:74682372-74682394 TCAGGGGGGTGGGGGGCTAGGGG + Intergenic
1099275409 12:80569732-80569754 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1099316997 12:81096616-81096638 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1099431445 12:82591157-82591179 TGTTGGGGGTGGAGGGCTACAGG + Intergenic
1099485713 12:83226982-83227004 ACCAGGGGGTGGAGAGCAAGGGG - Intergenic
1099647159 12:85372643-85372665 ACTTGAGGGTGGAGGGTAAGGGG - Intergenic
1099687646 12:85909831-85909853 GCCGGGGGGTGGGGGGCAAGGGG + Intergenic
1100054002 12:90487310-90487332 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1100229801 12:92595357-92595379 ACTAGAGGGTGGAGGGTAGGAGG - Intergenic
1100317197 12:93455262-93455284 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
1100374590 12:94002484-94002506 TATAGGGGGTGGGGAGCTAGGGG - Intergenic
1100764846 12:97852326-97852348 TGTGGGGGGTGGGGAGCAAGGGG + Intergenic
1100860428 12:98799843-98799865 GCTGGTGGGGGGAGGGCAAGGGG - Intronic
1101067776 12:101040749-101040771 TATGGGGGGTGGGGGGCTAGGGG - Intronic
1101512261 12:105404122-105404144 TGTCAGGGGTGGAGGGCTAGGGG - Intergenic
1101562999 12:105877633-105877655 TATTGGGGGTGGGGGGCTAGGGG - Intergenic
1101568606 12:105932983-105933005 TTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1101715549 12:107309048-107309070 TCAAGCAGCTGGAGGGCAAGAGG - Intergenic
1102568209 12:113811108-113811130 TGTTGGGGGTGGAGGGCTAAGGG - Intergenic
1102929188 12:116849552-116849574 CAGAGGTGGTGGAGGGCAAGAGG - Exonic
1103249240 12:119485907-119485929 ACAAGGTGGTGGAGGGGAAGCGG - Intronic
1103268060 12:119647768-119647790 TCGGGGGGGTGGGGGGCAAAGGG - Intergenic
1104168589 12:126257909-126257931 ACTAGAGGGTGGAGGGAGAGTGG + Intergenic
1104321777 12:127758299-127758321 TCTGGGGGTTGGGGGGTAAGGGG + Intergenic
1104485635 12:129149223-129149245 GTTGGGGGGTGGGGGGCAAGGGG + Intronic
1104499516 12:129271555-129271577 GTTAGGGGGTGGGGGGCAAGGGG - Intronic
1104546581 12:129718338-129718360 TCCAGGGAGGGGAGGGGAAGGGG + Intronic
1105034266 12:132907643-132907665 TGTCGGGGGTGGGGGGCCAGGGG - Intronic
1105431356 13:20340321-20340343 CCCAGGGGCTGGAGGGCAGGTGG - Intergenic
1105821882 13:24087348-24087370 CCTGGGGGAGGGAGGGCAAGGGG - Intronic
1106085245 13:26535835-26535857 TGTATGGGGTGGTGGGGAAGTGG + Intergenic
1106376819 13:29197214-29197236 TCCAGGGGATGGGGGGCAAGGGG - Intronic
1106749846 13:32751026-32751048 TCTTGAGGGTGGAGGGTAGGAGG - Intronic
1107412608 13:40172093-40172115 ACTAGGGGGTGGAGGGTGGGAGG - Intergenic
1107673499 13:42771058-42771080 TTCAGGGGGTAGAGGGCAAGGGG - Intergenic
1108015280 13:46068687-46068709 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1108145197 13:47469517-47469539 GTTAGGGGGTGGAGGGTGAGGGG + Intergenic
1108154303 13:47569864-47569886 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1108165861 13:47692431-47692453 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1108459069 13:50647152-50647174 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1108854056 13:54771868-54771890 GCCAGGGGGTGGAGGGCAAGGGG - Intergenic
1109004721 13:56857476-56857498 TGTGGGGGGTGGGGGACAAGGGG + Intergenic
1109755527 13:66754223-66754245 GTCAGTGGGTGGAGGGCAAGTGG + Intronic
1109938535 13:69327558-69327580 TTCAGGGGGTGGAGGCTAAGGGG - Intergenic
1110200555 13:72845134-72845156 ACTTGGGGGTGGGGGGCAAGGGG - Intronic
1110655688 13:77996006-77996028 TGTAGGGAGTGGGGAGCAAGGGG + Intergenic
1110789883 13:79576009-79576031 TTTCGGGGGTGTGGGGCAAGGGG - Intergenic
1110822688 13:79934767-79934789 CTTAGTGGGTGGAGGGCAAGGGG + Intergenic
1111043518 13:82783800-82783822 TTTGGTGGGTGGAGGGCTAGGGG - Intergenic
1111284595 13:86072192-86072214 TGTCGGGGGTTGGGGGCAAGAGG + Intergenic
1111773304 13:92626393-92626415 TCTAGAGGTGAGAGGGCAAGAGG + Intronic
1111814842 13:93139494-93139516 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1111835835 13:93387320-93387342 TGTTGGGGGTGGAGGGGAAGGGG - Intronic
1111861853 13:93717756-93717778 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
1112071598 13:95858046-95858068 TGTTGGTGGTGGAGGGCAAATGG + Intronic
1112081621 13:95978018-95978040 GCCAGGGGGTAGGGGGCAAGGGG + Intronic
1112911700 13:104493477-104493499 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1113046714 13:106164051-106164073 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1113809033 13:113126418-113126440 GCTCGGGGGTGGATGCCAAGGGG + Intronic
1114582290 14:23773134-23773156 TCTAGGAGGAGGAGGGCAGCAGG - Intergenic
1114600153 14:23949443-23949465 TCAGGGGGGTGGGGGGCTAGGGG + Intergenic
1114609783 14:24031697-24031719 TCTGGAGCGTGGAGGGCTAGGGG + Intergenic
1114694881 14:24617526-24617548 ATTGGGGGGTGGGGGGCAAGAGG - Intergenic
1114700767 14:24676057-24676079 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
1114742856 14:25115949-25115971 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1114797365 14:25731750-25731772 TGTCGGGGGTGGAGGGCTAGGGG - Intergenic
1115016077 14:28615959-28615981 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1115385421 14:32790763-32790785 GCCAGGGAGTGGGGGGCAAGGGG - Intronic
1115538620 14:34397493-34397515 TGTCGGGGGTGGGGGGCTAGAGG + Intronic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1115842239 14:37484988-37485010 GTCAGGGGGTGGAGGGGAAGGGG - Intronic
1116565896 14:46443645-46443667 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1116902478 14:50374933-50374955 GTTGGGGGTTGGAGGGCAAGAGG + Intronic
1117063722 14:51988453-51988475 TATAGGGGCTGGAGGGTGAGAGG - Intergenic
1117399346 14:55344708-55344730 TGGTGGGGGTGGAGGACAAGGGG - Intronic
1117911216 14:60640008-60640030 TTTGGGGGGTGGAAGGGAAGAGG + Intergenic
1117920324 14:60721807-60721829 TCTAGTGGGCGCAGGGCAGGTGG + Intronic
1118035061 14:61857611-61857633 TCAAGAGGCTGGAGGGGAAGTGG + Intergenic
1118063950 14:62170321-62170343 TCAGGGCGGTGGGGGGCAAGGGG - Intergenic
1118088533 14:62446239-62446261 GTCAGGGGGTGGAGGGCTAGGGG - Intergenic
1118395875 14:65336085-65336107 TCTAGGGGGTGGGGGAATAGGGG - Intergenic
1118428252 14:65691112-65691134 TTTGGGGGGTGGAGGGGCAGGGG + Intronic
1118490788 14:66257730-66257752 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1118496732 14:66314970-66314992 TGTTGGGGGTGGGGAGCAAGTGG - Intergenic
1118664323 14:68050298-68050320 TCAAGGGGGTGATGGGGAAGAGG - Intronic
1119028373 14:71171731-71171753 TCTGGGGAATGGGGGGCAAGGGG + Intergenic
1119120085 14:72067308-72067330 TCGGGGAGGTGGAGGACAAGGGG + Intronic
1119552113 14:75522570-75522592 TGTAGGGGGTGGTGGGCTGGTGG + Exonic
1119586441 14:75840390-75840412 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1120022650 14:79548182-79548204 TCAGGTGGGTGGAGGGCTAGGGG - Intronic
1120351764 14:83369922-83369944 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1121838302 14:97111860-97111882 TGTAGGGGGTGGAGGATAGGTGG + Intergenic
1121942800 14:98089224-98089246 GTCGGGGGGTGGAGGGCAAGGGG - Intergenic
1122127068 14:99585086-99585108 TTTTGGGGGTGGAGGGGACGGGG - Intronic
1122367776 14:101204909-101204931 GCTGTGGGGTGGAGGGCTAGGGG - Intergenic
1122391178 14:101386242-101386264 GTTTGTGGGTGGAGGGCAAGGGG - Intergenic
1122487422 14:102090364-102090386 ACTTGGGGTTGGAGGGCTAGAGG - Intronic
1122654103 14:103245676-103245698 GTTAGGGGGTAAAGGGCAAGGGG - Intergenic
1122837129 14:104435824-104435846 TCTTGGGGGTAGAGTGCAAAGGG - Intergenic
1123400993 15:19986235-19986257 TGTTGGGGGTGGGGGGCAAGAGG + Intergenic
1123968491 15:25482144-25482166 TCGCGGGGGTGGGGGGCTAGGGG - Intergenic
1124639856 15:31391053-31391075 TCTATGGGGTGGAGGGCTGTGGG + Intronic
1125104004 15:35949646-35949668 TCATGGGGGTGGGGGGCTAGCGG + Intergenic
1125142280 15:36422432-36422454 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1125361695 15:38871401-38871423 GCAAGGGGGTGGAGGGGCAGAGG - Intergenic
1125363889 15:38893012-38893034 TGTTGGGGGTGGGGGGCAGGGGG + Intergenic
1125578069 15:40768402-40768424 GCTACGGGGTAGAGGGAAAGGGG - Intronic
1125596614 15:40891310-40891332 GCTAGGGAGTGGAGGGAATGAGG - Intergenic
1126559917 15:50032179-50032201 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1126839550 15:52703688-52703710 GTTAGGGGGTGGGGGGCTAGGGG + Intronic
1127055569 15:55127549-55127571 ATTAGGAGGTGGGGGGCAAGGGG + Intergenic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1128067639 15:64774897-64774919 GCTACGGGGTGGGGAGCAAGGGG + Intronic
1128147074 15:65337692-65337714 TCCTGGAGGTGGAGGGCTAGAGG - Intronic
1128610558 15:69069679-69069701 TCTTGGGGTTGGGGGGCTAGGGG + Intergenic
1128767063 15:70257717-70257739 TCCAGGGTGAGGAGGGCATGTGG + Intergenic
1128806511 15:70535084-70535106 TCTAGGGGTTGTAGGGCCGGGGG + Intergenic
1129230579 15:74195059-74195081 TCTAGGAGGTGGCGGAGAAGGGG - Intronic
1129313259 15:74726442-74726464 TCTAGGGGGCAGAGGTCAGGCGG + Intergenic
1129707048 15:77800215-77800237 GCTGGCAGGTGGAGGGCAAGGGG + Intronic
1129919359 15:79307139-79307161 GCTAGGGGGTGGGGGGCTTGGGG - Intergenic
