ID: 1143873497

View in Genome Browser
Species Human (GRCh38)
Location 17:9974819-9974841
Sequence CGCCAGCAGCTCCGCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143873496_1143873497 -7 Left 1143873496 17:9974803-9974825 CCAAGCAACAAAGAAGCGCCAGC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1143873497 17:9974819-9974841 CGCCAGCAGCTCCGCCACCCAGG 0: 1
1: 0
2: 2
3: 29
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143873497 Original CRISPR CGCCAGCAGCTCCGCCACCC AGG Intronic
900145606 1:1157613-1157635 TCCCAGCAGCTCCGCCTCCTCGG - Intergenic
900171508 1:1271295-1271317 CCCAAGCAGCACCGCCACACAGG + Intronic
900186100 1:1333947-1333969 GGCCAGCAGCACCACCAGCCAGG - Exonic
900249519 1:1660306-1660328 CACTGGAAGCTCCGCCACCCGGG + Intronic
900310263 1:2030055-2030077 CGCCGGCAGCGCCGCGTCCCGGG + Exonic
900345622 1:2209001-2209023 ACCCAGCAGCTGCTCCACCCTGG + Intronic
900634820 1:3657845-3657867 CTCCAGCAGCTCCTCTACCTGGG + Intronic
900861888 1:5239802-5239824 GGCCAGCAGCCTCCCCACCCAGG + Intergenic
901145304 1:7060845-7060867 CGCCAGCAACTCCGCTTTCCTGG - Intronic
901569507 1:10148149-10148171 CACCGGAAGCTCCGCCTCCCAGG - Intronic
901835218 1:11919782-11919804 AGGCAGCAGCACAGCCACCCTGG + Exonic
902287623 1:15416732-15416754 CACCAGCAGCTTCACCGCCCGGG + Intronic
902503282 1:16924400-16924422 GGCCAGCAGGTCCTCCACGCGGG - Exonic
902506467 1:16941654-16941676 CGCTGCCAGCTCCGCCTCCCGGG - Intronic
903012812 1:20343161-20343183 TCCCAGCAGGCCCGCCACCCCGG + Exonic
903068938 1:20717251-20717273 CCCCAGCGTCTCCGCCTCCCGGG - Intronic
903179820 1:21599535-21599557 TGCCAGCAGCTTCGCCAGCGTGG - Exonic
903208397 1:21800305-21800327 CCCTACCAGCTCCGCCTCCCAGG + Intergenic
904293493 1:29502786-29502808 TGCCACCAGCTCCAGCACCCTGG - Intergenic
904772211 1:32886634-32886656 CCCCAGCGCCCCCGCCACCCGGG - Intronic
905483074 1:38275058-38275080 CAGCAGCTGCTCCCCCACCCTGG + Intergenic
905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG + Intergenic
906068584 1:43000745-43000767 CACCACCACCTCCGCCTCCCGGG + Intergenic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
907230687 1:52995794-52995816 CGGCAGCAGCACGGCCATCCAGG + Intronic
910188608 1:84572752-84572774 CGCCTCCCGCTCCGCCTCCCAGG + Intronic
910576971 1:88776030-88776052 CGCTGCCAGCTCCGCCTCCCAGG - Intronic
916301235 1:163276731-163276753 GGCCAGCAGCTATGCCACCCTGG + Intronic
916804477 1:168244790-168244812 CTCCAGCAGCTCCAGCAGCCTGG + Exonic
917412371 1:174772490-174772512 CACCACAAGCTCCGCCTCCCGGG - Intronic
917413502 1:174784093-174784115 CGCTACAAGCTCCGCCTCCCGGG + Intronic
918131199 1:181631144-181631166 GGCTGGCAGCTCGGCCACCCTGG - Intronic
918652979 1:186989195-186989217 CACCACAAGCTCCGCCTCCCAGG + Intergenic
921189717 1:212699249-212699271 CGGCAGCACCCCCCCCACCCGGG + Intronic
922005297 1:221524108-221524130 CACCACGAGCTCCGCCTCCCGGG - Intergenic
922455455 1:225770459-225770481 CCCCTGCAGCACCCCCACCCAGG + Intergenic
924150379 1:241123673-241123695 CACCACCACCTCCGCCTCCCGGG - Intronic
