ID: 1143873424

View in Genome Browser
Species Human (GRCh38)
Location 17:9974311-9974333
Sequence GAGGGTTGCCAGGATCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143873424_1143873435 15 Left 1143873424 17:9974311-9974333 CCCACAAGATCCTGGCAACCCTC 0: 1
1: 1
2: 0
3: 8
4: 178
Right 1143873435 17:9974349-9974371 CATTGCTATTCCCTGTCCTGGGG 0: 1
1: 0
2: 0
3: 26
4: 199
1143873424_1143873437 23 Left 1143873424 17:9974311-9974333 CCCACAAGATCCTGGCAACCCTC 0: 1
1: 1
2: 0
3: 8
4: 178
Right 1143873437 17:9974357-9974379 TTCCCTGTCCTGGGGGCTCCCGG 0: 1
1: 0
2: 7
3: 57
4: 482
1143873424_1143873436 16 Left 1143873424 17:9974311-9974333 CCCACAAGATCCTGGCAACCCTC 0: 1
1: 1
2: 0
3: 8
4: 178
Right 1143873436 17:9974350-9974372 ATTGCTATTCCCTGTCCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 206
1143873424_1143873434 14 Left 1143873424 17:9974311-9974333 CCCACAAGATCCTGGCAACCCTC 0: 1
1: 1
2: 0
3: 8
4: 178
Right 1143873434 17:9974348-9974370 TCATTGCTATTCCCTGTCCTGGG 0: 1
1: 0
2: 2
3: 10
4: 218
1143873424_1143873433 13 Left 1143873424 17:9974311-9974333 CCCACAAGATCCTGGCAACCCTC 0: 1
1: 1
2: 0
3: 8
4: 178
Right 1143873433 17:9974347-9974369 CTCATTGCTATTCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143873424 Original CRISPR GAGGGTTGCCAGGATCTTGT GGG (reversed) Intronic
904982917 1:34521937-34521959 AAGGGTGTCCCGGATCTTGTGGG + Intergenic
905013920 1:34764236-34764258 GAGGGTTGGCAGGAAGTGGTAGG + Intronic
911716089 1:101134769-101134791 GAGGGGTGGCAGGAGCCTGTAGG - Intergenic
913941628 1:125114404-125114426 GAGGGTTGCTAGGCTCTTTGTGG + Intergenic
915309864 1:155001542-155001564 GAGGGGTGCCTGGATGTTTTGGG - Intergenic
915798753 1:158766050-158766072 GAAGGTGGCTAGGATCTTGCAGG + Exonic
916408737 1:164524014-164524036 GAGGGTTGCCTGAATCTGGGAGG + Intergenic
916844617 1:168637071-168637093 GAGAGTTGGCAGGATTTGGTTGG - Intergenic
918208534 1:182330633-182330655 TAGGGTTGGGAGGATCTTGGAGG - Intergenic
918825634 1:189320218-189320240 GATGGTTGCCAGGAGCTGTTGGG + Intergenic
920079559 1:203362427-203362449 GAGGGGAGCCAGGGCCTTGTAGG - Intergenic
920218260 1:204377130-204377152 GAGGGTTGCCAGGAACTGAGTGG + Intronic
920685374 1:208105157-208105179 GAGGGTGGCCAGGATGGGGTGGG + Intronic
923104209 1:230842107-230842129 GGTGGTTGCCAGGAGCTTGCGGG + Intronic
923625271 1:235608537-235608559 GTTGGTTGCCAGGATCTGGGAGG - Intronic
924703948 1:246482827-246482849 CTGGTTTCCCAGGATCTTGTTGG - Intronic
1063939651 10:11114146-11114168 GAGGGTTTCCTAGTTCTTGTTGG + Intronic
1064906190 10:20348325-20348347 AAGGATTGCCAGGAGCTAGTGGG + Intergenic
1066954787 10:42154688-42154710 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
1066997008 10:42573560-42573582 GAGGGTTGCCATGGTTATGTTGG + Intergenic
1067209308 10:44245483-44245505 CAGGGTTGCCAGGGTCTAGAGGG - Intergenic
1069622344 10:69845658-69845680 GAGGGATGCAGGGACCTTGTGGG - Intronic