1131293514 15:91127701-91127723 TGTGGTGGGTGGAGGGCAGGAGG + Intronic
1131994247 15:98119125-98119147 TCTTGGGGGTGGTGGGCAGAGGG + Intergenic
1132262291 15:100436467-100436489 TATCGGGGCTGGGGGGCAAGGGG + Intronic
1132566309 16:625170-625192 TCCAGGGGAGGGAGGGGAAGCGG + Intronic
1132943494 16:2519959-2519981 TCTAGGGGGTGGGGCGCCGGGGG - Exonic
1133114680 16:3570574-3570596 TCTAGGGGGAGGAGGAGCAGAGG + Intronic
1133431148 16:5738001-5738023 TGGAGGGGGTGGGGGGCAAGGGG - Intergenic
1133492337 16:6282532-6282554 TGTCGGGGGTGGTGGGCAATGGG - Intronic
1133899820 16:9963427-9963449 TGTCAGGGGTGGGGGGCAAGAGG - Intronic
1134257893 16:12626590-12626612 TCTAAGGGGATGAGGGCCAGGGG - Intergenic
1134344865 16:13380816-13380838 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
1134355905 16:13482119-13482141 TCTAGAAGCTGGAGAGCAAGAGG - Intergenic
1134659511 16:15973382-15973404 TCTAGTGGGTAGAGGCCAGGGGG + Intronic
1134800540 16:17080482-17080504 TGTCGGGGGTGGGGGGAAAGGGG - Intergenic
1135185719 16:20314069-20314091 TCCAGGGGATGGGGGGCAAGGGG + Intronic
1135528076 16:23229185-23229207 TATAGGGGTTGGAGGCCAAAAGG + Intergenic
1135536699 16:23300187-23300209 GTCAGGGGGTGGAGGGCTAGGGG + Intronic
1135639198 16:24105527-24105549 GTTAGGGGGTGAGGGGCAAGGGG - Intronic
1135732263 16:24904934-24904956 GTCGGGGGGTGGAGGGCAAGGGG - Intronic
1135759889 16:25128902-25128924 TGTCAGGGGTGGGGGGCAAGGGG + Intronic
1135796651 16:25450545-25450567 GTCAGGGGGTGGAGGGCTAGGGG - Intergenic
1135974798 16:27101200-27101222 TTCAGCGGGTGGGGGGCAAGGGG + Intergenic
1136173029 16:28499613-28499635 TCTAAAGGGTGGGGGGCAGGGGG + Exonic
1136229681 16:28879031-28879053 TCTTGGGTGTGGGGGGCATGAGG + Intronic
1137020280 16:35418356-35418378 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1137040275 16:35604837-35604859 TCTGCAGGGTGGATGGCAAGAGG + Intergenic
1137462753 16:48680268-48680290 TGTCGGGGGTGGGGGGCCAGGGG + Intergenic
1138097026 16:54219811-54219833 GGTGGGGGATGGAGGGCAAGAGG + Intergenic
1138175974 16:54898587-54898609 TTGTGGGGGTGGAGGGCAAGGGG - Intergenic
1138306043 16:55975629-55975651 ACCAGGGGGTGGGGGGCTAGGGG + Intergenic
1138850880 16:60627909-60627931 GTCAGGGGGTTGAGGGCAAGGGG + Intergenic
1138931653 16:61665499-61665521 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1140384160 16:74519330-74519352 TTTTGGGGGTGGGGGGCTAGGGG + Intronic
1140552281 16:75879673-75879695 TTTAGGGGTTGGGGGGCAAGGGG + Intergenic
1140559076 16:75956102-75956124 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
1140604270 16:76516087-76516109 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
1140657535 16:77155850-77155872 TGTGGGGGGTGGGGGGCTAGGGG + Intergenic
1141052768 16:80786915-80786937 TGTGGGGGGTGGGGGGCTAGGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141981912 16:87556058-87556080 TCGATGGGGTGGAGGCCACGTGG + Intergenic
1142070217 16:88087728-88087750 TCACGGGGGTGTAGGGGAAGCGG - Intronic
1142088156 16:88195481-88195503 TCTGAGGGCTGGAGGGGAAGTGG + Intergenic
1142615040 17:1129176-1129198 GTTGGAGGGTGGAGGGCAAGGGG + Intronic
1142931290 17:3286060-3286082 CTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1143304390 17:5934292-5934314 GCCAGTGGGTGGGGGGCAAGGGG - Intronic
1143308612 17:5969760-5969782 GCCAGGGGGTGGGGGGCTAGGGG + Intronic
1143412116 17:6715594-6715616 TCAGGGGGTTGGAGGGCAAGGGG - Intergenic
1143570314 17:7754007-7754029 TCCATGGGGTGGAGTGCTAGGGG + Intronic
1143703817 17:8682584-8682606 TGTGGGGGGTGGGGGGCTAGGGG - Intergenic
1143872006 17:9963926-9963948 TCTAGGGGGTGGAGGGCAAGGGG + Intronic
1145036071 17:19541398-19541420 TCTAGTGGGTGGGGGGCAGGAGG + Intronic
1145715530 17:27016549-27016571 TATGGGGGGTGGGGGGCTAGGGG - Intergenic
1146556351 17:33827870-33827892 TGTCGGGAGTGGAGGGAAAGAGG - Intronic
1146649216 17:34596446-34596468 ACTAGGGGCTGGAGGCCTAGAGG - Intronic
1146895663 17:36539951-36539973 TCTGGGGGCTGGGGGGCAAATGG + Intronic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1147541162 17:41361171-41361193 TTTGGGGGGTGGGGGGCTAGGGG - Intergenic
1147571399 17:41573327-41573349 TCTTGAGGGTGGAGGGAAACTGG - Intergenic
1147645583 17:42031784-42031806 TCTGGGGAGGGGAGGGCAAGAGG + Exonic
1147776810 17:42907649-42907671 TGTAGGTGGTGGAGGGCAGGAGG + Intronic
1147969836 17:44213282-44213304 TCTGGGGGGAGGAGGGGATGGGG + Exonic
1148177599 17:45581168-45581190 TCCGGGGGGTGGGGGGCGAGGGG + Intergenic
1148470695 17:47891406-47891428 TCGGGGGGGTGGAGGGCTGGGGG - Intergenic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149061353 17:52426010-52426032 GTTAGGGGGTGGGGAGCAAGGGG + Intergenic
1149377345 17:56058581-56058603 TTTGGGGGGTAGGGGGCAAGGGG - Intergenic
1149728866 17:58924722-58924744 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
1150255509 17:63741462-63741484 CCTAGGGGGTGGGGAGGAAGGGG + Intronic
1150636484 17:66916717-66916739 GCAGGGAGGTGGAGGGCAAGTGG + Intergenic
1150747731 17:67829462-67829484 TCCGGGGGGTGGGGGGCAAGGGG - Intronic
1150854190 17:68734804-68734826 TCAAGGGGGTTGAGGGCAGAGGG - Intergenic
1151186768 17:72370556-72370578 TGTCGGGGGTCGGGGGCAAGGGG + Intergenic
1151198545 17:72450417-72450439 TTGCGGGGGTGGGGGGCAAGGGG - Intergenic
1152296805 17:79472140-79472162 TCTCTGGGATGGAGGCCAAGTGG - Intronic
1153066092 18:1046727-1046749 TCGGGGGGTTGGGGGGCAAGGGG - Intergenic
1153368610 18:4287679-4287701 GTCATGGGGTGGAGGGCAAGGGG + Intronic
1153951800 18:10064072-10064094 CTTGGGGGGTGGGGGGCAAGGGG + Intergenic
1154264003 18:12863549-12863571 TTTGGGGGGGGGGGGGCAAGTGG + Intronic
1155096239 18:22559277-22559299 TCTCGGGGGTGTAGGGGCAGCGG + Intergenic
1155711464 18:28885854-28885876 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1155929547 18:31690985-31691007 TCAGTGGGGTGGGGGGCAAGGGG + Intergenic
1156228910 18:35135390-35135412 TCTGGGAGGTGGAGTGCTAGGGG - Intronic
1156309356 18:35908222-35908244 TGTAGCAGGTGGAGGGCCAGGGG + Intergenic
1156442774 18:37208180-37208202 TGTAGGGGGAGGAGGGAAGGTGG - Intronic
1156626367 18:38914861-38914883 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1157107955 18:44792551-44792573 TCCAGGCGGTGGTGGGCAACAGG - Intronic
1157532666 18:48434766-48434788 GTTAGGGGGTGGGGGGCTAGGGG + Intergenic
1158036953 18:53043309-53043331 GCTGGGGGTTGGGGGGCAAGGGG + Intronic
1158390757 18:57043124-57043146 TGTCGGGGGTGGAGGGCAAGGGG + Intergenic
1158735056 18:60069746-60069768 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1159082294 18:63748926-63748948 TTTGGGGGGTGGGGAGCAAGGGG + Intergenic
1159254979 18:65933593-65933615 TATTGGGAGTGGAGGGCAAGAGG + Intergenic
1160275600 18:77430818-77430840 TCGAGGGGTTGGGGGGCTAGGGG + Intergenic
1160456531 18:79006105-79006127 TCGTGGGGGTGGAGGGCGCGTGG + Intergenic
1160479309 18:79224392-79224414 TCTGTGGGGTGGAAAGCAAGTGG + Intronic
1161160210 19:2757532-2757554 TCTTTGGGGTGGAGGGCCCGAGG - Intronic
1161966900 19:7554093-7554115 TTTGGGGGGTGGAGGGGAACAGG + Intronic
1162824251 19:13241919-13241941 TTTAGGGGGCAGAGGGCATGCGG - Intronic
1163136825 19:15317599-15317621 AGTGGGGGGTGGTGGGCAAGGGG + Intronic
1163453346 19:17391846-17391868 TCTGAGGAGTGGAGGGGAAGTGG + Intergenic
1163565458 19:18048525-18048547 TCATGGGGGTGGTGGGCATGAGG - Intergenic
1164460024 19:28438822-28438844 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1164926726 19:32136534-32136556 GTTGGGGGGTGGGGGGCAAGAGG + Intergenic
1164940507 19:32249428-32249450 TCTTGGGGGTGGAGTGGAGGTGG - Intergenic
1165003203 19:32782112-32782134 TGTGGGGGGTGGGGGGCTAGGGG - Intronic
1165121488 19:33561695-33561717 TCTAGGGGTTGGGGGGCAAGGGG - Intergenic
1165425395 19:35742687-35742709 TGTTGGGGGTGAAGGGTAAGGGG + Exonic
1165940098 19:39410564-39410586 GCTAGGGGGAGGAGGGGAAGAGG - Intergenic
1166040857 19:40201961-40201983 CCTGGGGGGTGGGGGACAAGGGG - Intronic
1166060183 19:40321133-40321155 TATGGCGGGTGGTGGGCAAGGGG - Exonic
1166252018 19:41577828-41577850 TCTATGAGGAGGAGGCCAAGGGG - Intronic
1166263716 19:41663014-41663036 TGTCAGGGGTGGAGGGCTAGGGG + Intronic
1166616229 19:44249866-44249888 TCTAGGGGGTGGAGGGGAGGTGG - Intronic
1166632684 19:44421024-44421046 GTTGGTGGGTGGAGGGCAAGGGG - Intronic
1167135475 19:47612949-47612971 TCTCGGGGGAGGTGGGCAGGAGG + Intronic
1167275724 19:48538058-48538080 GGTGGGGGGTGGGGGGCAAGGGG - Intergenic
1167599658 19:50447120-50447142 ACTGGGGGGTGGAGGTCAAGGGG - Intronic
1167884268 19:52487563-52487585 CCTAGGATGAGGAGGGCAAGGGG + Intronic
1168101562 19:54144215-54144237 TCTAGGGGAGGGAGAGGAAGAGG - Exonic
1168246401 19:55114863-55114885 TCTGGGGGATGCAGGGGAAGGGG + Intronic
926234330 2:11027945-11027967 TCTAGGGGGGTCAGGGGAAGAGG + Intergenic
926321337 2:11750125-11750147 GCTAGGGGACAGAGGGCAAGGGG - Intronic
926431711 2:12793688-12793710 GTTAGGGGGTGGGGGGCTAGGGG + Intergenic
926585392 2:14680264-14680286 GTCAGGGGGTGGAGGGCAAAGGG + Intergenic
927116991 2:19914932-19914954 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
927117806 2:19922563-19922585 TGTAGGGGGTGGGGGGCTGGGGG + Intronic