1063504080 10:6580380-6580402 CGCCAGCCTCCCCGCCAGCCCGG + Intergenic
1064290821 10:14032627-14032649 CGCCAGCAGCTCCCCCTTGCTGG - Intronic
1065180992 10:23125288-23125310 CACCACAAGCTCCGCCACCCGGG - Intergenic
1065879131 10:30024769-30024791 CACCACAAGCTCCGCCTCCCAGG + Intronic
1065995514 10:31055995-31056017 CCCCAGCAGTGCCGCCACACAGG + Intergenic
1066461754 10:35618524-35618546 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1067227538 10:44385527-44385549 CGCCAGCAGGCCCTCCGCCCGGG - Intronic
1067346283 10:45441260-45441282 GACCCGCAGCTCCCCCACCCAGG - Intronic
1068181073 10:53519114-53519136 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1068208095 10:53883789-53883811 CACCACCACCTCCGCCTCCCAGG + Intronic
1068286224 10:54939417-54939439 CACCACAAGCTCCGCCTCCCGGG - Intronic
1068667594 10:59694011-59694033 CACCACAAGCTCCGCCTCCCGGG + Intronic
1069950253 10:72013756-72013778 CCCCATCAGCTCTGCCAGCCTGG - Intergenic
1070570693 10:77637883-77637905 CGCGGGCAGCTCCCCCTCCCCGG + Intronic
1070812859 10:79306956-79306978 AGCCAGCTGTTCCGCCTCCCTGG - Intronic
1070842327 10:79495745-79495767 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1070999174 10:80814428-80814450 CGCCCCCAGCTCCCCCACCTGGG + Intergenic
1071802036 10:89074247-89074269 GGCAAACAGTTCCGCCACCCAGG + Intergenic
1072125082 10:92438570-92438592 CACCACAACCTCCGCCACCCAGG + Intergenic
1072270534 10:93771897-93771919 CACCACCACCTCCGCCTCCCGGG - Intronic
1072283765 10:93894053-93894075 CTCCTGGAGCTCCGCGACCCCGG - Exonic
1072656664 10:97334627-97334649 CGCCCGCAGCTCCGCGCCCGCGG - Exonic
1072720402 10:97777476-97777498 CTGCAGCAGATCCGCCAGCCAGG + Intergenic
1072951357 10:99849152-99849174 CACCACAACCTCCGCCACCCGGG - Intronic
1075149058 10:119910073-119910095 AGCCACCAGCTCTGCCACCGTGG + Intronic
1075712167 10:124536531-124536553 CCCCAGCAGCTTGGCCTCCCTGG - Intronic
1076074046 10:127518508-127518530 CGCTACAAGCTCCGCCTCCCAGG + Intergenic
1076878880 10:133230482-133230504 CAGCAGCAGCTCCGTCTCCCGGG - Exonic
1076895407 10:133308987-133309009 AGGCAGCGGCTCCGCCGCCCCGG - Exonic
1077080516 11:722765-722787 CGCCAGCCCCTCCACCTCCCAGG - Exonic
1077106103 11:843263-843285 CGCCGGCAGCTCCCCGCCCCGGG + Intronic
1077228681 11:1449234-1449256 TGCCAGCAGCTGCCCCAGCCTGG + Intronic
1077470828 11:2759809-2759831 GGCCAGCCCCTCCTCCACCCTGG + Intronic
1077611383 11:3645146-3645168 CAGCAGCAGCTTCCCCACCCAGG + Exonic
1077820126 11:5729193-5729215 CACTACCAGCTCCGCCTCCCAGG + Intronic
1079133929 11:17765510-17765532 AGCCAACAGCTTCACCACCCTGG + Intronic
1079393906 11:20045194-20045216 CACCAGCAGGTCAGCCACACTGG + Exonic
1079430709 11:20386708-20386730 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1080929777 11:36797862-36797884 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1083737604 11:64690559-64690581 TGCAAGCAGCACCTCCACCCTGG - Intronic
1083781305 11:64919265-64919287 CACCACAAGCTCCGCCTCCCAGG - Intronic
