ID: 1143872655

View in Genome Browser
Species Human (GRCh38)
Location 17:9968427-9968449
Sequence TGATGGACTTAGAGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143872655_1143872658 7 Left 1143872655 17:9968427-9968449 CCCAGCTCACTCTAAGTCCATCA 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1143872658 17:9968457-9968479 AGAAGTCCTGACATACACTGAGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143872655 Original CRISPR TGATGGACTTAGAGTGAGCT GGG (reversed) Intronic
901117286 1:6857271-6857293 TGATGGATTGAGTGTGGGCTGGG + Intronic
901146410 1:7067811-7067833 TGATGGGCTTAGACGGATCTAGG - Intronic
903039663 1:20519520-20519542 TGATTGACTTATGGTGACCTGGG + Intergenic
904332853 1:29775250-29775272 TTATAGACTGAGTGTGAGCTAGG - Intergenic
907306498 1:53516083-53516105 TGATGGACTCTGTGTGACCTGGG + Intronic
908329403 1:63055874-63055896 GCCTGGACTTAGACTGAGCTGGG + Intergenic
920150000 1:203898395-203898417 TGATTGGCCTAGAGTGAGTTGGG - Intergenic
921222376 1:212982187-212982209 AAATGGACTCAGAGTGAACTAGG - Intronic
1063375004 10:5549070-5549092 TGAATCACTTAGAGTGAACTGGG - Intergenic
1065741224 10:28798871-28798893 ATATGGCCTTATAGTGAGCTTGG + Intergenic
1067297610 10:44983806-44983828 TGCTGGACGGAGAGTGAGCCTGG - Intronic
1067439669 10:46301521-46301543 TGAGGGCCTTGGAGTGAGGTGGG + Intronic
1070311863 10:75279583-75279605 TAAAGGCCTTAGAATGAGCTGGG - Intergenic
1072010051 10:91294815-91294837 GGAAGGACTTGGAGGGAGCTTGG + Intergenic
1075743333 10:124709351-124709373 GGATGGAGCTAGAGAGAGCTGGG - Intronic
1076059249 10:127400675-127400697 GGCTGGACATAGAGTAAGCTGGG + Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079385215 11:19972767-19972789 TGAGGGGCTTAGTGTCAGCTTGG - Intronic
1081564150 11:44246719-44246741 TCATGGATTCAGAGTGGGCTAGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083372970 11:62196195-62196217 TTAGGGACTTAGTCTGAGCTGGG - Intergenic
1090895358 11:130967839-130967861 TGCTGAACTTAGAATGAGGTTGG + Intergenic
1091346564 11:134858097-134858119 TGATAGACTAAGAATGAGCCAGG - Intergenic
1094113506 12:26885325-26885347 TGGTGGACTGAGAGAGGGCTAGG + Intergenic
1094754282 12:33448347-33448369 TCATGGACCTGGAGTGAGTTAGG + Intergenic
1097921308 12:65077503-65077525 TTATGAACTTAGTGTGGGCTGGG + Intronic
1099339919 12:81417197-81417219 TGATGGAATTATAGTGTGTTTGG - Intronic
1101228302 12:102712287-102712309 TGATGGATTTAGTGTGGGCAAGG + Intergenic
1101931181 12:109015508-109015530 TGATGGACTGAAAGTGAAATGGG + Intronic
1102493581 12:113304187-113304209 TGTATGACTTTGAGTGAGCTAGG - Intronic
1103677762 12:122670030-122670052 TGATGAACTTAGTGTGTGCCAGG - Intergenic
1108081261 13:46738855-46738877 TTATGAACTTAGAGAAAGCTAGG - Intronic
1110455380 13:75685252-75685274 ACATGGACTTGGAGTAAGCTGGG + Intronic
1118530454 14:66699730-66699752 TGATGGAATTAGAGAGAGAAAGG + Intronic
1121915927 14:97836907-97836929 TTATGGACCTAGAGTCACCTGGG + Intergenic
1122337785 14:101005299-101005321 TGATGAAACTTGAGTGAGCTTGG + Intergenic
1122400887 14:101466699-101466721 AGATTGAATTAGACTGAGCTGGG + Intergenic
1122855443 14:104557789-104557811 TGATGGACTCAGGCTCAGCTGGG + Intronic
1123626272 15:22228872-22228894 GGGTGGAATGAGAGTGAGCTGGG - Intergenic