927125502 2:20009475-20009497 GTCAGGGGGTGGGGGGCAAGAGG + Intronic
927696726 2:25244435-25244457 GCTAGGGGGTGGAGGGTCTGTGG + Intronic
928272773 2:29871978-29872000 TCTAGGGCTTGGAGGACAATGGG - Intronic
928408230 2:31031821-31031843 TGTGGAGGGTGGAGGGGAAGTGG - Intronic
928787225 2:34903223-34903245 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
928869045 2:35952917-35952939 TTGGTGGGGTGGAGGGCAAGGGG - Intergenic
929064195 2:37956801-37956823 TGTTGGGGGTGGGGAGCAAGGGG - Intronic
929262364 2:39879908-39879930 TCTGGGAGGTAGAGTGCAAGAGG + Intergenic
929312614 2:40443100-40443122 TCTGAGGGGTTGGGGGCAAGGGG + Intronic
929562139 2:42962537-42962559 GGTTGGGGGAGGAGGGCAAGCGG + Intergenic
929574195 2:43041928-43041950 TCTGTGGAGGGGAGGGCAAGAGG - Intergenic
929967377 2:46545208-46545230 TGGAGGATGTGGAGGGCAAGGGG + Intronic
930222745 2:48761724-48761746 TTGTGGGGGTGGAGGGCATGGGG - Intronic
930286628 2:49437030-49437052 TGTCAGGGGTGGAGGGCTAGGGG + Intergenic
930365617 2:50435798-50435820 TCTTGAGGGTGGAGGGAAGGAGG + Intronic
930672401 2:54164855-54164877 TCACGGGGGTGAGGGGCAAGAGG - Intronic
931215344 2:60236916-60236938 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
931754062 2:65356581-65356603 TCTTTGGGGTAGAGGGCAGGTGG - Intronic
932045940 2:68349954-68349976 TGTTGGGGTTGGGGGGCAAGGGG + Intergenic
932121857 2:69108614-69108636 ACTAGAGGGTGGAGGGTGAGAGG - Intronic
932292695 2:70595728-70595750 GTTCGGGGGTGGTGGGCAAGGGG + Intergenic
932380177 2:71275523-71275545 TTGGGGGGGTGGGGGGCAAGGGG + Intergenic
932513785 2:72323830-72323852 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
932607780 2:73176162-73176184 CCTAGTGGGTCGAGGGGAAGGGG + Intergenic
932798325 2:74716803-74716825 TCATGGAGGTGGGGGGCAAGTGG - Intergenic
932843279 2:75105366-75105388 TCTAGGGGCTGGAGGTGGAGGGG + Intronic
933008080 2:77021976-77021998 TCTTGGAGGTGGAGGAAAAGGGG - Intronic
933094925 2:78166004-78166026 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
933195565 2:79385678-79385700 GTTGGGGGGTGGTGGGCAAGGGG - Intronic
933335700 2:80956168-80956190 GTCAGGGGGTGGTGGGCAAGCGG - Intergenic
933679448 2:85086859-85086881 TGTCGGGGGTGAGGGGCAAGGGG - Intergenic
933748173 2:85585557-85585579 TTAAGGGTGTGCAGGGCAAGGGG + Intronic
934477563 2:94603528-94603550 CCTGAGGGGTGGAGGGCAGGGGG - Intronic
934785294 2:97000781-97000803 GTCAGGGGGTGGAGGGCAAGGGG - Intronic
934852876 2:97712635-97712657 GCAAGGAGGTGGTGGGCAAGGGG + Intergenic
934926233 2:98383478-98383500 TCTATGGGGTGGAGGGCACCGGG - Intronic
935021422 2:99236135-99236157 TGTAGGGGGTGGGGGGCTAGGGG + Intronic
935130539 2:100257926-100257948 TCTGGAAGGTGGAGGGCAGGAGG - Intergenic
935451774 2:103217747-103217769 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
936580769 2:113698606-113698628 TATTGGGGGTGGGGGGAAAGGGG + Intergenic
936598144 2:113868968-113868990 TATTGGGAATGGAGGGCAAGTGG + Intergenic
936695536 2:114943044-114943066 GCTGGGGGGTGGAGGGCTAGAGG - Intronic
937208300 2:120251086-120251108 CCTAGGGGATGGGGGGCAGGTGG + Intronic
937212052 2:120280546-120280568 TTTGGGGGGCGGGGGGCAAGGGG + Intronic
937365412 2:121257487-121257509 TCAGGTGGGTGGAGGGCAGGAGG - Intronic
937492020 2:122379816-122379838 TCAGGGGGGTGGGGGGCTAGGGG - Intergenic
937784236 2:125876655-125876677 TCTCGGGGGTGGGGGGCTAGGGG - Intergenic
937813161 2:126221299-126221321 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
937946060 2:127338479-127338501 GCGAGAGGGTGGAGGGCAGGAGG - Intronic
938301355 2:130216096-130216118 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
938305112 2:130248011-130248033 TCTATGGGGTGTCGGGCAAGTGG + Intergenic
938395020 2:130939050-130939072 ACTTGAGGGTGGAGGGCAGGAGG - Intronic
938448902 2:131399196-131399218 TCTACGGGGTGTCGGGCAAGTGG - Intergenic
938595547 2:132784012-132784034 TGGAGGGGGCGGAGGGGAAGGGG + Exonic
939029028 2:137048053-137048075 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
939224381 2:139346574-139346596 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
939380334 2:141427020-141427042 TGTCAGGGGTGGAGGGCTAGGGG - Intronic
939474963 2:142674999-142675021 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
939941259 2:148354257-148354279 GGTGGGGGGTGGAGGGCAAGGGG - Intronic
940048364 2:149434629-149434651 GAAAGGGAGTGGAGGGCAAGAGG + Intronic
940417544 2:153440096-153440118 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
940572257 2:155452790-155452812 TATCGGGGGTGGTGGGCTAGGGG + Intergenic
940720208 2:157273969-157273991 TTTAGGGGGTGGGGGGCTGGAGG - Intronic
940786631 2:157988612-157988634 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
940811521 2:158248064-158248086 TTCAGGGGGTGGGGGACAAGGGG - Intronic
940950467 2:159666924-159666946 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
941072987 2:160975715-160975737 TCGGGGGGGTGGGGGGCTAGGGG - Intergenic
942761470 2:179403526-179403548 TTTGGGGGGTGGGGGGCTAGGGG + Intergenic
943101447 2:183491991-183492013 GTTGGTGGGTGGAGGGCAAGGGG - Intergenic
943198841 2:184792921-184792943 GCTAGGGGGTGGTGGGAAGGAGG - Intronic
943501792 2:188699229-188699251 GTTGAGGGGTGGAGGGCAAGGGG + Intergenic
943635092 2:190297900-190297922 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
943885351 2:193210041-193210063 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
944752317 2:202722667-202722689 TCTAGAGGGTGGAGGGTGGGAGG + Intronic
944818199 2:203401268-203401290 TGAAGGTGGAGGAGGGCAAGAGG - Intronic
945210416 2:207376616-207376638 ATTGGGGGGTGGGGGGCAAGGGG - Intergenic
945385029 2:209187158-209187180 TAGAGGGGGTGGGGGGCTAGGGG + Intergenic
945780480 2:214165622-214165644 TCAAGGGGGTGGGGGGCAGTGGG - Intronic
946212758 2:218160852-218160874 GCCAGGGGATGGAGGGCAAGGGG + Intergenic
946263864 2:218521485-218521507 GTTGGGGGATGGAGGGCAAGGGG - Intronic
946638503 2:221757004-221757026 TTTCGGGGGTTGAGGGGAAGGGG - Intergenic
946697503 2:222374507-222374529 TTTCGGGGGTGGAGGGCTAGGGG - Intergenic
947129442 2:226905907-226905929 TCTAGAGGGTGGCGGGCAGCTGG + Intronic
947131974 2:226937588-226937610 ATTGGAGGGTGGAGGGCAAGAGG - Intronic
947302959 2:228708984-228709006 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
947439235 2:230103707-230103729 GTCAGGGGGTGGAGGGTAAGGGG - Intergenic
947779353 2:232743557-232743579 ACTTGGGGGTGGAAGGCAGGAGG - Intronic
947996383 2:234531343-234531365 GCTTGGGTGGGGAGGGCAAGTGG + Intergenic
948239485 2:236417723-236417745 GTTAGGGGATGGGGGGCAAGGGG - Intronic
948810636 2:240474563-240474585 ACTTGAGGGTGGAGGGTAAGAGG - Intergenic
1169637122 20:7704841-7704863 TCTAGGGGCTGGGGCGCTAGAGG - Intergenic
1169749746 20:8979922-8979944 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1170059103 20:12240752-12240774 TATCGGGGGTGGGGGGTAAGGGG + Intergenic
1170171576 20:13419297-13419319 TGTAGAGGGAGGAGGGCATGAGG + Intronic
1170486876 20:16826810-16826832 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
1170671247 20:18435590-18435612 TGTCGGGGGTGGGGGGCAAGAGG + Intronic
1170691712 20:18622228-18622250 TTCAGGGGGTCGGGGGCAAGGGG - Intronic
1170803419 20:19609562-19609584 TGTTGGAGGTGGGGGGCAAGGGG - Intronic
1170909016 20:20544866-20544888 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1171143037 20:22759463-22759485 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1171242522 20:23583149-23583171 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1172511317 20:35503096-35503118 TCAAGGAGCTGGAGGGCCAGAGG + Exonic
1172656731 20:36542317-36542339 TCCAGGGGCTGGAGGTCATGGGG + Intronic
1173229907 20:41186153-41186175 CCTAAGGGGTGGAGGACATGGGG - Intronic
1173236158 20:41247605-41247627 ACTGGGGAGTGGAGGGGAAGAGG - Intronic
1173296275 20:41761433-41761455 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1173619792 20:44428352-44428374 TGCAGGGGGTGGTGGGCATGGGG - Exonic
1174509321 20:51039102-51039124 TCTAGAGGGTGCAGGGGGAGAGG + Intergenic
1174670205 20:52299976-52299998 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1174687232 20:52467712-52467734 TCTCGGGGGATGGGGGCAAGGGG - Intergenic
1175500905 20:59450137-59450159 TCTTTGGGGTGCAGGGGAAGGGG + Intergenic
1175734564 20:61376350-61376372 CCCAGGGGAAGGAGGGCAAGAGG + Intronic
1175841295 20:62029353-62029375 ACTTGGGGGCGGTGGGCAAGTGG + Intronic
1175905369 20:62376908-62376930 TCTTGGGAGTGGGGGCCAAGCGG - Intergenic
1176127089 20:63480464-63480486 TCCAGTGGGTGGAGGCCAGGGGG + Intergenic
1176151297 20:63592447-63592469 CCTAGGGGCAGGAGGGCCAGTGG + Intronic
1176241129 20:64076475-64076497 GCGAGGGGGTCGAGGGCATGGGG - Intronic
1176691476 21:9916307-9916329 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1176691505 21:9916471-9916493 TGTAGGGGGTGGGGGCCTAGGGG - Intergenic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1177186332 21:17801690-17801712 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1177313751 21:19430146-19430168 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1177373281 21:20235085-20235107 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1177403997 21:20642523-20642545 TGTTGGGGGTCGGGGGCAAGGGG + Intergenic