1084207945 11:67606830-67606852 CGCCAGCGGCCCCGCCTCCTCGG - Exonic
1084650680 11:70487469-70487491 CGCCACCAGGTCCGACACCGTGG - Intronic
1087169932 11:95040288-95040310 GGCCATCAGTTCCACCACCCAGG - Intergenic
1087900574 11:103636022-103636044 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1089336525 11:117727779-117727801 CCCCAGTAGCTCCCTCACCCAGG - Intronic
1089346978 11:117796970-117796992 CGCCGCCAGCCGCGCCACCCTGG + Intronic
1090636700 11:128694316-128694338 CGCCCGCCGCTTCGCCTCCCCGG - Intronic
1091129438 11:133133231-133133253 CTCCAGCCGCCCTGCCACCCAGG - Intronic
1091283209 11:134394046-134394068 CCCCAGCACCACCGCCTCCCGGG + Intronic
1091428563 12:413012-413034 CACCACAAGCTCCGCCTCCCGGG + Intronic
1091618449 12:2067387-2067409 TGCCACCATCTCCACCACCCAGG - Intronic
1091923571 12:4325016-4325038 CGCCACAACCTCCGCCTCCCGGG + Intronic
1092391618 12:8085093-8085115 CGCCACAACCTCCGCCTCCCCGG + Intronic
1092752921 12:11735674-11735696 CGCCACAACCTCCGCCTCCCGGG + Intronic
1092884138 12:12910944-12910966 CGCCACAAGCTCTGCCTCCCAGG + Intronic
1092997334 12:13962783-13962805 CGACAGCTGCTCTGCCCCCCTGG - Intronic
1094375371 12:29783650-29783672 GGCCAGCAGCGCCGCGGCCCCGG + Exonic
1094411168 12:30170068-30170090 TGCCAGCAGCGCCGCGGCCCCGG + Intergenic
1094585979 12:31777751-31777773 CACTACAAGCTCCGCCACCCAGG + Intergenic
1096055412 12:48646543-48646565 CGCCACAACCTCCGCCTCCCGGG - Intergenic
1096094078 12:48923070-48923092 CACCACAACCTCCGCCACCCGGG - Intronic
1096236145 12:49928650-49928672 CCCTAGCATCTCCACCACCCAGG + Intergenic
1096619948 12:52858099-52858121 CGCCACAACCTCCGCCTCCCAGG - Intergenic
1096634270 12:52948811-52948833 CGCCAGCACCTCCTCCACCTGGG + Intronic
1097027056 12:56064723-56064745 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1098417140 12:70247238-70247260 CGCTACCACCTCCGCCTCCCGGG + Intronic
1099095563 12:78370921-78370943 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1099247207 12:80207275-80207297 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1099958971 12:89378709-89378731 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1099974170 12:89529108-89529130 TGCAAGCTGCTCCGCCTCCCAGG + Intergenic
1101998158 12:109539851-109539873 GGGCAGCAGCTCCTCCACCCGGG + Intergenic
1102277873 12:111597856-111597878 TGCCACCAGCACCGCCACCCCGG + Intronic
1102424102 12:112827209-112827231 CCCCAGCACCTCCCCCAGCCTGG + Intronic
1102937428 12:116909551-116909573 CGCTGGAAGCTCCGCCTCCCGGG - Intergenic
1103209282 12:119154689-119154711 CTCCCCCAGCTCCGCCTCCCCGG - Intronic
1103451689 12:121033684-121033706 CGCCACCAGCTCCACCTCTCTGG + Exonic
1103971815 12:124677361-124677383 CCCCAGCCTCTCCGCCACCTCGG + Intergenic
1104001881 12:124865002-124865024 CGCCACAACCTCCGCCTCCCGGG - Intronic
1104196828 12:126548388-126548410 CGCCACCACCTCCGCCTCCCGGG + Intergenic
1105015506 12:132784272-132784294 AGCCTGCAGCTCCGCCTCCAGGG + Exonic
1105461836 13:20597666-20597688 CGCCGCAAGCTCCGCCTCCCGGG - Intronic