1070590961 10:77800635-77800657 CAGGGCTGCCAGGACCTGGTGGG + Intronic
1070808812 10:79286950-79286972 GAGGGTTGGTGGGAACTTGTGGG + Intronic
1073492222 10:103860230-103860252 GGGGGTTGCCAGCATCATCTGGG + Intergenic
1073505207 10:103980848-103980870 GTGGGATTCCTGGATCTTGTAGG + Intronic
1077297736 11:1834019-1834041 GAGGGGTCCCAGGCTCTTGTGGG + Intronic
1077523185 11:3048484-3048506 GAGGGATACCATGATCATGTAGG - Intronic
1078144987 11:8716366-8716388 GAGGGCAGCCAGGGCCTTGTGGG - Intronic
1085852053 11:80132362-80132384 GAGGGTTGCCAGGGCCTTGAGGG - Intergenic
1088175268 11:107046345-107046367 GAAGGTTGCCAGGGGCTGGTGGG + Intergenic
1088930420 11:114345738-114345760 GATGGTTGCCAGGAACTGGGGGG + Intergenic
1089533203 11:119145218-119145240 GAGGGTTAACAGGGTCCTGTGGG - Intergenic
1090462619 11:126905590-126905612 GAGGCTTGCAATGCTCTTGTGGG - Intronic
1092299722 12:7235247-7235269 GGTGGTTGCCAGGAGCTGGTGGG + Intergenic
1092403870 12:8202164-8202186 GAGGGTTTCCCAGATCTTCTGGG + Intergenic
1092450785 12:8600255-8600277 GAGGGTGGGGATGATCTTGTGGG - Intergenic
1097672533 12:62557234-62557256 GAAGGATGACAGGATGTTGTTGG + Intronic
1099930237 12:89065906-89065928 GATGGTTGCCAGGGTCTGGAAGG + Intergenic
1100371712 12:93974811-93974833 GGGAGTAGCCAGGATCTTGCAGG + Intergenic
1101055185 12:100905136-100905158 GAGAGCTGGCAAGATCTTGTGGG + Intronic
1102214296 12:111149435-111149457 GGGGGTTGCCTGTATATTGTGGG + Intronic
1102890342 12:116553782-116553804 GAGGGTTGCCAGGAGTTGGAGGG + Intergenic
1102920950 12:116791139-116791161 GGCAGTTGCCAGGAGCTTGTGGG - Intronic
1106606923 13:31237034-31237056 GAGAGTTGCCTGGACCTAGTAGG + Intronic
1106788011 13:33126314-33126336 GAGGGAAGCCAGGCTTTTGTTGG + Intronic
1108071851 13:46636509-46636531 GATGGTTGCCAGGGGCTTGGAGG - Intronic
1110066333 13:71111190-71111212 GGTGGTTGCCAGGGACTTGTAGG + Intergenic
1112083472 13:96002788-96002810 CTGGGTTGCCAAGATCTTTTGGG - Intronic
1113681660 13:112248733-112248755 GGGGGTTGCCAGCTTGTTGTAGG + Intergenic
1122507115 14:102238707-102238729 GAGAGATGTCAGGATTTTGTCGG - Intronic
1128487525 15:68109577-68109599 GAGGGTTTTCAGGAACTTCTGGG - Intronic
1133695552 16:8259275-8259297 GAAGGTTGCCAGGAGCTGGAGGG - Intergenic
1135532210 16:23264450-23264472 GAGGGTTGAGAGGGTCTTGAAGG + Intergenic
1136696932 16:32089717-32089739 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
1136797432 16:33033007-33033029 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
1137084824 16:36106416-36106438 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
1138378929 16:56587021-56587043 AAGGGTGGCCAGGATTTTGAGGG - Intergenic
1138838329 16:60465869-60465891 GATGTTTTCCAGGATCTGGTGGG + Intergenic
1142819328 17:2452437-2452459 GAGAGTAGCTAGGATCTAGTGGG - Intronic
1143284121 17:5776545-5776567 AAGTGATGCCAGGATCTTCTGGG - Intronic