1177593781 21:23208893-23208915 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1177714238 21:24818099-24818121 TCGTGGGGGTGGGGGGCTAGGGG + Intergenic
1177975277 21:27841804-27841826 TATAGGGGGTGGACGCCTAGGGG - Intergenic
1178067925 21:28926724-28926746 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1178880263 21:36444275-36444297 TGTCGGGGGTGGAGGGTGAGGGG - Intergenic
1179187172 21:39093963-39093985 TCTTGGGGTTGTAGGGAAAGGGG - Intergenic
1181013158 22:20053995-20054017 TGGAGGGGGAGGAGGGCAGGAGG - Intronic
1181172075 22:21015434-21015456 TTTAGGGGCTGGAGTGGAAGGGG + Intronic
1181177230 22:21044766-21044788 TTTAGGGGCTGGAGGGGAAGGGG - Intergenic
1181466580 22:23113717-23113739 TCTAGTGGGGAGAGGGCGAGTGG - Intronic
1181512224 22:23394134-23394156 GCTGGGGGGTGGAGGGCGTGGGG + Intergenic
1182351332 22:29701687-29701709 TTTTGGGGGCAGAGGGCAAGAGG + Intergenic
1182771060 22:32796721-32796743 GCTAGGGTCTGGAGGGGAAGAGG + Intronic
1182895905 22:33859036-33859058 TGTAGGGGGTCGGGGGCTAGGGG + Intronic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1183457360 22:37930062-37930084 CCTTGGTGGTGGAGGGCACGGGG + Intronic
1183591085 22:38779635-38779657 TCAAGGGGGCGCAGGGCAGGTGG + Intronic
1183746132 22:39693002-39693024 TCAAGGGGGTGGGGTCCAAGGGG + Intergenic
1184046432 22:41975396-41975418 TGTGTGGGGTGGAGGGAAAGGGG - Intergenic
1184608064 22:45585724-45585746 TCCAGGAGGTGGAGGGCATGGGG + Intronic
1185107991 22:48885227-48885249 TCTAGTGGGGGGCGGGGAAGAGG - Intergenic
1185110216 22:48896432-48896454 GGCAGGGGGTGGAGGGCATGTGG + Intergenic
1185110235 22:48896475-48896497 GTGATGGGGTGGAGGGCAAGGGG + Intergenic
1185174027 22:49309340-49309362 TCTAGAAGGTTGAGGGCAGGAGG + Intergenic
1185415270 22:50705979-50706001 TCCAGGCGGTGGAGCGCAAGTGG + Intergenic
949119397 3:367785-367807 TTTGGGGTGTGGAGGGCAAGGGG - Intronic
949145133 3:690871-690893 TGGAGGGGCTGGTGGGCAAGAGG - Intergenic
949162487 3:896857-896879 TTTAGGGGGTGGGGGGCAATTGG - Intergenic
949203602 3:1411138-1411160 TGTTGGGGGTGGGGGACAAGGGG - Intergenic
949697752 3:6719094-6719116 ATCAGGGGGTGGGGGGCAAGGGG - Intergenic
951168556 3:19511139-19511161 TGTGGGGGGTGGGGGGCTAGGGG - Intronic
951197559 3:19841069-19841091 GTTGAGGGGTGGAGGGCAAGGGG - Intergenic
951398121 3:22196018-22196040 TTTCGAGGGTGGAGGGTAAGAGG + Intronic
951765169 3:26189865-26189887 TTCAGGGGGTGGGGGGCAAGGGG - Intergenic
951911401 3:27754232-27754254 TGTAGGGGGTGGGGGGCTAGGGG - Intergenic
951939868 3:28065742-28065764 TCTCGGGGGTGGGGGGCTAGGGG + Intergenic
951977299 3:28526951-28526973 TGTTGGGGGTGGGGGGCTAGGGG - Intronic
953000509 3:38928367-38928389 TGTTGGGGGTGGGGAGCAAGGGG + Intronic
953881907 3:46695065-46695087 GCCTGGGGGTGGAGGGCATGGGG - Intergenic
954947250 3:54436774-54436796 TGTCGGGGGTGGGGAGCAAGGGG + Intronic
955092995 3:55770791-55770813 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
955279930 3:57584853-57584875 TTTGGGGGGTGGAGGGGCAGGGG + Intronic
955317589 3:57951767-57951789 GCTGAGAGGTGGAGGGCAAGGGG - Intergenic
955464353 3:59220978-59221000 TGTGGGGGTTGGGGGGCAAGGGG - Intergenic
955586680 3:60485647-60485669 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
956220755 3:66900125-66900147 TTCAGGGGGTAGGGGGCAAGAGG + Intergenic
956234383 3:67052544-67052566 GTTGGGGAGTGGAGGGCAAGGGG - Intergenic
956318077 3:67961825-67961847 GTCAGGGGGTGGAGAGCAAGGGG + Intergenic
956453300 3:69395011-69395033 TGTCGGGGGTGGAGGGCAAGGGG + Intronic
956633189 3:71336421-71336443 ATCGGGGGGTGGAGGGCAAGGGG - Intronic
956669041 3:71669247-71669269 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
956918728 3:73903532-73903554 GTTGGTGGGTGGAGGGCAAGGGG - Intergenic
957376941 3:79370831-79370853 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
957773117 3:84720000-84720022 GTTGGGGGCTGGAGGGCAAGGGG - Intergenic
957844583 3:85715650-85715672 GTCAGCGGGTGGAGGGCAAGGGG - Intronic
958507439 3:94998348-94998370 TTTGAGGGGTGGGGGGCAAGGGG - Intergenic
958677407 3:97283602-97283624 TCAGGGGGGTGAGGGGCAAGGGG + Intronic
958694022 3:97505334-97505356 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
958993899 3:100879167-100879189 ACCAGGGGGTGAGGGGCAAGGGG - Intronic
959176518 3:102919771-102919793 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
959224932 3:103568267-103568289 TCTGGGGGGTGAGGGGCAGGAGG + Intergenic
959667070 3:108934173-108934195 GCTGGGGGGTGGGTGGCAAGGGG + Intronic
959790933 3:110360030-110360052 TTTGAGGGGTGGGGGGCAAGGGG + Intergenic
960125769 3:113996867-113996889 GCTGGGGGGTGGGGGGCAAGGGG + Intronic
960248910 3:115430739-115430761 GTTGGGGGATGGAGGGCAAGGGG + Intergenic
960278736 3:115756855-115756877 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
960656460 3:120009685-120009707 TGTGGGGGGTGGGGGGCTAGGGG + Intronic
960676686 3:120202301-120202323 TGTTGGGGGTTGGGGGCAAGGGG - Intronic
961224151 3:125224042-125224064 TGTCGGGGGTGGGGGGGAAGGGG - Intergenic
961629230 3:128284111-128284133 TGTGGGGGGTGGAGGGCTGGAGG - Intronic
961662554 3:128477379-128477401 TGTAGGGGGTGGAGGCCAGGGGG + Intergenic
962292038 3:134145410-134145432 TCAGGGGAGTGGAGGGCAGGGGG + Intronic
962302975 3:134259602-134259624 TCCAGAGGGCAGAGGGCAAGGGG - Intergenic
963035933 3:141028910-141028932 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
963061186 3:141228502-141228524 TCTAGGGGATGGAGGTGGAGTGG - Intergenic
963399911 3:144785441-144785463 GTTTGGGGGTGGAGGACAAGGGG - Intergenic
963576489 3:147066815-147066837 ATTTGGGGGTGGAGGGCAGGGGG + Intergenic
963672659 3:148271517-148271539 TCTACTGGGTGGAGAGCAGGAGG - Intergenic
963875207 3:150467626-150467648 TCTAGGGGGAGGAGGAGAAAGGG + Intergenic
964377428 3:156063058-156063080 TGTCGGGGGTGGAGGGCAAGGGG - Intronic
964414505 3:156433173-156433195 TCTAGGGAGTGGAGGAGACGTGG + Intronic
964676942 3:159293806-159293828 TCTCGGAGGTGGAAGGGAAGGGG + Intronic
964831805 3:160891992-160892014 GTCAGGGGGTGGAGGGCTAGGGG + Intronic
964844904 3:161034689-161034711 TCGGGGGGGTGGAGGACTAGGGG + Intronic
964844956 3:161035080-161035102 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
964905377 3:161713029-161713051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
965110967 3:164421660-164421682 TTTTGGGGGTGGAGGGTAAAGGG - Intergenic
965447522 3:168793903-168793925 TGTTGGGGGTGGGGGTCAAGTGG + Intergenic
965477686 3:169177464-169177486 GTTTGGGGGTGGAGGGCGAGGGG + Intronic
965633845 3:170760836-170760858 GCTATGTGGTGGGGGGCAAGAGG + Intronic
965790419 3:172381615-172381637 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
965858561 3:173119152-173119174 TCGAGGGGGTGTGGGGAAAGGGG + Intronic
966374835 3:179285782-179285804 TGCGGGGAGTGGAGGGCAAGTGG - Intergenic
967707269 3:192665601-192665623 TTTTGGGGGTGGGGGGCAAGGGG + Intronic
967857093 3:194126450-194126472 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
968016544 3:195339700-195339722 TGTTGGGGGTGGTGGGCATGAGG + Intronic
968095884 3:195930608-195930630 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
968734056 4:2286068-2286090 TCTAGGGGGTGCAGGGACAGTGG + Intronic
968740974 4:2331665-2331687 GCTGAGGGGTGCAGGGCAAGTGG + Intronic
968764864 4:2462948-2462970 TGTAGGGGGTGGCCCGCAAGCGG - Exonic
969014847 4:4097142-4097164 CCTTGGGGGTGGGGGACAAGGGG + Intergenic
969393877 4:6908664-6908686 TCTGGGGACTTGAGGGCAAGAGG - Intergenic
969488159 4:7483743-7483765 TCCAGGGGGTGGGGGGCCAGGGG + Intronic
969608307 4:8213097-8213119 CCTTGTGGGTGGAGGGCAGGTGG - Intronic
970174665 4:13327105-13327127 TCAAGAGGGTTGGGGGCAAGGGG + Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
970614111 4:17751776-17751798 CCAAGGGGCTGGAGGTCAAGAGG + Intronic
971023536 4:22564567-22564589 TTGAGGGGGTGGAGGGTGAGGGG + Intergenic
971122620 4:23721043-23721065 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
971548275 4:27914895-27914917 TGTGGGGGGTTGGGGGCAAGGGG + Intergenic
972424120 4:38916654-38916676 TGTCGGGGGTAGGGGGCAAGGGG + Intronic
972442570 4:39109651-39109673 TGGAGGGGGTGGTGGGGAAGTGG + Intronic
972446531 4:39149550-39149572 GTTAGGGGGTGGGGAGCAAGGGG + Intergenic
972760845 4:42102412-42102434 TCGGGGGGGTGGGGGGCAAGGGG + Intergenic
972887711 4:43512860-43512882 GTCAGGGGTTGGAGGGCAAGGGG - Intergenic
972953372 4:44358043-44358065 TTTGGGGGGTGGGGGGCTAGGGG - Intronic
972985263 4:44755656-44755678 TCAAAGGGGTGGAGGGCTATTGG - Intergenic
973256086 4:48115195-48115217 GTTGTGGGGTGGAGGGCAAGGGG - Intronic
973313337 4:48732771-48732793 TGTGGGGGGTGGGGGGCTAGGGG + Intronic
973589354 4:52425057-52425079 GCTGGGGAGTGGGGGGCAAGGGG - Intergenic
973922308 4:55700356-55700378 CCAAGGGGGTGGGGGGCAAGGGG + Intergenic
973981827 4:56314308-56314330 TCTTGGAGGAGGAGGGCGAGGGG + Exonic
974760917 4:66272210-66272232 TGTTGGGGGTGGAGGGTGAGGGG + Intergenic
974851165 4:67406511-67406533 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