1105684240 13:22762732-22762754 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1105734006 13:23248616-23248638 CGCCGGAAGCTCCGCCTCCCGGG - Intronic
1106466675 13:30019930-30019952 CCCCTGCATCTCCCCCACCCCGG - Intergenic
1107605404 13:42050293-42050315 CGCCACAACCTCCGCCTCCCGGG - Intronic
1110372713 13:74757534-74757556 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1112319693 13:98395272-98395294 CGCCGGCAGCTCTGGCCCCCTGG - Exonic
1112433349 13:99372574-99372596 CTCCAGCAGCTTCCCCACCTTGG - Intronic
1112500342 13:99938334-99938356 TGCCAGTAGCACCTCCACCCAGG + Intergenic
1112983058 13:105410402-105410424 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1114248568 14:20937192-20937214 CACCACCACCTCCGCCTCCCGGG + Intergenic
1114483288 14:23048205-23048227 CGCCAGGAGCTGCGCCACGTCGG + Exonic
1117776450 14:59189083-59189105 CGCCAGCTCCTCGGCCAGCCGGG - Intronic
1119145496 14:72310109-72310131 CTCCAGCACCTTCTCCACCCCGG + Intronic
1122137897 14:99645218-99645240 CGCCAGCAGCGCCCCGGCCCTGG - Exonic
1122782964 14:104151366-104151388 CTCCACCAGCTCCCCCACCCAGG - Intronic
1122937777 14:104967868-104967890 CGCCAAGAGCACCGCCTCCCAGG + Intronic
1123017567 14:105382666-105382688 AGCCAGCAGCTCCAGCACCCAGG - Intronic
1123480665 15:20628673-20628695 CGCCGGCAGCACCGCTCCCCAGG - Intergenic
1123637344 15:22371694-22371716 CGCCGGCAGCACCGCTCCCCAGG + Intergenic
1123707728 15:22962472-22962494 CACCACCACCTCCGCCTCCCTGG + Intronic
1124655533 15:31503937-31503959 CCCCGGCAGCTGCGCCATCCTGG + Intronic
1125478366 15:40062989-40063011 CGCCAGCTCCTCCTCCAGCCAGG + Intergenic
1125631258 15:41149071-41149093 CACCACCACCTCCGCCTCCCAGG + Intergenic
1125658650 15:41378692-41378714 CGCCACAACCTCCGCCTCCCGGG - Intronic
1127831557 15:62755657-62755679 CGCCAACAGCACTGCCAACCTGG + Exonic
1128191769 15:65707759-65707781 CACCAGCACCACCGCCTCCCAGG + Intronic
1129408378 15:75334954-75334976 CGCTGCCAGCTCTGCCACCCGGG - Intergenic
1129524212 15:76203886-76203908 CTCCCGCAGCTCAGTCACCCGGG + Exonic
1129880472 15:79003394-79003416 CGTCAGCAGCTCCTGCCCCCTGG - Intronic
1131290187 15:91100342-91100364 CGCCAGCGGATTTGCCACCCAGG + Exonic
1131367700 15:91853836-91853858 CGGCAGCGGCCCCGACACCCGGG + Exonic
1131819917 15:96261950-96261972 CCCCAGCCCCTCCCCCACCCAGG + Intergenic
1132486339 16:193877-193899 CGCCGCAAGCTCCGCCTCCCGGG + Intronic
1132637597 16:960051-960073 GGCCAGCAGCTGTGACACCCCGG + Intronic
1132747654 16:1443677-1443699 GGCCTGCAGCTCCACCACCCTGG + Exonic
1132814919 16:1821124-1821146 AGACAGCAGCTCAGCCACACAGG + Intronic
1132853077 16:2033471-2033493 CGGCAGCCGCTCAGCCTCCCGGG + Intronic
1132855683 16:2043637-2043659 CGCCACCAGCTCGGCCACAGAGG + Exonic
1132899753 16:2246720-2246742 AGCCGGCAGCCCCACCACCCTGG - Intronic
1132982963 16:2748573-2748595 CACTGCCAGCTCCGCCACCCAGG - Intergenic
1133046171 16:3089545-3089567 CGCCACCAGCGCAGCCACACGGG - Exonic
