ID: 1143872779

View in Genome Browser
Species Human (GRCh38)
Location 17:9969584-9969606
Sequence AGCCACCTGGACTCCCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143872774_1143872779 9 Left 1143872774 17:9969552-9969574 CCACTTTCTACCTGGGGGCAGAA 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG 0: 1
1: 0
2: 1
3: 8
4: 184
1143872769_1143872779 22 Left 1143872769 17:9969539-9969561 CCAGACACAGCAACCACTTTCTA 0: 1
1: 0
2: 3
3: 19
4: 191
Right 1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG 0: 1
1: 0
2: 1
3: 8
4: 184
1143872768_1143872779 23 Left 1143872768 17:9969538-9969560 CCCAGACACAGCAACCACTTTCT 0: 1
1: 0
2: 3
3: 26
4: 258
Right 1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG 0: 1
1: 0
2: 1
3: 8
4: 184
1143872777_1143872779 -1 Left 1143872777 17:9969562-9969584 CCTGGGGGCAGAACTGGGCTGCA 0: 1
1: 0
2: 6
3: 33
4: 313
Right 1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG 0: 1
1: 0
2: 1
3: 8
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143872779 Original CRISPR AGCCACCTGGACTCCCATGA TGG Intronic
900151513 1:1181040-1181062 GGCCACCTGGGCTCCCAGGCTGG + Intronic
901620416 1:10581216-10581238 AGCAGTCTGGAATCCCATGAGGG + Intronic
901785312 1:11620738-11620760 AGTCACCTGGACTCACTTCATGG - Intergenic
902450710 1:16495107-16495129 GGCCACCTGGACTCCAATCTTGG + Intergenic
902502157 1:16918232-16918254 GGCCACCTGGACTCCAATCTTGG - Intronic
904461604 1:30684020-30684042 ATCCTCCTGCACTCCCAGGAAGG - Intergenic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
906708269 1:47910594-47910616 AGTGTCCTGGACTCCCATGGGGG - Intronic
908632922 1:66130185-66130207 CTCCACTTGGTCTCCCATGAGGG - Intronic
915339526 1:155168734-155168756 AGCCACCTGCATTTCCATCAAGG + Intergenic
915510099 1:156382147-156382169 AGCCACAAGGACCCCCAGGAGGG - Exonic
917193415 1:172442660-172442682 AACCACCTGGACTTCTGTGAGGG - Exonic
920202235 1:204266592-204266614 AGCCACCTGAACCCCAAGGAGGG - Intronic
921581590 1:216902163-216902185 AACCACCTGGACTGCCATACAGG - Intronic
922796351 1:228341626-228341648 AGCCACCTGGGCCCCCGGGAAGG - Intronic
923800790 1:237206197-237206219 AGCCACTAGGACCCCCAGGAGGG + Intronic
924324652 1:242883420-242883442 GGCCACCTGGTCTGCCATGCTGG + Intergenic
924647651 1:245894064-245894086 AGCCAGCTGGACTTCCAGGGTGG + Intronic
1067766059 10:49088325-49088347 AGCAACCTGGACCTCCAGGAAGG + Intronic
1071387653 10:85138611-85138633 AGCCACCTGGTCTACTGTGATGG - Intergenic
1072158347 10:92743969-92743991 AGACTCCTGGATTCCCATGTGGG + Intergenic
1072683000 10:97520260-97520282 AGCCACCCAGAGCCCCATGAGGG - Intronic
1072763199 10:98075409-98075431 AGCCACCTTGTCTCACATGATGG - Intergenic
1072935122 10:99704655-99704677 CCCCACCTGTACTCCCATCATGG - Exonic
1077271014 11:1681120-1681142 GGCCACCTGGCCTCCCACAAGGG + Intergenic
1077863721 11:6205660-6205682 TGCCACCTGGACCCTCATCAAGG + Exonic
1078308538 11:10215476-10215498 AACCATCTGGACTTCCATAAAGG + Intronic