974855423 4:67455130-67455152 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
974922192 4:68255536-68255558 GTTGAGGGGTGGAGGGCAAGGGG + Intergenic
975098875 4:70489423-70489445 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
975192260 4:71478604-71478626 GTTAGGGGGTTGGGGGCAAGGGG + Intronic
975217871 4:71777881-71777903 TGTCGGGGGTTGAGGGCTAGGGG + Intronic
975309756 4:72890555-72890577 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
975476614 4:74830785-74830807 TGTCGGGGGTGGGGGGCCAGGGG + Intergenic
975619803 4:76285008-76285030 GCCAGAGGGTGGAGGGCAAGGGG - Intronic
975842825 4:78493652-78493674 TCTGGGTGGTGGGGGGCTAGGGG + Intronic
975999105 4:80350778-80350800 TGTTGGGGGTGGAGGGAAAGGGG + Intronic
976032465 4:80772708-80772730 TTTGGGAGGCGGAGGGCAAGAGG - Intronic
976032717 4:80776581-80776603 TGTCGGGGGATGAGGGCAAGGGG + Intronic
976330797 4:83829028-83829050 TCCAGGAGGTGGAGACCAAGGGG + Intergenic
976510370 4:85901970-85901992 GTTGGGGGGTGGAGTGCAAGGGG - Intronic
976693668 4:87895296-87895318 TGTGGGGGCTGGGGGGCAAGGGG + Intergenic
977426100 4:96868851-96868873 GTCAGGGGGTAGAGGGCAAGGGG + Intergenic
978051423 4:104204852-104204874 TCTTGGGGGTAGGGGGCAAGGGG + Intergenic
978099100 4:104814943-104814965 TGTTGGGGGTGGAGAGCAATGGG + Intergenic
978150545 4:105428665-105428687 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
978452729 4:108853661-108853683 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
978459963 4:108940593-108940615 TCTTGGGCCTGGAGGGCCAGGGG + Exonic
978494620 4:109345958-109345980 TTTCGGGGGTGGAGGGCAGGGGG + Intergenic
978664839 4:111170020-111170042 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
978989498 4:115061618-115061640 TGTCGGGGGTGAGGGGCAAGGGG + Intronic
979035016 4:115705126-115705148 TGTTGGGGGTGGGTGGCAAGGGG - Intergenic
979104002 4:116661205-116661227 TTCAGGGGGTGGAAGGCAATGGG + Intergenic
979314922 4:119251050-119251072 TGTGGGGGGTGGGGGGCTAGGGG - Intronic
980364057 4:131776501-131776523 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
980364087 4:131776665-131776687 TGTAGGGGGTGGGGGCCTAGGGG - Intergenic
980380374 4:132006058-132006080 TCTTGGGGGTGGGGGGCAAGGGG + Intergenic
980476664 4:133327111-133327133 TGTCGGGGCTGGGGGGCAAGGGG + Intergenic
980519715 4:133916162-133916184 GTCAGGGGGTGGAGGGTAAGGGG - Intergenic
980776317 4:137441000-137441022 TCTAGGGGTTGGAGGGGTGGGGG + Intergenic
981347518 4:143693992-143694014 TCTTGAGGGTGGAGGGTAGGAGG + Intronic
981410462 4:144424417-144424439 TCTAGGGAGAGGTGGGTAAGGGG - Intergenic
981530223 4:145745356-145745378 TCTAGGGGGTTAGGGGGAAGTGG - Intronic
982014716 4:151141970-151141992 CCTAGCAGGTGAAGGGCAAGAGG + Intronic
982047927 4:151467825-151467847 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
982077561 4:151753030-151753052 GCTTGGGGGAGGAGGGGAAGAGG + Intronic
982507106 4:156233325-156233347 GCCAGGGGGTGGGGGGCTAGGGG - Intergenic
982528827 4:156511869-156511891 TTTGGGGTGTGGCGGGCAAGGGG + Intergenic
982732797 4:158974453-158974475 TGTTGCGGGTGGGGGGCAAGGGG - Intronic
982880909 4:160714042-160714064 TCTCGGGGGTGGGGGGCTAGGGG + Intergenic
982943795 4:161592420-161592442 TCTCAGGGGTGGGGGGCTAGGGG - Intronic
983079769 4:163370818-163370840 TTGAGGGGGTGGGGGGCTAGAGG + Intergenic
983160305 4:164405280-164405302 TCGTGGGGGTGCAGGGCTAGGGG + Intergenic
983161089 4:164415590-164415612 TGTCGGGGGTTGAGGGCAAGGGG - Intergenic
983179996 4:164636498-164636520 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
983234816 4:165167245-165167267 TAGAGGGGGTGGAGGGCTGGGGG + Intronic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
983759656 4:171389085-171389107 GTTAGGGGGTGGGGGGCAAAGGG + Intergenic
983851419 4:172585401-172585423 GTCAGGAGGTGGAGGGCAAGGGG - Intronic
983948298 4:173610551-173610573 GTCAGGGGGTGGGGGGCAAGAGG - Intergenic
984187241 4:176560970-176560992 TCAGGGGGGTGGGGGACAAGGGG - Intergenic
984199387 4:176698709-176698731 TCTTGGGGGTGGGGGACATGGGG - Intronic
984619213 4:181933010-181933032 CCCAGGGGGTTGGGGGCAAGGGG + Intergenic
984870679 4:184322336-184322358 TCTGGAGGGTGGAGGGAGAGAGG - Intergenic
985044550 4:185927432-185927454 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
985193184 4:187400002-187400024 TGTAGGGGGTGGGAGGCTAGAGG + Intergenic
985321898 4:188722131-188722153 GTTAGAGGGTGGAGGGCTAGGGG - Intergenic
985850891 5:2388393-2388415 AATTGGGGGTGGAGGGGAAGGGG - Intergenic
985877868 5:2613793-2613815 GTTAGGGGGTGGGAGGCAAGGGG - Intergenic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
985902465 5:2807239-2807261 TTCAGGGGGTGGAGGGATAGGGG - Intergenic
985950623 5:3219259-3219281 TCTGGGGGGAGGAAGGCAGGTGG + Intergenic
986071457 5:4288614-4288636 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
986183290 5:5414224-5414246 TGTCGGGGATGGGGGGCAAGGGG + Intergenic
986331862 5:6722431-6722453 TCTTGGGAGTGGGGGGCTAGAGG + Intronic
986467884 5:8045179-8045201 GTCAGAGGGTGGAGGGCAAGGGG + Intergenic
986518390 5:8587083-8587105 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
986671645 5:10147928-10147950 TTTGGAGGGTGGAGGGCGAGAGG - Intergenic
986766425 5:10932198-10932220 TCTAGGGGGTGTAGGTGGAGGGG + Intergenic
986939047 5:12927334-12927356 TTGAGGGGGTGGGGGGCTAGGGG + Intergenic
987830717 5:23091067-23091089 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
988320760 5:29693257-29693279 TCTAGAGGGAGGAGGGAGAGAGG - Intergenic
988394000 5:30673795-30673817 TGTTGGGGGTGGGGGGCCAGGGG + Intergenic
988918357 5:35918458-35918480 TTCAGGGGGTGGAGGGCTAGGGG + Intronic
989197315 5:38728174-38728196 TATAGGGAGTGGAGTGGAAGGGG + Intergenic
989347658 5:40448078-40448100 TTGGGGGGGTGCAGGGCAAGGGG - Intergenic
989502182 5:42180219-42180241 TGTAGGGGGCGGGGGTCAAGGGG + Intergenic
989687157 5:44103785-44103807 GTTAGGGGGTGGGGGGAAAGGGG - Intergenic
989697695 5:44222816-44222838 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
989737987 5:44731593-44731615 TTTGGGGTGTGGGGGGCAAGGGG - Intergenic
989819322 5:45776243-45776265 TCCAGAAGGTGGAGGGGAAGAGG - Intergenic
990062808 5:51672998-51673020 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
990064696 5:51698146-51698168 TGTTGGGGGTGGGGGGTAAGGGG - Intergenic
990781531 5:59369808-59369830 TATAGTGGGTGGAGGGAAATGGG + Intronic
990897136 5:60711889-60711911 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
991182389 5:63767610-63767632 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
991225351 5:64264376-64264398 TGTCGGGGGTGGGAGGCAAGGGG - Intronic
991927493 5:71719462-71719484 TCAAGGGGGTCGAGAGCGAGGGG - Intronic
991951452 5:71950373-71950395 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
992000216 5:72428846-72428868 GCTGGGGGGTGAAGGGCCAGGGG + Intergenic
992329599 5:75702158-75702180 GTCAGGGGGTGGAGGGTAAGGGG + Intronic
992603175 5:78425941-78425963 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
992607340 5:78472383-78472405 ACTTGGGGGTGGGGGGCAAGGGG - Intronic
993080970 5:83300725-83300747 GTTGGGGGGTGGGGGGCAAGAGG - Intronic
993119704 5:83759466-83759488 GCTGGGGGGTGGAGAGCTAGGGG + Intergenic
993446835 5:88023361-88023383 ACTTAGGGGTGGAGGGCCAGAGG - Intergenic
993467288 5:88264929-88264951 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
993636202 5:90346943-90346965 GTTGGGGGGTGGAGGGCTAGGGG - Intergenic
993895521 5:93528893-93528915 TCTCGGGGGTGGGGGGCTAGGGG + Intergenic
993930524 5:93933648-93933670 GTTAGGGGGTGGGGGGCTAGGGG + Intronic
993963891 5:94336405-94336427 TTTGGGGGGTGGGGGGCTAGGGG - Intronic
994415504 5:99464690-99464712 TCTGGGGGCTGGGGGGCTAGGGG + Intergenic
994471300 5:100211547-100211569 ACTTGAGGGTGGAGGTCAAGAGG + Intergenic
994511876 5:100714359-100714381 TTTAGAGGGCGGAGGGCAGGAGG - Intergenic
994595711 5:101831854-101831876 TTTAGTGGGTGGGAGGCAAGGGG - Intergenic
994780501 5:104083651-104083673 TGTCGGGGGTGGGGGCCAAGGGG + Intergenic
994990617 5:106991917-106991939 TCTAGAGGGAGGTAGGCAAGGGG + Intergenic
995593473 5:113724115-113724137 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
995790070 5:115877346-115877368 GTCAGGGGGTGGAGGGCTAGGGG - Intronic
995976276 5:118039132-118039154 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
995997001 5:118312563-118312585 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
996265954 5:121540522-121540544 ACTTGTGGGTGGAGGGCAAGAGG + Intergenic
996363368 5:122675039-122675061 GCCAGGGGCTGGAGGGAAAGGGG - Intergenic
996474722 5:123903821-123903843 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
997003938 5:129796842-129796864 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
997054256 5:130421602-130421624 TCTTGGGGGTTGGGGGCGAGGGG + Intergenic
997112981 5:131095576-131095598 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
997601760 5:135143712-135143734 TATCAGGGGTGGGGGGCAAGGGG - Intronic
997963248 5:138338307-138338329 GGTAGGTGGTGGAGGGCAGGTGG + Exonic