1133299917 16:4776163-4776185 CTGCAGCAGGTCCTCCACCCTGG + Intergenic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1133333972 16:4994805-4994827 CGCCAGCAGCACAGGCACTCAGG + Intronic
1133462547 16:5999783-5999805 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1133474835 16:6110793-6110815 TGCCAGCAGCACTGCCTCCCTGG - Intronic
1133797728 16:9059882-9059904 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1134033606 16:11012517-11012539 CACCACAAGCTCCGCCTCCCGGG - Intronic
1134104605 16:11476849-11476871 CGTCCGCAGCGCCGCCAGCCTGG - Exonic
1134785084 16:16935078-16935100 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1135545166 16:23360868-23360890 CACCACAAGCTCCGCCTCCCGGG + Intronic
1136371866 16:29841666-29841688 GTTCAGCAGCTCCTCCACCCCGG - Exonic
1136458475 16:30395547-30395569 CGCCTCCGGCTCCGCCACCCCGG - Exonic
1137242115 16:46664595-46664617 CGCCACAACCTCCGCCTCCCAGG + Intronic
1137696973 16:50468167-50468189 CGCCAGCCCCGCCGCCAGCCTGG - Intergenic
1138382856 16:56615835-56615857 CACTAGAAGCTCCGCCTCCCGGG + Intergenic
1140110222 16:71997670-71997692 CACCACAAGCTCCGCCTCCCGGG - Intronic
1140288308 16:73625931-73625953 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1140345079 16:74205529-74205551 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1140459147 16:75124709-75124731 CGCCGCAAGCTCCGCCTCCCAGG - Intergenic
1141077565 16:81021438-81021460 GGCGAGCAGCTCCACCATCCTGG + Intronic
1141394146 16:83690095-83690117 CACCACCATCTCCGCCTCCCGGG - Intronic
1141702193 16:85647660-85647682 CACCAGAACCTCCGCCTCCCGGG + Intronic
1141704351 16:85656531-85656553 GGCCAGCAGCTCCTTCTCCCGGG - Exonic
1142040371 16:87889694-87889716 CACCACAAGCTCCGCCTCCCAGG - Intronic
1142190319 16:88714410-88714432 CGCCAGCAGCAGGGCCATCCCGG - Exonic
1142237081 16:88927443-88927465 CCCCAGCCCCTCCTCCACCCCGG - Intronic
1143427534 17:6852305-6852327 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1143464785 17:7129473-7129495 CACCTGCAGCAGCGCCACCCCGG + Intergenic
1143873497 17:9974819-9974841 CGCCAGCAGCTCCGCCACCCAGG + Intronic
1143950972 17:10631900-10631922 AGCCCGCAGCTCCTCCACCTCGG + Exonic
1145882843 17:28364680-28364702 CCCCAGCATCCCCTCCACCCAGG + Intronic
1145952498 17:28830235-28830257 CACCACAAGCTCCGCCTCCCAGG + Intronic
1147518473 17:41144503-41144525 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1147580155 17:41623507-41623529 AGCCAGCAGCCCCGCCCCCTGGG + Intronic
1147672483 17:42184575-42184597 CGCCACCAGCTCCCACGCCCAGG + Intronic
1148677928 17:49455757-49455779 TGCCAGGAGCACCGTCACCCAGG + Intronic
1148765941 17:50038216-50038238 AGCCAGCATCTCCTCCAGCCTGG + Intergenic
1148774318 17:50086974-50086996 CACCACCAGCTCTGCCTCCCAGG - Intronic
1148927995 17:51104558-51104580 CGCCATCACCTCCACCTCCCGGG - Intronic
1149755355 17:59181596-59181618 ACACAGCATCTCCGCCACCCAGG + Intronic
1150135328 17:62692252-62692274 CGCCATCAGCACCACCACCAGGG - Exonic
1150488519 17:65560086-65560108 CGCCAGCAGCGCCCCGAGCCCGG + Intronic
1151252863 17:72850995-72851017 CGCGAGCAGCTCTGCCACAATGG + Intronic