1081286310 11:41274536-41274558 AGCCAACTGGACTTCCTGGATGG + Intronic
1083921390 11:65782842-65782864 AGGGACCTGGACACCCAAGAGGG - Intergenic
1084259547 11:67966773-67966795 AGGCACCTGCTCCCCCATGATGG + Intergenic
1084781190 11:71409566-71409588 ACCCACCTGGTCTCTCATGTGGG + Intergenic
1087176349 11:95099546-95099568 AGCCAGCTTGGCTCCCAGGAAGG + Intronic
1088781177 11:113135707-113135729 AGCCACCTGCAATGCCATGGAGG + Intronic
1088990619 11:114950324-114950346 AGCCAGCTGCACTCCTATGCAGG - Intergenic
1091636919 12:2203933-2203955 AGCCTCCTGGTCCCCCATGAAGG - Intronic
1092012284 12:5124445-5124467 TGCTACCTGGAATACCATGATGG + Intergenic
1092626021 12:10329874-10329896 AGCCAGTTGGACTAGCATGAAGG - Intergenic
1098977611 12:76919776-76919798 AGCCCCCTGGACTTCCCAGAGGG + Intergenic
1099857457 12:88184453-88184475 AGCCTCCTGGCCTTCCAAGAAGG + Intronic
1102832348 12:116015223-116015245 AGTCACCTGGTTTCCCAAGATGG - Exonic
1103562095 12:121798149-121798171 AGCCACCTGGAACCCCATCCTGG + Intronic
1103945563 12:124524444-124524466 AGTCACCTGGCATCCCAGGAGGG - Intronic
1104769639 12:131353095-131353117 AACCACTTGGACTGCCATAAAGG + Intergenic
1104779956 12:131413649-131413671 AGCCTCCCGGAGTCCCATGCGGG + Intergenic
1105727856 13:23183515-23183537 AGCCACCAGGAATGCCAGGAGGG - Intronic
1108529312 13:51314278-51314300 AGACACCGGGACTTCCTTGAGGG + Intergenic
1109434011 13:62274713-62274735 AGCCAGCTGGACTTCCTGGATGG - Intergenic
1110059750 13:71026666-71026688 AACCTCCTGGCCTTCCATGAAGG + Intergenic
1110060248 13:71031221-71031243 AACCTCCTGGCCTTCCATGAAGG + Intergenic
1110421184 13:75310811-75310833 AGACACCGGGACCCCCTTGAGGG - Intronic
1113802874 13:113095610-113095632 GGCCACCTGCTCTCACATGATGG - Intronic
1114595804 14:23910732-23910754 AGACATCTTGACTCCCAGGAGGG - Intergenic
1118752101 14:68815001-68815023 AGCCAAATGTTCTCCCATGAAGG - Intergenic
1119386652 14:74261509-74261531 TGCCATCTGGACTCCACTGATGG - Exonic
1122843633 14:104478769-104478791 TGCTCCCTGGACTGCCATGATGG - Intronic
1123053385 14:105558688-105558710 AGCCTCCTGGGCTCCCAGGCAGG - Intergenic
1123077962 14:105679102-105679124 AGCCTCCTGGGCTCCCAGGCAGG - Intergenic
1125062084 15:35437070-35437092 AGCCACTTTGACGCCCATGGTGG + Intronic
1125735222 15:41920055-41920077 GGCCACCTGGCATCCCATGGGGG + Intronic
1125750018 15:42021620-42021642 CTCCACCTGGCCTCCCAGGAGGG - Intronic
1129761544 15:78131647-78131669 TGCGACCTGGACTCCCACGGCGG - Intronic
1130920256 15:88337969-88337991 AGCCACCTGCAAACTCATGAGGG - Intergenic
1131154846 15:90068407-90068429 CGCCACCTGGCCTCCCACCAGGG + Exonic
1131230244 15:90654301-90654323 AGGCTCCTGGCCTCCCATCAGGG + Intergenic
1131230295 15:90654461-90654483 GGGCTCCTGGCCTCCCATGAGGG + Intergenic
1131230326 15:90654561-90654583 GGGCTCCTGGCCTCCCATGAGGG + Intergenic
1132591843 16:729507-729529 GGCCAGCTGGACCCACATGAGGG + Exonic
1132995924 16:2822407-2822429 AGCCAGCTGGAGTCCCACAAGGG - Intronic