998542507 5:142996037-142996059 ACTGGGGGGTGGGGAGCAAGTGG + Intronic
998604739 5:143622104-143622126 ACTTGGGGGTGGAGGGTAGGAGG + Intergenic
998659604 5:144221412-144221434 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
999321773 5:150619667-150619689 TCCCGGGGGTGCAGGGCATGCGG + Intronic
999514858 5:152290882-152290904 TGGTGGGGGTGGGGGGCAAGAGG - Intergenic
999597453 5:153220861-153220883 TCAGGGGGTTGGCGGGCAAGGGG + Intergenic
999679723 5:154045462-154045484 TCTTGGGGGTTGGGGGGAAGGGG - Intronic
1000189620 5:158897410-158897432 TCTAGAGGGTGGAGGGTTGGAGG + Intronic
1000291168 5:159872920-159872942 GTTTGGGGGTGGGGGGCAAGGGG - Intergenic
1000593073 5:163182135-163182157 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1000627760 5:163558795-163558817 ACTTGAGGGTGGAGGGTAAGAGG + Intergenic
1000786381 5:165549599-165549621 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1000971952 5:167724512-167724534 TCTATTGGGTGGAGGGAAGGAGG + Intronic
1001148942 5:169209791-169209813 TGTCGGGGGTAGGGGGCAAGGGG + Intronic
1001325886 5:170723660-170723682 TCTAGGTGCTGGAGGTAAAGAGG + Intronic
1002663986 5:180809870-180809892 TGGAGGGGGTGGAGGTCATGTGG - Intronic
1002849955 6:985193-985215 TGTAGGGGGTTGAGGGCAAGGGG - Intergenic
1003764921 6:9224692-9224714 TCTAGGATTTGGAAGGCAAGAGG + Intergenic
1003778363 6:9394936-9394958 TGTAGGGGGTGGAGGTCAGCAGG + Intergenic
1003932621 6:10940670-10940692 GCTAGGAGGTGGGGGGAAAGAGG + Intronic
1004057477 6:12154635-12154657 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1004127395 6:12887030-12887052 AGGAGGGGGTGGAGGACAAGGGG - Intronic
1004231241 6:13835420-13835442 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
1004234776 6:13864839-13864861 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1004253371 6:14041071-14041093 TCTCGGGGGTTGGGGGAAAGGGG - Intergenic
1004326496 6:14678755-14678777 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1004799008 6:19124730-19124752 TGTTGGGGGTGGTGGGCAAGGGG + Intergenic
1004829488 6:19462151-19462173 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1004870376 6:19898157-19898179 TCTAGGAGGTGATGGTCAAGAGG + Intergenic
1005193205 6:23252194-23252216 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1005223401 6:23614187-23614209 ACAAGGGGGTGGGGGGCAAGGGG + Intergenic
1005338594 6:24821776-24821798 TGGAGGGGGTTGATGGCAAGTGG - Intronic
1005687197 6:28266050-28266072 TCTTGAGGGTGGAGGGTGAGAGG - Intergenic
1005772792 6:29092825-29092847 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1005785295 6:29239125-29239147 TTTAGGGGGTGGGGGGCCAGGGG - Intergenic
1006155237 6:32010031-32010053 TGTAGGAGGTGGAGGGAAAGAGG + Intergenic
1006161543 6:32042765-32042787 TGTAGGAGGTGGAGGGAAAGAGG + Exonic
1006215054 6:32434338-32434360 TTGGGGGGGTGGGGGGCAAGGGG + Intergenic
1006338156 6:33431693-33431715 TCCAGGAGGTGGGGGGCAGGTGG + Intronic
1007369398 6:41416512-41416534 TCTGGTGGGTGGAGGGAACGGGG - Intergenic
1007692441 6:43711426-43711448 AGTAGGGGGTGGAGAGGAAGGGG + Intergenic
1007692962 6:43714751-43714773 TCCATGGGGTGGAGGGGAGGTGG - Intergenic
1007938307 6:45753599-45753621 TGTCGGGGGTAGGGGGCAAGGGG - Intergenic
1007994584 6:46292867-46292889 TCGTGGGGGTGGAGGGCTAGGGG - Intronic
1008104279 6:47425747-47425769 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1008207915 6:48685926-48685948 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1008311826 6:49985687-49985709 TCTGGGGCGTAGGGGGCAAGGGG - Intergenic
1008474153 6:51918343-51918365 GTTAGTGGGTGGGGGGCAAGGGG - Intronic
1008646454 6:53519418-53519440 TCTGGTGGGTGGAGGGGGAGGGG - Intronic
1009280608 6:61746303-61746325 TGTCGGGGATGGGGGGCAAGGGG - Intronic
1009524965 6:64732156-64732178 TGTCGGGGTTGGGGGGCAAGGGG + Intronic
1009717725 6:67422590-67422612 TGTTGGGGTTGGAGGGCAAGGGG - Intergenic
1009756517 6:67947302-67947324 TTTGGGGGGTGGGGGGCTAGGGG - Intergenic
1010096629 6:72054071-72054093 TTTGGGGGGTGGTGGGCAAGGGG - Intronic
1010616728 6:78021776-78021798 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1010645452 6:78382363-78382385 TCTAGGGGGTGAGGGACATGGGG + Intergenic
1010879204 6:81147482-81147504 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
1010959820 6:82133101-82133123 GTTAGAGGGTGGGGGGCAAGGGG + Intergenic
1011066189 6:83328312-83328334 GTCAGGGGGTGGAAGGCAAGGGG + Intronic
1011201123 6:84837477-84837499 TGTCGGGGGTGGGGAGCAAGGGG - Intergenic
1011303667 6:85903177-85903199 TGTTGGGGGTGGCGGGCTAGGGG - Intergenic
1011405854 6:87014800-87014822 GTTGGGGGGTGGAGGGCTAGGGG + Intronic
1011534544 6:88362000-88362022 TCTAGCGGGTGTAGGGAAATGGG + Intergenic
1011633156 6:89346637-89346659 TGTAGGGGGTGGGGGGCAGGGGG - Intronic
1011736653 6:90317316-90317338 GTCAGGGGGTGGAGGGCTAGAGG - Intergenic
1012168680 6:95991077-95991099 TCTCGGGGGAGGAAAGCAAGAGG - Intergenic
1012338589 6:98090667-98090689 GTTAGGGGGTGGGAGGCAAGGGG - Intergenic
1012391910 6:98751219-98751241 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1012487077 6:99734379-99734401 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1012537816 6:100320393-100320415 TCTAGATGATGGAGGGAAAGAGG - Intergenic
1012932021 6:105327292-105327314 TCTAGGGGGAAGAGGGAATGGGG + Intronic
1013004022 6:106053823-106053845 TGTGGGGGGTGGAGGGCTGGGGG - Intergenic
1013431975 6:110063607-110063629 GAATGGGGGTGGAGGGCAAGGGG - Intergenic
1013453310 6:110306152-110306174 GTTGGGGGGTGGGGGGCAAGGGG + Intronic
1014149537 6:118037865-118037887 GTTGGGGGGTGGGGGGCAAGAGG + Intronic
1014235797 6:118953125-118953147 TGTCGGGGGTGGGGGGCATGAGG - Intergenic
1014729575 6:125016780-125016802 GTGAGGGGGTGGGGGGCAAGGGG + Intronic
1015159791 6:130140013-130140035 TCTGGGGGGTGGGGGGAAGGGGG + Exonic
1015571865 6:134630165-134630187 GCTGAGGGGTGGGGGGCAAGGGG - Intergenic
1016412337 6:143796556-143796578 TGTAGGGGGTGGGGGACTAGGGG - Intronic
1017057432 6:150450367-150450389 GTTGGGGGGTGGAGGGCTAGGGG + Intergenic
1017103789 6:150869321-150869343 TCAGGGGGTGGGAGGGCAAGAGG - Intronic
1017180398 6:151546609-151546631 TCTGGGGGGCTTAGGGCAAGGGG - Intronic
1017236048 6:152118609-152118631 GGTAAGGGGTGGGGGGCAAGGGG + Intronic
1017369383 6:153687553-153687575 TGTAGGGGGTGGGGGGCTAGGGG - Intergenic
1017592302 6:155990720-155990742 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1017639539 6:156477827-156477849 TGTTGGGGGTGGGAGGCAAGGGG + Intergenic
1018231804 6:161682564-161682586 TCTTGAGGGTAGAGTGCAAGGGG + Intronic
1018381430 6:163261407-163261429 CTCAGGGGGTGGGGGGCAAGGGG - Intronic
1018501747 6:164418850-164418872 TGTTGGGGGTGGAGGGTAAGGGG - Intergenic
1018646970 6:165957938-165957960 TCTCAGGGCTGGAGAGCAAGCGG + Intronic
1018795037 6:167179302-167179324 TGTGTGGGGTGGAGGGCTAGGGG - Intronic
1018821281 6:167375760-167375782 TGTGTGGGGTGGAGGGCTAGGGG + Intronic
1018904238 6:168065762-168065784 TCTAGGGGGTGAGGGGCGTGTGG - Intronic
1019484051 7:1280267-1280289 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1019692680 7:2425423-2425445 TTTTGGGGGTGGAGGGTAAAAGG - Intronic
1019848263 7:3528082-3528104 GCTAGGGGGTGAAGGGTAGGAGG + Intronic
1020138462 7:5599259-5599281 CCTGGGGGGTGGAGCCCAAGGGG + Intronic
1020204623 7:6105158-6105180 TGTAGGGGGAGGCGGGCGAGGGG - Intronic
1020687098 7:11309569-11309591 GCTTGGGGGTGGAGGGACAGAGG + Intergenic
1020759879 7:12255126-12255148 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1020913415 7:14161662-14161684 GTTGGGGGGTGGGGGGCAAGGGG + Intronic
1021378431 7:19937347-19937369 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1021535589 7:21700954-21700976 TGTTGGGGGTGGAGGGCTAGGGG + Intronic
1022139409 7:27480232-27480254 GTTAGGGGGTGGGGGGCAAGGGG + Intergenic
1022351893 7:29574074-29574096 TCTAGGAGATGGAGGAAAAGAGG + Intergenic
1022441545 7:30437219-30437241 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1022688846 7:32625087-32625109 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1022739085 7:33104300-33104322 ACTTGAGGGTGGAGGGCAGGCGG + Intronic
1023224488 7:37954588-37954610 GCCAGGGGGTGGGGGGCTAGGGG + Intronic
1023289152 7:38651208-38651230 TCATGGGGGTGGGGGGCTAGGGG + Intergenic
1023311278 7:38888952-38888974 TGTGGGGGGTGGGGGGCTAGGGG + Intronic
1023520543 7:41046209-41046231 TCTAAGAGGAGGAGGGCAATGGG + Intergenic
1023863059 7:44226977-44226999 TGTAGGGGATGGGGGGCATGAGG + Intronic
1024062303 7:45708299-45708321 TCTGGGGAGTGCAAGGCAAGAGG - Intronic
1024205681 7:47158227-47158249 GTTTGGGGGTGGGGGGCAAGGGG + Intergenic
1024660272 7:51486508-51486530 ACTGGGGGGTGGGGGGCAAGAGG - Intergenic
1024704803 7:51945267-51945289 TGTCGGAGGTCGAGGGCAAGAGG - Intergenic
1024832706 7:53480286-53480308 GTTGGGGGGTTGAGGGCAAGGGG - Intergenic
1026107362 7:67431802-67431824 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1026429818 7:70333803-70333825 GTTGGGGGGTGGAGGGCTAGGGG + Intronic
1026649512 7:72203181-72203203 TGTCGGGGGGTGAGGGCAAGGGG + Intronic