1143653497 17:8279075-8279097 AAAGGTTGCCAGAATCTAGTTGG + Intergenic
1143873424 17:9974311-9974333 GAGGGTTGCCAGGATCTTGTGGG - Intronic
1143952219 17:10642442-10642464 GAGGTGTGCCAGGAGCCTGTTGG + Exonic
1147212798 17:38881812-38881834 GAGGGGAGCTAGGATCTTGCAGG + Intronic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1150605567 17:66687759-66687781 GAGGGTTGCCAGGATTTCAGAGG + Intronic
1150962838 17:69933951-69933973 GGTGGTTGCCAGGATCTGGAAGG - Intergenic
1151804349 17:76396465-76396487 GAGGCTCTCCAGGATCTTGATGG + Exonic
1153053945 18:927198-927220 AAGGGATGCTAGGATCTTCTGGG + Intergenic
1153235980 18:2988113-2988135 GAGGGTTGCCAGATTCTGTTGGG - Intronic
1154007197 18:10541914-10541936 GAGAGAGGCCAGGATCTTTTCGG + Intronic
1158490187 18:57902975-57902997 GAGAGTTATCTGGATCTTGTGGG - Intergenic
1162080608 19:8215596-8215618 GAGGGTGCCCAGGCTCTTGTGGG - Intronic
1163165955 19:15498393-15498415 GATGGTTGCCAGGGGCTTGGCGG - Intronic
1164887108 19:31788565-31788587 GAGGGGAGCCAAGATCCTGTGGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167352051 19:48981655-48981677 GGGGGAGGCCAGGATCATGTGGG + Intronic
1167653307 19:50745935-50745957 TAGGGTTGTCAGGACCTTCTGGG + Intergenic
1202669195 1_KI270709v1_random:35126-35148 GAGGGTTGCTAGGCTCTTTGTGG + Intergenic
927542238 2:23923337-23923359 GGTGATTGCCAGGGTCTTGTGGG + Intronic
927767483 2:25825455-25825477 GGTGGTTGCCAGGAGCTGGTGGG - Intronic
930144293 2:47985546-47985568 GATAGTTGCCAGGAGCTGGTGGG - Intergenic
930341024 2:50114838-50114860 ATTGGTTGCCAGGATCTAGTGGG + Intronic
930377417 2:50585350-50585372 GATGGTTACCAGGGGCTTGTGGG + Intronic
934252100 2:90364739-90364761 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
934257343 2:91438207-91438229 GAGGGTTGCTAGGCTCTTTGTGG + Intergenic
934525786 2:95050754-95050776 GGGGGATGCCAGGATCCTGAGGG - Intronic
935194681 2:100805901-100805923 GGGGGTTGCCAGGAGCTGGGGGG + Intergenic
936111482 2:109669690-109669712 GAGGGTTGTCAGAACCTTGGAGG - Intergenic
937478835 2:122238874-122238896 GAAGGTTGACAGGAGCGTGTTGG - Intergenic
937798250 2:126051176-126051198 GAGAGTTGCCAGAACCATGTTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938583399 2:132668380-132668402 GAGGGCTGCCAGGCTCTTACCGG + Exonic
938773855 2:134523913-134523935 GAGTGTTGACAGCATCTAGTGGG + Intronic
938911009 2:135886027-135886049 GAGGCCAACCAGGATCTTGTAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941946026 2:171098083-171098105 GATGGTTGCCAGGAACTAGGGGG + Intronic
945972054 2:216240580-216240602 GAGGGATGGCAGGATCTCCTGGG - Intergenic
946278472 2:218648733-218648755 GTGGCTTACCAGGATCATGTAGG - Exonic
948400722 2:237683016-237683038 GAGCGCTGCCAGCATCTGGTGGG + Intronic
1170885928 20:20339958-20339980 GAGGGTGTCTCGGATCTTGTGGG - Intronic
1171026810 20:21638288-21638310 GATGGTTGCCAGGATCTGAGGGG - Intergenic