1133247340 16:4457913-4457935 AGCCACCTCTAATCCCTTGAGGG - Intergenic
1133451230 16:5905591-5905613 AGCCTCCTGAACAGCCATGACGG - Intergenic
1133535259 16:6695836-6695858 AGCCACCTGGATTTCCAGCAGGG - Intronic
1133825023 16:9270646-9270668 GGCCACCTGCTCACCCATGATGG - Intergenic
1141201864 16:81904413-81904435 TGACACCTGGACTCCCACGCAGG - Intronic
1141442171 16:84036672-84036694 GGCCACCCCGAGTCCCATGAAGG + Intronic
1142618473 17:1150627-1150649 AGGGCCCTGGACTCCCAGGAAGG - Intronic
1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG + Intronic
1144248698 17:13394318-13394340 AGCCACCTGCACTCCCAGCTTGG + Intergenic
1145280905 17:21466252-21466274 ATCCACCTGGAATCCCAGCATGG - Intergenic
1145397009 17:22504313-22504335 ATCCACCTGGAATCCCAGAATGG + Intergenic
1151313847 17:73310434-73310456 AGCCCCCTGCCCTCCCCTGAGGG - Intronic
1153462636 18:5353490-5353512 TGTCCCCTGGACTCCAATGAGGG + Intergenic
1160277502 18:77451354-77451376 AACGTCCTGGGCTCCCATGAGGG + Intergenic
1162534163 19:11253353-11253375 AGCCACCTGGACCACCTAGATGG - Intronic
1165170859 19:33890682-33890704 AGGCACCTGGAATCCAAAGAAGG - Intergenic
1165207967 19:34207471-34207493 AGCCACTGGGACTCCCTTGGAGG - Intronic
1166408999 19:42543771-42543793 AGACACCGAGACTCCCAGGAGGG - Intronic
1166454791 19:42931767-42931789 AACCACCTGTATTCCCATTAAGG + Intronic
1168614481 19:57826761-57826783 TTCCACCTGCACTCCCATGGCGG + Intronic
927452600 2:23222003-23222025 AACCAACTGGACACCCAAGATGG + Intergenic
927926485 2:27017231-27017253 AGCCAAATGGACCCCCATTAGGG + Intronic
929914858 2:46126433-46126455 CCCCACATGGACTCCCATGGGGG + Intronic
932391579 2:71395407-71395429 AACCTCCTGGACTTCCAAGAAGG - Intronic
932591172 2:73068834-73068856 AGCCTCCTGCACTCCCAGGTTGG - Intronic
932612219 2:73208321-73208343 AGCCCCCTGCACTCCCATCTGGG - Intronic
934035530 2:88085797-88085819 AGGCACCTGGAGTCCCATGCGGG + Intronic
934560992 2:95313233-95313255 AGCCTCCAGGACTCCCAGGCTGG - Intronic
936013797 2:108942748-108942770 GGCCATCTGGACTCTCACGAAGG + Intronic
942083063 2:172419554-172419576 AGACATCTGGACGCCAATGAGGG + Intergenic
946034566 2:216731605-216731627 GGCCACCTGGACTCCCACAGGGG - Intergenic
947858197 2:233338699-233338721 AGACACCAGGATTCCCAGGACGG - Exonic
948279097 2:236732748-236732770 AGACAGGTGGACTCCCAGGAAGG - Intergenic
948909364 2:240995358-240995380 ACACACATTGACTCCCATGACGG - Intergenic
1168904588 20:1392981-1393003 TTCCACCTGCACTCCCATGGCGG + Exonic
1169208618 20:3753727-3753749 AGCCACAGGGACTCCCACCAGGG - Exonic
1174282340 20:49448264-49448286 AGCCTTTGGGACTCCCATGAGGG + Intronic
1174416693 20:50372190-50372212 AGCTTCCTGGTCTCCCATGTTGG - Intergenic
1175751279 20:61499670-61499692 TGCCACCTGCCATCCCATGAGGG + Intronic
1175964871 20:62655458-62655480 AGCCACCTGGGTTCCCCAGAAGG + Intronic
1175990595 20:62786578-62786600 GGCCACCTGGGCTCCCAGCAGGG - Intergenic
1176244132 20:64089363-64089385 AGCCACCTGCACCCCCACCAAGG - Intronic