1026806121 7:73430443-73430465 TGGAGGGGGAGGAGGGGAAGGGG - Intergenic
1027479869 7:78682368-78682390 GCTGGTGGGTGGGGGGCAAGGGG - Intronic
1027693640 7:81380659-81380681 TCTAGGGGCTGAAAGGCAAGAGG - Intergenic
1027864031 7:83623870-83623892 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1027874923 7:83756664-83756686 TGTTGGGGGAGGGGGGCAAGAGG - Intergenic
1028009338 7:85620647-85620669 TTTGGGGGGTGGAGGGCTGGGGG + Intergenic
1028101393 7:86825105-86825127 ACTAGAAGGTGGAGGGCAGGAGG - Intronic
1028689433 7:93635193-93635215 GTCAGTGGGTGGAGGGCAAGGGG - Intronic
1028822928 7:95233365-95233387 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1028888041 7:95956528-95956550 TGTCGGGGGTGGGGGGCAAGAGG - Intronic
1028998010 7:97123140-97123162 TTCAGGGGGTGGGGGGAAAGAGG - Intronic
1029195149 7:98800278-98800300 ACTTGAGGGTGGAGGGCAGGAGG - Intergenic
1029537126 7:101163404-101163426 TCGAGGAGGTGGAGGAGAAGCGG - Exonic
1029714709 7:102319631-102319653 TCTGGGGTGTGTGGGGCAAGAGG - Intronic
1029871093 7:103693341-103693363 TCGGGGGGTTGGGGGGCAAGGGG + Intronic
1029913219 7:104177719-104177741 TTTGCGGGGTGGAGGGCAAGGGG - Intronic
1029973902 7:104815086-104815108 TCTCGGGGTTGGGGGGCAGGCGG - Intronic
1030482873 7:110126089-110126111 TTTGGGGGGTGGGGGACAAGGGG + Intergenic
1030679407 7:112418972-112418994 GTTGCGGGGTGGAGGGCAAGGGG + Intergenic
1030971642 7:116064542-116064564 TCAAGGGGGTGGAGGGCAAGGGG + Intronic
1030973497 7:116090961-116090983 TGTCGGGGGTGGGGGGCAAGGGG + Intronic
1030998932 7:116392218-116392240 TGTCGGGGGTGGCGGGCAAGGGG + Intronic
1031211141 7:118827773-118827795 GTCAGGGGGTGGGGGGCAAGAGG + Intergenic
1031268438 7:119612348-119612370 TGTCGGGGGTGGGGGGCTAGAGG + Intergenic
1031278918 7:119770056-119770078 GCTAGGGGATGGAGGGAATGGGG + Intergenic
1031712087 7:125061302-125061324 CCAGGGAGGTGGAGGGCAAGGGG - Intergenic
1031856420 7:126928221-126928243 GGTGGGGGGTGGGGGGCAAGGGG + Intronic
1031900227 7:127401255-127401277 GTCAGGGAGTGGAGGGCAAGGGG - Intronic
1032255074 7:130290592-130290614 GCCAGGGGCTGAAGGGCAAGAGG - Intergenic
1032890129 7:136185577-136185599 TGTTGGGGGTTGGGGGCAAGGGG - Intergenic
1033083499 7:138320707-138320729 TGTCGGGGGTGGGGGCCAAGGGG + Intergenic
1033245547 7:139714074-139714096 ACGAGGGAGTGGAGAGCAAGTGG + Intronic
1033963938 7:146950440-146950462 TGTTGGTGGTGGGGGGCAAGGGG - Intronic
1034097292 7:148421638-148421660 TCCAGGGTGTGGGGGGCATGGGG - Intergenic
1034285700 7:149881866-149881888 TCTTGGGGGTAGAGGACAATGGG - Intergenic
1034373094 7:150617696-150617718 GTAAGGGGGTGCAGGGCAAGGGG - Intergenic
1034594324 7:152175463-152175485 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1034791845 7:153977702-153977724 TGTCGGGGGTGGGGGACAAGGGG - Intronic
1034999719 7:155603185-155603207 TCTGGAGAGTGGAGGGCAGGAGG - Intergenic
1036925739 8:12903717-12903739 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1036938275 8:13026396-13026418 CCCCGGGGGTAGAGGGCAAGAGG - Exonic
1036985097 8:13520468-13520490 TGTAGGGGGTTGGGGGCTAGGGG + Intergenic
1037462189 8:19122208-19122230 TCTAGTGGGTGAATGGAAAGTGG - Intergenic
1037709923 8:21347438-21347460 ACTAGGGGGTGGAGAGAAAAAGG - Intergenic
1037719315 8:21429394-21429416 TCTAGGGGAGAGAGGGCAGGGGG + Intergenic
1037739782 8:21599029-21599051 TCAGGGGGTTGGGGGGCAAGGGG + Intergenic
1038101422 8:24381297-24381319 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
1038858929 8:31364559-31364581 TGTCGGGGATGGGGGGCAAGGGG - Intergenic
1039121692 8:34155238-34155260 TCTAGAGGGAAAAGGGCAAGCGG - Intergenic
1039267690 8:35843640-35843662 TTTAGGGGATGGGGGGCAAGGGG - Intergenic
1039456823 8:37712708-37712730 ACAGGTGGGTGGAGGGCAAGTGG + Intergenic
1039777714 8:40753039-40753061 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
1040519540 8:48163528-48163550 GTTAGTGGGTGGAGGGCTAGGGG - Intergenic
1040719197 8:50296608-50296630 TCAGGAGGATGGAGGGCAAGGGG + Intronic
1040748650 8:50677973-50677995 TGTGGGGAGAGGAGGGCAAGGGG + Intronic
1040963379 8:53059361-53059383 GTTGTGGGGTGGAGGGCAAGGGG + Intergenic
1041418563 8:57641811-57641833 GTTAGGGGGTGGGGGGCAAGCGG - Intergenic
1041645501 8:60247401-60247423 TGTTGGGGGTGGAGCGGAAGGGG - Intronic
1041666824 8:60453694-60453716 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1041966561 8:63685275-63685297 AGTAGGGGGTGGAGAGGAAGAGG - Intergenic
1042065772 8:64874154-64874176 TTCTGGGGGTGGGGGGCAAGGGG + Intergenic
1042116094 8:65433161-65433183 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
1042362812 8:67901971-67901993 TTTTGGAGGTGGAGGGCAGGGGG - Intergenic
1042470270 8:69179388-69179410 TTTAGGGGGTGTAGGGAAATGGG + Intergenic
1042993066 8:74662431-74662453 GCTGAGGGGTGGGGGGCAAGGGG + Intronic
1042995949 8:74698777-74698799 CTTAGGGGGTGGGAGGCAAGGGG + Intronic
1043032321 8:75152000-75152022 TTCAGGGGGTGGGGGGCTAGGGG + Intergenic
1043368589 8:79564210-79564232 GTGAGGGGGTGGGGGGCAAGGGG + Intergenic
1043646672 8:82530212-82530234 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1043870725 8:85428861-85428883 CACAGGGGGTGGGGGGCAAGGGG - Intronic
1044170573 8:89046738-89046760 ACTTGAGGGTGGAGGGCAGGAGG - Intergenic
1044557928 8:93584846-93584868 ACTTGAGGGTGGAGGGCAGGAGG + Intergenic
1044773037 8:95657731-95657753 ACTAGAGGGTGGAGGGAAACAGG + Intergenic
1045391180 8:101716315-101716337 GTTGGGGGGTGGTGGGCAAGGGG + Intronic
1045456324 8:102383282-102383304 TCTAGAGGGTGGGGAGCTAGGGG - Intronic
1045893274 8:107183045-107183067 TCTTGGGGGTCGGGGGTAAGGGG + Intergenic
1046036457 8:108847879-108847901 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1046476541 8:114751935-114751957 GTTAGGGGGTGGGGGTCAAGGGG + Intergenic
1046785955 8:118266829-118266851 GCTAGGGGGTGGAGGGGTTGAGG + Intronic
1047230791 8:122996290-122996312 CCTCGGGGGTGGTGGGAAAGCGG - Intergenic
1047369006 8:124239723-124239745 GTTGGGGGATGGAGGGCAAGGGG - Intergenic
1047374691 8:124284877-124284899 ATCAGGGGGTGGGGGGCAAGGGG - Intergenic
1047457140 8:125025336-125025358 TACAGTGGGTGGAGGGCAAGGGG + Intronic
1047736905 8:127773742-127773764 TGTCGGGGGTGGGGGACAAGGGG + Intergenic
1048411761 8:134182394-134182416 GTTAGGGGGTGGGAGGCAAGGGG - Intergenic
1048448962 8:134514954-134514976 TGTTGGGGGTGGAGGGCTAGGGG - Intronic
1048837567 8:138536013-138536035 TCCAGGAGGTGGTGTGCAAGAGG + Intergenic
1048868405 8:138777513-138777535 GTTGGGGGGTGGTGGGCAAGGGG - Intronic
1049030925 8:140036991-140037013 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1049038382 8:140094445-140094467 TCTGGGTGGTGGTGGGCAGGAGG - Intronic
1049232141 8:141489931-141489953 TCTGAGGGGTGGTGGGCAATGGG + Intergenic
1049989915 9:981176-981198 GCTAGGAGGCGCAGGGCAAGAGG - Intronic
1050003939 9:1108315-1108337 TGCAGGGGGTGGGGGACAAGGGG - Intergenic
1050032304 9:1399337-1399359 TGTTGGGGGTAGGGGGCAAGGGG + Intergenic
1050403544 9:5282624-5282646 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
1050514488 9:6428919-6428941 TTTGGGAGGTGGAGGACAAGTGG + Intronic
1050855181 9:10345411-10345433 TGTGGGGGGTGGGGGGCTAGGGG - Intronic
1051112072 9:13650745-13650767 TCAAGGGGGTGGGAGGCAAGGGG - Intergenic
1051231026 9:14955707-14955729 TGCAGGGGGTGAAGGGCTAGGGG + Intergenic
1051233513 9:14976472-14976494 TCTTGGGAGTGGGGGGCGAGTGG + Intergenic
1051338576 9:16090412-16090434 GTTAGGGGGTGGGGGGCTAGTGG + Intergenic
1051951044 9:22633162-22633184 GTTGGGAGGTGGAGGGCAAGGGG + Intergenic
1052383106 9:27793187-27793209 TATTGGGGGTACAGGGCAAGAGG + Intergenic
1052539794 9:29795826-29795848 GCTGGGGGGTGGGGGGCTAGGGG - Intergenic
1052556149 9:30020725-30020747 TGTTGGGGGTTGGGGGCAAGGGG - Intergenic
1052596927 9:30573298-30573320 TGTCGGGGGTGGAGGACAAGTGG + Intergenic
1052795806 9:32922279-32922301 ACTAGGGGCTGAAGGGCAGGAGG + Intergenic
1052852406 9:33386028-33386050 CCTGAGGGGTGGAGGGCAGGGGG + Intronic
1053033320 9:34801904-34801926 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1053049697 9:34949844-34949866 TCTCGGGGGTAGGGGGAAAGGGG + Intergenic
1053156225 9:35781427-35781449 AGGAGGGGGTGGAGGGGAAGGGG + Intergenic
1053441782 9:38122496-38122518 GCTAGGGGCTGGAGGGAGAGAGG - Intergenic
1053628407 9:39902386-39902408 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1053680505 9:40482579-40482601 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1053777652 9:41563941-41563963 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1053840706 9:42186603-42186625 TCTGGTGGGTGGCGGGAAAGAGG - Exonic
1053930494 9:43110890-43110912 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1054215480 9:62348315-62348337 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1054283207 9:63142356-63142378 CCTGAGGGGTGGAGGGCAGGGGG - Intergenic
1054293590 9:63318094-63318116 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1054391612 9:64622583-64622605 CCTGAGGGGTGGAGGGCAGGGGG + Intergenic
1054504116 9:65893745-65893767 CCTGAGGGGTGGAGGGCAGGGGG - Intronic