1172566051 20:35931351-35931373 GTGGGTGGCCACGATCTTCTTGG - Exonic
1172611261 20:36254420-36254442 GTGGGTTGCCAGGGCCTGGTGGG + Intronic
1173283236 20:41648058-41648080 AAAGTTTGCCTGGATCTTGTAGG + Intergenic
1173757228 20:45527395-45527417 GATGGTTGCCAGGGGCTGGTGGG - Intergenic
1174398486 20:50262502-50262524 GACGGTTGCCAGGAACTGGGGGG - Intergenic
1177619823 21:23574514-23574536 AATGGTTGTCAGGAGCTTGTGGG - Intergenic
1177750623 21:25278967-25278989 GTTGGTTGCCAGGAACTTGGTGG - Intergenic
1178608199 21:34057509-34057531 GAGGCTAGCCAGAAGCTTGTGGG + Intergenic
1181358770 22:22319023-22319045 GAGGGTTCCCTGGCTTTTGTTGG - Intergenic
1183254472 22:36753519-36753541 AAGGGTTTCCAGGACCTTGCAGG - Intergenic
1203325451 22_KI270738v1_random:10222-10244 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
950066575 3:10116368-10116390 GAGGGATGCCAGGATCTTGTAGG + Intronic
952255398 3:31690894-31690916 GAGGGTGCCCAGGAGATTGTAGG - Intronic
953857637 3:46512517-46512539 GGTGGTTGCCAGGAGCTTGGAGG - Intergenic
954485154 3:50842624-50842646 GAGGGTTGCTGGCATCTAGTAGG - Intronic
957822034 3:85389015-85389037 TAGGGTTTCCAGGACATTGTGGG + Intronic
960996097 3:123341455-123341477 GATGGTTTCCAGGAGCTTGGGGG + Intronic
961887225 3:130104174-130104196 GAAGGCTGCCAGGTTCTTGATGG + Intronic
961940083 3:130628044-130628066 GAGGCATTCCAAGATCTTGTTGG + Intronic
962896787 3:139722736-139722758 TAGGGTAGCCAGGACCTTTTTGG + Intergenic
965875716 3:173316833-173316855 GAGAGTTGCCAGGTTCCAGTGGG + Intergenic
968848760 4:3063339-3063361 CAGGGCTGCCTGGTTCTTGTAGG + Intergenic
970431263 4:15991009-15991031 GAATGTTGCCAGGATGGTGTCGG - Intronic
978372939 4:108047265-108047287 GAGGGTTGCCAGGATTCAGATGG - Intergenic
981980336 4:150784430-150784452 CTGTGTTGCCAGGATCATGTGGG - Intronic
983605840 4:169582694-169582716 TAGGGTTTTCAGGATCTTCTTGG - Intronic
986345918 5:6835054-6835076 GAGGGTTGCTTGTATCTTCTTGG + Intergenic
986694107 5:10336939-10336961 GAGGGTTACCAGGAGCTTGGAGG + Intergenic
989181053 5:38577502-38577524 GAGGGTGTGCAGGTTCTTGTGGG - Intronic
991243912 5:64489151-64489173 AAGGCTTGCCAAGATCTTGTAGG + Intergenic
991256162 5:64617497-64617519 GAGGGTTACCATGCTCTTATTGG + Intergenic
991501912 5:67285558-67285580 GAAGGATGACAGCATCTTGTAGG - Intergenic
993413964 5:87602456-87602478 AAGGGTTGCAAAGATCCTGTGGG + Intergenic
996643132 5:125781675-125781697 AATAGTTGCCAGGATTTTGTGGG - Intergenic
997580217 5:135012336-135012358 GAGTGGTGCCAGGACCTTGATGG - Intergenic
998571143 5:143259121-143259143 CAGGGCTGTCAGGATCTTCTGGG + Intergenic
999189980 5:149739931-149739953 CAGGGTTGACAGGCTCTTGGTGG + Intronic
999405745 5:151305047-151305069 GTGGGTGGGCAGGATCTTGTAGG + Intergenic
1003388649 6:5692871-5692893 GAGGGTTGGCAGCAACTTGGTGG - Intronic
1004005927 6:11637173-11637195 GAGAGTTGCCAGAAGCTTGGAGG + Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1004698350 6:18055191-18055213 GATGGTTGCCAGGGACTTGGGGG + Intergenic