1177250687 21:18587024-18587046 CGCCATCTGGAGTCCCAGGAAGG + Intergenic
1181686704 22:24534162-24534184 AGCCACCTGGATTCTCTTGTTGG - Intergenic
1183270947 22:36862332-36862354 GGCCACGTGGACTCCCCTGTAGG - Intronic
1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG + Intronic
950226682 3:11241394-11241416 AGCCAGCTGGACTCCCTGGGTGG + Intronic
950967444 3:17155961-17155983 AGCCACCAGCACTCACATCAGGG + Intergenic
955360608 3:58270981-58271003 AGCCACCTGGCCACCCATGGAGG - Exonic
959813316 3:110644743-110644765 AACCTCCTGGACTTCCAAGAAGG + Intergenic
962332052 3:134486510-134486532 AGCCACCTGGACTCCGAGGAAGG - Intronic
963778511 3:149464097-149464119 TTCCACCTGCACTCCCATGGCGG + Intergenic
964400385 3:156291760-156291782 AGCCGCCAGGACTCCTCTGACGG + Intronic
965620630 3:170639334-170639356 AGCCACTTGGAGTACCATGATGG + Intronic
968746128 4:2361551-2361573 AGCCACCTTGAGGCCCAGGAGGG + Intronic
969606113 4:8203057-8203079 AGCCAACTTGCCCCCCATGAGGG + Intronic
972112908 4:35587807-35587829 AACCACCTGAATTCTCATGAAGG - Intergenic
974083584 4:57236863-57236885 ACACACCTGGATTCCCATCATGG - Intergenic
976636932 4:87295668-87295690 TGCCAACTGGAGTCCCATAAAGG + Intergenic
978662454 4:111144183-111144205 AGACACATGGACTAACATGAGGG + Intergenic
979064329 4:116109062-116109084 AGCCTCCTGGCCTTCCAAGAAGG + Intergenic
980684165 4:136203574-136203596 ACCCCCCTGGACTTCCAAGAAGG + Intergenic
982432640 4:155340013-155340035 AGCCCCCTGGCCTTCCAAGAAGG + Intergenic
983696552 4:170539660-170539682 ATCCACCAGAACTGCCATGAAGG - Intergenic
984663919 4:182405177-182405199 GTCCAGCTGGCCTCCCATGAGGG + Intronic
985476636 5:83281-83303 AACCACCTGGCCTCTCATGGAGG - Intergenic
985521306 5:375047-375069 ATCCTCCTGGACTTCCAGGAAGG - Intronic
988269585 5:28996571-28996593 AGCCACATGGACTTCCACAATGG - Intergenic
988461158 5:31439081-31439103 AGCCTACTGTACTCCCATGCAGG - Intronic
989951756 5:50307667-50307689 AGCCACATGGACTTCCACAATGG + Intergenic
992868291 5:80980284-80980306 AGCCACATGGAAAGCCATGATGG - Intronic
996594811 5:125188194-125188216 AGACAGCTGTCCTCCCATGATGG + Intergenic
997713606 5:136026737-136026759 AGCCACCTGCATTTCCAGGAGGG - Intergenic
999998419 5:157114393-157114415 AGCCACGTGAGTTCCCATGAAGG + Intronic
1000361742 5:160454026-160454048 ACCCCACTGGTCTCCCATGATGG + Intergenic
1001280230 5:170381493-170381515 AGCCACTTGAACCCCTATGATGG + Intronic
1002599722 5:180347296-180347318 AGCCACCTGGGCTCTCCTGCTGG - Intronic
1005304418 6:24499379-24499401 GGCCACCTGGGCTGCCATCAAGG - Intronic
1005533192 6:26729240-26729262 AACCACCTGCAGTTCCATGAAGG + Intergenic
1005537602 6:26772424-26772446 AACCACCTGCAGTTCCATGAAGG - Intergenic
1005835806 6:29708623-29708645 AGCCAGCTGGACTCCCCTCTTGG + Intergenic
1006055425 6:31380309-31380331 AGCCAGCTGGACTCCCCTCTTGG - Intergenic
1007746762 6:44047897-44047919 AGGCTCTTGGCCTCCCATGAAGG + Intergenic
1012157673 6:95840347-95840369 AGCCACCTGGATTCTCTTGTTGG + Intergenic