1054672001 9:67807032-67807054 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1054871040 9:70047348-70047370 TGTTGGGGGTGGGGCGCAAGGGG - Intronic
1055074175 9:72196737-72196759 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
1055177483 9:73337489-73337511 GTTGGGGGGTGGAGGGCAAGTGG + Intergenic
1055208981 9:73766206-73766228 AGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1056255455 9:84794997-84795019 TTTGGGGGGTGGAGGGCACAGGG - Intronic
1056679993 9:88708746-88708768 ATTAGGAGGTGGGGGGCAAGGGG + Intergenic
1057308563 9:93926955-93926977 TGTCGGGGTTGGGGGGCAAGGGG - Intergenic
1057916386 9:99058804-99058826 TCTAGTGGATAGAGGGCCAGTGG - Intronic
1058034015 9:100231502-100231524 GTTGGGGGGTGGGGGGCAAGGGG - Intronic
1058080935 9:100700389-100700411 TATCGGGGGTGGGGGGCTAGGGG + Intergenic
1058226081 9:102365652-102365674 TGTTGGGGGTAGAGAGCAAGGGG - Intergenic
1058507972 9:105685927-105685949 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1058530741 9:105902577-105902599 TCGAGGTGGTAGAGGGCAACTGG + Intergenic
1058578772 9:106431991-106432013 GCGGGGGGGTGGGGGGCAAGAGG - Intergenic
1058934939 9:109761520-109761542 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1059178510 9:112189872-112189894 TGTGGGGGGTGGGGGGCTAGGGG - Intergenic
1059360209 9:113736194-113736216 TCTGAGGGGTAGAGGGGAAGGGG + Intergenic
1059601704 9:115785623-115785645 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1060208482 9:121696561-121696583 TCATGGGGGTGGAGGGCCAAGGG - Intronic
1061010828 9:127953685-127953707 TCTGAGGGGAGGAGGGCAACGGG + Intronic
1061187500 9:129063337-129063359 CCTCGGGGGTGGGAGGCAAGGGG + Intronic
1061287823 9:129634199-129634221 ACCTGGGGGAGGAGGGCAAGAGG + Exonic
1061858960 9:133458141-133458163 CCTAGGGCGTGCAGGGCTAGGGG + Intronic
1062466299 9:136683058-136683080 ACTAGGGGGTGGGGGGGAGGGGG + Intronic
1185511862 X:669744-669766 GCTAGGGGATGGAGGGCATTAGG + Intergenic
1185669661 X:1797555-1797577 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1185695458 X:2190895-2190917 GCTGGGGGTTGGGGGGCAAGGGG + Intergenic
1185711334 X:2305836-2305858 GTTGGGGGGTGGGGGGCAAGGGG + Intronic
1185911861 X:3988883-3988905 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1185917671 X:4053890-4053912 GTCAGGGGGTGGAGGGCAAAGGG - Intergenic
1186333189 X:8558167-8558189 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1186436830 X:9550207-9550229 TGTAGGGGGTGGGGAGAAAGAGG + Intronic
1186618940 X:11216861-11216883 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1186631707 X:11356258-11356280 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1186947400 X:14584045-14584067 ACTTGAGGGTGGAGGGAAAGAGG + Intronic
1187144811 X:16627793-16627815 TCTGGTGGGTGGAGAGCAGGGGG - Intronic
1187247811 X:17568811-17568833 TCTGTGGGGTGGGGGGCTAGGGG - Intronic
1187258315 X:17661419-17661441 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1187575934 X:20555238-20555260 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1187597982 X:20796158-20796180 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1187699402 X:21950591-21950613 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1187731600 X:22260712-22260734 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1187753163 X:22489612-22489634 GTTAGGGGGTGGGGGGTAAGGGG + Intergenic
1187804560 X:23104622-23104644 TGTCGGGGGTGGGGGGCAAAGGG + Intergenic
1187886717 X:23895487-23895509 ATCAGGGGATGGAGGGCAAGGGG + Intronic
1188000366 X:24974649-24974671 GTTGGGGGGTGGGGGGCAAGGGG + Intronic
1188280590 X:28263180-28263202 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1188778868 X:34254944-34254966 GTTAGGGGGTGGGGGGCTAGGGG + Intergenic
1189009097 X:37028375-37028397 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1189295791 X:39916648-39916670 TCCAGGGGGTGGCCTGCAAGTGG - Intergenic
1189359413 X:40338075-40338097 GTCGGGGGGTGGAGGGCAAGGGG + Intergenic
1189439192 X:41019154-41019176 TCTAGCTGGTTGGGGGCAAGAGG + Intergenic
1189736957 X:44081025-44081047 ACTCGGGGGTGGAGGGTGAGAGG - Intergenic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1190491328 X:50985262-50985284 GCTAGTGGCTGGAGGGCAGGGGG + Intergenic
1190493695 X:51007126-51007148 GCTGGGGGGTGAGGGGCAAGGGG - Intergenic
1190510726 X:51171282-51171304 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1190551094 X:51581650-51581672 GTTAGGAGGTGGAGGGCGAGGGG + Intergenic
1190603541 X:52117103-52117125 ACTGGGGGGTGGAGGTCTAGGGG + Intergenic
1191140564 X:57112096-57112118 ACTTGAGGGTGGAGGGTAAGAGG + Intergenic
1191182061 X:57574779-57574801 TGGAGGGGTTGGAGGGCACGAGG - Intergenic
1191854557 X:65613026-65613048 TGTTGGGGGTTGGGGGCAAGGGG - Intronic
1191949642 X:66574658-66574680 TCTGGGAGGTGGGGGGCAAGGGG - Intergenic
1192043639 X:67649019-67649041 ATTAGGGGGTGGTGGGCTAGTGG - Intronic
1192185820 X:68946228-68946250 TGCATGGGGTGGAGGGAAAGAGG - Intergenic
1192302759 X:69923284-69923306 GTTTGGGGGTGGGGGGCAAGGGG - Intronic
1192359319 X:70429094-70429116 TCTGGGAGTTGTAGGGCAAGTGG + Intronic
1192540339 X:71964209-71964231 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1192616192 X:72625249-72625271 TCTTGAGGATGGAGGGCGAGAGG - Intronic
1192637553 X:72833632-72833654 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1192644161 X:72887182-72887204 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1192662660 X:73058336-73058358 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1192850283 X:74948717-74948739 GTTGGGGGGTGGAGGGCAAGAGG - Intergenic
1192963700 X:76155448-76155470 TGTCGGGGGTGGGGGACAAGGGG + Intergenic
1192994500 X:76498602-76498624 TCTGGGTTGTGGTGGGCAAGGGG + Intergenic
1193056288 X:77154713-77154735 TTTTGGGGGTGGGGGACAAGGGG + Intergenic
1193084300 X:77435435-77435457 GCTGGGGGGTGGAGGTGAAGGGG - Intergenic
1193160706 X:78226048-78226070 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1193339599 X:80332502-80332524 GTCAGGGGGTGGGGGGCAAGAGG + Intergenic
1193339926 X:80335479-80335501 TTGGGGGGCTGGAGGGCAAGAGG + Intergenic
1193527952 X:82616996-82617018 GTGAGGGGGTGGAGGGCTAGGGG - Intergenic
1193552952 X:82921573-82921595 TGTTGGGGGTGTGGGGCAAGGGG - Intergenic
1193568883 X:83116893-83116915 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1193615469 X:83683073-83683095 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1193634057 X:83926506-83926528 GTTAGGGGGTTGAGGGAAAGGGG - Intergenic
1193660175 X:84247874-84247896 TCAAAGGGGTGGGGGGGAAGTGG + Intergenic
1193932177 X:87566909-87566931 TTTGGAGGGTGGAGGGCAGGAGG + Intronic
1194057037 X:89148283-89148305 ACTTGGGGGTTGAGGGTAAGCGG + Intergenic
1194190715 X:90834032-90834054 TGTCGGGGGTGGGGGTCAAGGGG - Intergenic
1194376181 X:93136511-93136533 TGTCGGGGGTTGGGGGCAAGGGG + Intergenic
1194886717 X:99324380-99324402 GTTGGGGGGTGGAGGGCAAGGGG + Intergenic
1195008211 X:100708070-100708092 TGTCGGGGGTGGGGGGCTAGGGG + Intronic
1195209637 X:102641388-102641410 GCTCGGGGGTGCGGGGCAAGGGG - Intergenic
1195534424 X:105995131-105995153 CCTAGGGGGAGGAGGAAAAGGGG - Intergenic
1195633905 X:107090954-107090976 TTCGGGGGGTGGAGGGAAAGGGG - Intronic
1195917592 X:109951057-109951079 AAGAGGGGGTGGGGGGCAAGGGG + Intergenic
1196602335 X:117616850-117616872 TTTAGGGGGTGGAGGGCAAGTGG - Intergenic
1196630932 X:117939085-117939107 TTCAGGGGGTGGGGGGCTAGGGG - Intronic
1196870107 X:120105059-120105081 TGTCGGGGGTGGAGAGCTAGGGG + Intergenic
1196948629 X:120853483-120853505 GCATGGGGGTGGAGGTCAAGGGG + Intergenic
1197029546 X:121797293-121797315 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1197434845 X:126414093-126414115 TGTAGGGGGTGGGGGGCAAGGGG + Intergenic
1198390173 X:136166481-136166503 TGGAGGGGGTGGTGGGGAAGGGG - Intronic
1198455189 X:136810332-136810354 GTTGGGGGGTGGGGGGCAAGGGG - Intergenic
1198620977 X:138509236-138509258 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
1198699303 X:139380810-139380832 TCGGGGGGGTGGGGGGCAAGGGG - Intergenic
1198794538 X:140381438-140381460 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1198833569 X:140777136-140777158 GTTGGGGGGTGGGGGGCAAGGGG + Intergenic
1199021602 X:142884714-142884736 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1199088130 X:143652868-143652890 GTCAGGGGGTGGCGGGCAAGGGG + Intergenic
1199402375 X:147413326-147413348 TGTCAGGGGTGGAGGGCAAGGGG + Intergenic
1199403200 X:147424757-147424779 TGGGGTGGGTGGAGGGCAAGGGG + Intergenic
1199466309 X:148141472-148141494 ATTGGGGGGTGGAGGGCTAGGGG + Intergenic
1199628351 X:149760183-149760205 TCCAGGGGATGAAGGGAAAGGGG - Intergenic
1199788291 X:151125768-151125790 TGTTGGGGGTGGGGTGCAAGGGG + Intergenic
1199852607 X:151736363-151736385 CCTTGGGGTTGGAGGGCAATGGG + Intergenic
1200370260 X:155717551-155717573 GTCAGGGGGTGGGGGGCAAGAGG - Intergenic
1201021469 Y:9662239-9662261 TGTTGGGGGTGGGGGGCTAGTGG + Intergenic
1201939209 Y:19440905-19440927 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1202091802 Y:21198689-21198711 GCCAGGGGGTGGAGGGCTATGGG - Intergenic