1005424368 6:25685911-25685933 GGTGGTTGCCAGGGCCTTGTGGG - Intronic
1008083705 6:47221699-47221721 GCGTGTTGCTAGGATCATGTGGG - Intergenic
1008881593 6:56385728-56385750 GAGGGTTGTCAGGAGCTGGGAGG - Intronic
1013320301 6:108981480-108981502 GATGGTTGCCAAGAGCTGGTGGG - Intergenic
1017358294 6:153536213-153536235 GTGGGTTGCCAGGCCCTGGTGGG + Intergenic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1020476348 7:8599492-8599514 GAGGTCTGCCATGATCTGGTAGG + Intronic
1021822034 7:24507877-24507899 GATTGTTGCCAGGAACTGGTGGG + Intergenic
1023590411 7:41775208-41775230 GAGGCTGGACAGGATCTTGATGG + Intergenic
1024614518 7:51099566-51099588 GGTGGTTGCCAGGAGCTTGAGGG + Intronic
1024904072 7:54356184-54356206 CAGTTTTGCCATGATCTTGTAGG + Intergenic
1025319707 7:58082675-58082697 GAGGGTTGCTAGGCTCTTTGTGG + Intergenic
1025554006 7:62280799-62280821 GAGGGTTGCTAGGCTCTTTGTGG - Intergenic
1025560775 7:62372475-62372497 GAGGGTTGCTAGGCTCTTTGTGG + Intergenic
1029690123 7:102175644-102175666 GAGGGCTGGCGGGACCTTGTCGG - Intronic
1031544127 7:123031626-123031648 GAGGGTTTCCTGGGTATTGTAGG + Intergenic
1032493534 7:132343411-132343433 GGTGATTGCCAGGACCTTGTGGG - Intronic
1033381093 7:140820218-140820240 CATGTTGGCCAGGATCTTGTGGG + Intronic
1034716829 7:153251204-153251226 GATGGTTACCAGGATCTGGGGGG + Intergenic
1036498512 8:9292742-9292764 GCAGGATGCCAGGATCTTGAAGG + Intergenic
1036656817 8:10682168-10682190 GAGGGGTGTCAGGTTCTGGTTGG - Intronic
1036844347 8:12153466-12153488 GAGGGTTTCCCAGATCTTCTAGG + Intergenic
1036865719 8:12395788-12395810 GAGGGTTTCCCAGATCTTCTAGG + Intergenic
1037558124 8:20046293-20046315 GGTGGTTGCCAGGAGCTGGTGGG - Intergenic
1040499249 8:47992689-47992711 GAGGGATGTCAGGATTTTGTCGG + Intergenic
1042491834 8:69408278-69408300 GATGGTTGCCAGGAGATGGTGGG + Intergenic
1049048788 8:140174582-140174604 GATGGTTGCCAGGGGCTTGGGGG - Intronic
1049162599 8:141106790-141106812 GGGGGTTGCCAGGAGCTAGGGGG - Intergenic
1050985619 9:12078464-12078486 GGTGGTTGCCAGGATTTTGGGGG + Intergenic
1054984388 9:71244915-71244937 GAGGGTTGCCAGAATCCAGATGG + Intronic
1056515785 9:87348080-87348102 GTTGGTTGCTAGGATTTTGTAGG - Intergenic
1058921430 9:109618886-109618908 GAGGGATGTTAGGATCTTGCAGG + Intergenic
1060778317 9:126392897-126392919 GAGGGTTGGCAGGACCTCCTAGG + Intronic
1062220288 9:135411303-135411325 GAGGGTTTCCTGGATCGTGCCGG - Intergenic
1187492574 X:19765725-19765747 GCTGGTTGCCAGGAGCTGGTGGG - Intronic
1190786481 X:53655586-53655608 GATTGTTGCCAGAATCCTGTTGG - Intronic
1193699266 X:84742689-84742711 GAGAGATGTCAGGATTTTGTCGG - Intergenic
1195755074 X:108192039-108192061 GAATGGTCCCAGGATCTTGTGGG - Intronic
1198414638 X:136407605-136407627 TATGGTTGGCAGGATCTGGTGGG - Intronic
1198960435 X:142176356-142176378 GAGAGTTGCCAGGAGCTTTGTGG - Intergenic