1133386950 16:5377455-5377477 TGTTAGAGTTTGAGTGAGCTTGG + Intergenic
1136050990 16:27649872-27649894 TGATGGATTAGGAGTGACCTGGG + Intronic
1136455433 16:30377531-30377553 TGAAGGAAGTAGAGTGACCTGGG + Intronic
1136573975 16:31112390-31112412 AGATGGACTTACATGGAGCTGGG + Exonic
1142354680 16:89596874-89596896 TGAGGGACTTGGAGGGAGCTGGG + Exonic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1148636748 17:49154635-49154657 TGCTGGACCTGGAGAGAGCTCGG - Intronic
1149129180 17:53275631-53275653 TCATGCACTTAAAGTGAGTTTGG - Intergenic
1150050660 17:61958973-61958995 TGATGGAGTCAGAGAGACCTGGG - Intronic
1153746691 18:8186901-8186923 AGATTGACTTAGAGTGGGCAAGG + Intronic
1164610393 19:29627823-29627845 TGGTGGACTTAGGGTGGTCTGGG - Intergenic
1165226366 19:34358046-34358068 TGGTGGAATTTGAGTGTGCTTGG - Intergenic
1166509932 19:43399387-43399409 TGATGGTTTTAGAATGATCTAGG + Intergenic
1168629094 19:57943328-57943350 AGATGGACTCAGAGGGAGCCTGG - Intronic
925420328 2:3704801-3704823 TGATGGACACAGAGTGAGAGGGG - Intronic
925917624 2:8618063-8618085 TGATGGATTTAGAGAGAGAATGG - Intergenic
936545515 2:113389234-113389256 GGATGGACTTAGAGAGACTTCGG + Intergenic
936933778 2:117818186-117818208 TGATGGAATTTCAGTAAGCTCGG + Intronic
937713194 2:125001764-125001786 TGATGAACTTACAGTCATCTAGG + Intergenic
940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG + Intronic
941545326 2:166842926-166842948 GTATGGACTTGGAGTGAGGTAGG + Intergenic
944456871 2:199904090-199904112 TGATGGGTCTAGAGTGAGCTTGG + Intergenic
1170789650 20:19497195-19497217 TCATGGGCTAAGAATGAGCTGGG - Intronic
1171320896 20:24243291-24243313 TGTTGGAGTAAGAGAGAGCTGGG - Intergenic
1171488506 20:25500447-25500469 TGATGATCTCAGAGTGAGCCCGG - Intronic
1175275657 20:57768823-57768845 GGATGGAGTGAGAGTGAGCAGGG - Intergenic
1180392601 22:12298287-12298309 TGATGTGCTTGGTGTGAGCTGGG + Intergenic
1180407147 22:12566481-12566503 TGATGTGCTTGGTGTGAGCTGGG - Intergenic
1181313179 22:21956465-21956487 TTATGGTCTTAGAGGCAGCTGGG - Intergenic
1181346285 22:22222537-22222559 TTATGGTCTTAGAGGCAGCTGGG - Intergenic
1184650079 22:45915644-45915666 AGATGGAGTTAGTGGGAGCTGGG - Intergenic
1185323262 22:50212137-50212159 TGCTGGCCTCAGAGTGAGTTAGG + Intronic
951738440 3:25893860-25893882 TCATATATTTAGAGTGAGCTAGG - Intergenic
954024608 3:47772805-47772827 TGATGTACTTACAGGGAGTTTGG + Exonic
957812982 3:85252363-85252385 TGAAGGAGTGAGAATGAGCTGGG + Intronic
958427681 3:93997915-93997937 AGATGGAGGTTGAGTGAGCTGGG + Intronic
958968320 3:100583759-100583781 TGAATGACTTACAGTGACCTGGG - Intergenic
959167357 3:102797320-102797342 TGCTGTACTTAAAATGAGCTGGG + Intergenic
960579632 3:119265293-119265315 TGTTGGGCTCAGAGTGAGTTGGG - Intergenic
963967197 3:151386065-151386087 TGAAGGATTAAGAGTTAGCTGGG + Intronic
964203555 3:154145493-154145515 TGATGGAGACAGAGTGATCTTGG + Intronic
970840767 4:20465778-20465800 TCATGGAAGTAGAGTGGGCTGGG - Intronic
975215272 4:71746396-71746418 TGAAGGGCTTAGAGTCTGCTGGG + Intronic
976102976 4:81585017-81585039 TGATGGAGGTATAGTGAGATTGG + Intronic
976650850 4:87433001-87433023 TGCTGGCCTCAGAGTGAGTTTGG + Intronic
976953011 4:90857043-90857065 TGAGGGAGTTAGAGTGAGGCTGG + Intronic