1013980298 6:116121152-116121174 TGGCACCTGGACCCCCAGGAAGG + Exonic
1014297797 6:119641739-119641761 AGCCAGCAGCACTCACATGATGG - Intergenic
1014329852 6:120049490-120049512 AGCCTCCTTGACTCACCTGATGG - Intergenic
1021506763 7:21394527-21394549 AGCCACCTGGACACATATTATGG + Intergenic
1022487926 7:30794694-30794716 TGTCACCTGGACTCCCATTGTGG + Intronic
1022643301 7:32207871-32207893 AGCCTCTGGGACTCCCATGGGGG + Intronic
1022678220 7:32520778-32520800 AACCATCTGTACACCCATGAGGG - Intronic
1024442131 7:49432381-49432403 AGCCACCTGACCTCCCAACATGG + Intergenic
1026512006 7:71035170-71035192 AGACACCAGGACTTCCAAGATGG + Intergenic
1029076585 7:97939535-97939557 AGGCGCCTGCTCTCCCATGATGG + Intergenic
1029219756 7:98978868-98978890 GTCCAACTGGACTGCCATGAAGG + Exonic
1032997954 7:137469422-137469444 AGCCATGTGGAGTCACATGAAGG + Intronic
1034512949 7:151551244-151551266 AGCCACCTGGCCTGCAATGAGGG - Intergenic
1034549445 7:151810971-151810993 CGCCACCTGGGGTCCCATGGTGG - Intronic
1034732314 7:153398908-153398930 AGCCACCTGGCCACCCTAGAGGG + Intergenic
1036831765 8:12026140-12026162 AGGCACCTGCTCCCCCATGATGG + Intergenic
1037550497 8:19966426-19966448 AGCCAGATGGAGTACCATGAGGG + Exonic
1037772535 8:21810943-21810965 AGCCACCTGACCTCCCATCAGGG + Intronic
1048960764 8:139574814-139574836 TGCCACCTGGACCCCCAAAAAGG + Intergenic
1049059732 8:140267189-140267211 AGGCACCAAGAGTCCCATGAGGG - Intronic
1049335800 8:142084055-142084077 GGATAACTGGACTCCCATGAGGG + Intergenic
1049367196 8:142246217-142246239 AGCCACCCCTACCCCCATGAAGG + Intronic
1049724971 8:144141646-144141668 GGAGACCTGGACTCCCAGGAGGG - Intergenic
1049999322 9:1059687-1059709 AGCCAACTGGATTCACATAATGG - Intergenic
1052778802 9:32759548-32759570 AGAAACATGGATTCCCATGAGGG + Intergenic
1055841675 9:80512717-80512739 ACACACCTGGAGTCCCATCAGGG + Intergenic
1056093856 9:83231394-83231416 GTCCATGTGGACTCCCATGAAGG + Intergenic
1057228287 9:93303987-93304009 AGCCGCCAGGGCACCCATGATGG + Intronic
1058620799 9:106880795-106880817 GGGGACCTGGACTCCCAAGATGG + Intronic
1059071684 9:111144351-111144373 AGGGGCCTGGACTCCCTTGAAGG + Intergenic
1059512286 9:114860346-114860368 AGCCACATGGACTCCCTAAATGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1186098689 X:6131614-6131636 TGACAGCTGGAGTCCCATGAAGG - Intronic
1188903251 X:35761249-35761271 TGGCACCTGGACTCCCAGTATGG - Intergenic
1191225212 X:58035252-58035274 AGACAACTGAACTCCCAGGAGGG - Intergenic
1191908520 X:66122234-66122256 AACCACCTGGCCTTCCAAGAAGG - Intergenic
1196120031 X:112040012-112040034 GGCCATCTGGTCCCCCATGAAGG - Intronic
1197717504 X:129720055-129720077 AGCCACCAGCACCCCCATCATGG + Intergenic
1197789078 X:130232868-130232890 AGACATCTGTACTCCCATGTAGG + Intronic
1198671827 X:139089431-139089453 ACCCAACTGGACTCTTATGAAGG + Intronic
1201222188 Y:11782413-11782435 GGCCACCTGGTCTGCCATGCTGG + Intergenic
1202055968 Y:20829599-20829621 AGCCACCTGGACTTACTTGATGG + Intergenic