981366803 4:143913287-143913309 CGATGGACTTAGAGGCAACTGGG - Intergenic
982228985 4:153191230-153191252 TGATGGGCTTAGTTTGAGTTGGG + Intronic
991146993 5:63318670-63318692 TTATGAACTAAGAGTGAGTTAGG - Intergenic
992344898 5:75866810-75866832 GGAGGGGCTTAGAGTGAACTTGG + Intergenic
992457344 5:76927927-76927949 AGATGGGCTTAGAGTCAGCTGGG - Intergenic
994186050 5:96816555-96816577 TAATGGCATTATAGTGAGCTGGG - Intronic
994898035 5:105730612-105730634 TGATTGACTTACAGAGATCTTGG - Intergenic
998736593 5:145148848-145148870 TGATGGACACTGAGTGGGCTTGG + Intergenic
1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG + Intronic
1003842376 6:10135281-10135303 TGCTGGTCTCAGAGTGAGTTTGG - Intronic
1008138465 6:47804152-47804174 TGATGTACTTAAAATGAACTGGG + Intronic
1012506057 6:99947685-99947707 TGTTGGAATTGGAATGAGCTTGG + Intronic
1014601352 6:123417152-123417174 TGCAGGACTGAGAGTGACCTTGG - Intronic
1015167659 6:130216231-130216253 TGATGGACTTGGAGAGGGGTGGG + Intronic
1017746934 6:157455587-157455609 TCCTGGAGTTACAGTGAGCTGGG + Intronic
1020678104 7:11203885-11203907 TCATGCAATTAGGGTGAGCTGGG - Intergenic
1024937609 7:54727117-54727139 TGATGCCCTTTGAGTGACCTTGG - Intergenic
1025899557 7:65732756-65732778 TGAGCAACTTAGAGTGAGCCTGG - Intergenic
1026054145 7:66970329-66970351 GGATGGACTGAGTGTGAGGTAGG - Intergenic
1034541619 7:151762160-151762182 TGATGGACTTAGCGGGAGAAGGG + Intronic
1035042380 7:155938603-155938625 TGCTGGACTGAGCGGGAGCTGGG + Intergenic
1035154246 7:156899266-156899288 TGAGGGGCAGAGAGTGAGCTTGG - Intergenic
1036679631 8:10861746-10861768 TGAAGGACTCAGAGAGATCTTGG - Intergenic
1046731036 8:117726666-117726688 TGCTGGACCCATAGTGAGCTGGG - Intergenic
1048044155 8:130757395-130757417 TGTTGGCCTTAAATTGAGCTGGG + Intergenic
1049981316 9:906152-906174 TCATGGTCTTAGAGTGGGCAGGG + Intronic
1050406935 9:5319278-5319300 TGATGAACTGAGGGTGAGCAGGG + Intergenic
1050413844 9:5394237-5394259 TGATGAACTGAGGGTGAGCAGGG + Intronic
1052390176 9:27870250-27870272 TGGTGAACTTAGAGTGTGATGGG + Intergenic
1053164364 9:35834159-35834181 TTTTGGATTTAGAGAGAGCTAGG + Intronic
1055803403 9:80066286-80066308 TGATTGACTTAGGGTGGGGTGGG - Intergenic
1187299506 X:18033970-18033992 TGATTTATTTAGAGTGTGCTAGG + Intergenic
1187646440 X:21352316-21352338 TGCTGGCCTTAGAATGAGTTAGG - Intergenic
1188438679 X:30192631-30192653 TGATAGACTAAGAGTTATCTAGG + Intergenic
1192311354 X:70017346-70017368 TGCTGGCCTCAGAGTGAGTTAGG - Intronic
1192330162 X:70168925-70168947 TCAGGGTCCTAGAGTGAGCTGGG + Intergenic
1194059566 X:89180735-89180757 AAATGGACTTAAAGAGAGCTTGG - Intergenic
1194683053 X:96877632-96877654 AGATGGACTTAGTCTGAGCATGG - Intronic
1195090573 X:101454673-101454695 TGGTGTGCTTAGAGTCAGCTTGG - Intronic
1198556670 X:137800782-137800804 TGATGCAGTTAGGGTTAGCTTGG - Intergenic
1199581850 X:149368409-149368431 GGCTGGACTTAGAGGGATCTAGG + Intergenic
1199681433 X:150227337-150227359 TGAGGGACTTAAAATGAACTGGG + Intergenic
1201451037 Y:14115670-14115692 TCATGCACTTAGAGTGAGAATGG - Intergenic
1201848817 Y:18453750-18453772 TCATGGTCTTACAGTGTGCTGGG - Intergenic
1201884501 Y:18866625-18866647 TCATGGTCTTACAGTGTGCTGGG + Intergenic