1151537898 17:74748989-74749011 CGCCAGCAGCCCCGCCTTCTCGG - Exonic
1151705533 17:75765095-75765117 GGCCAGCAGCTCCGCGACCTGGG + Exonic
1152229767 17:79108648-79108670 CGCCCCCAGCACGGCCACCCTGG + Intronic
1152280981 17:79384752-79384774 TGCCAGCAGCTCCTCCTCCACGG - Intronic
1152539206 17:80966492-80966514 CACCAGCAGCTCTGCGTCCCGGG + Intergenic
1152545694 17:80999122-80999144 TGCCACCAGCTCCGCCTGCCTGG - Exonic
1152652215 17:81499941-81499963 TGCCAACAGCCCTGCCACCCTGG + Intergenic
1152820768 17:82436670-82436692 CTCCACCAGCTGCGGCACCCCGG - Exonic
1153327825 18:3839895-3839917 CGCCATCTGCTCAGACACCCTGG + Intronic
1153962360 18:10150344-10150366 TTCCAGCAACTCCTCCACCCAGG + Intergenic
1155872133 18:31042251-31042273 CACCACCAGCTCCACCACCTGGG + Intronic
1158714272 18:59863904-59863926 CGCTACCAGCTCCGCCCCCCGGG + Intergenic
1158716895 18:59888610-59888632 AGCTAGCAGCCCCACCACCCTGG - Intergenic
1158947300 18:62458086-62458108 TGCCTGCAGCCCTGCCACCCTGG + Intergenic
1160341004 18:78088636-78088658 CGCCCACGGCTCCGCCACTCGGG - Intergenic
1160669976 19:357158-357180 CGCCGCAAGCTCCGCCTCCCGGG + Intergenic
1161014892 19:1978650-1978672 CCCCAGCAGCTCCAGCACCATGG - Exonic
1161022161 19:2015595-2015617 CGCCAACGCCGCCGCCACCCCGG - Exonic
1161285039 19:3464384-3464406 CGCCAGGTGCCCCCCCACCCCGG + Intronic
1161384246 19:3982578-3982600 GGCCAGCCCCTCCACCACCCAGG + Intronic
1161428608 19:4217808-4217830 CGCAGGCAGCTCAGCCACTCGGG - Exonic
1161483741 19:4523831-4523853 CTCCAGCAGCTCGTCCACGCAGG + Exonic
1162746611 19:12802082-12802104 CGCCAGCAGCAGCGCCCCCGGGG - Intronic
1162856064 19:13469522-13469544 GTACAGCAGCTCCGCCTCCCGGG + Intronic
1164072828 19:21784777-21784799 CACCACCATCTCCGCCTCCCAGG - Intergenic
1165153608 19:33774647-33774669 ATCCAGCAGCTCCTCCACCTGGG - Intergenic
1165722985 19:38092933-38092955 CACCACAAGCTCCGCCTCCCAGG + Intronic
1165808452 19:38596247-38596269 CGCCTCCAGCTCCGCCCCTCCGG + Intronic
1165971831 19:39638259-39638281 CCCCACCAGTTCTGCCACCCGGG - Intergenic
1166789443 19:45389869-45389891 CACCACAAGCTCCGCCTCCCGGG + Intronic
1166807213 19:45494580-45494602 CACCAGCAGCTCCACCCCGCTGG - Exonic
1166855367 19:45780567-45780589 CCCCAGCTGGTCCCCCACCCAGG - Exonic
1166979333 19:46623561-46623583 CGCCAGCAGAAGCGCCACCAGGG - Exonic
1167088575 19:47327766-47327788 CGCCGCAAGCTCCGCCTCCCAGG + Intergenic
1167212546 19:48142365-48142387 CACTTGCAGCTCCGCCTCCCAGG - Intronic
1167302603 19:48687496-48687518 CACCACCACCTCCGCCTCCCGGG + Intergenic
1167392201 19:49202964-49202986 CACTACAAGCTCCGCCACCCGGG + Intronic
1167609596 19:50500812-50500834 CGCCCCCAGCTCCTCCTCCCGGG + Intergenic
1167900318 19:52616765-52616787 CACCACCACCTCCGCCTCCCGGG - Intronic
1168124184 19:54274694-54274716 GCCCAGCATCTACGCCACCCTGG - Exonic
1168141005 19:54387086-54387108 CGCCACCACCTCCGCCTGCCGGG + Intergenic
1168590096 19:57626242-57626264 CACCACAAGCTCCGCCTCCCGGG - Intergenic
925309962 2:2875305-2875327 CCCCAGCAGCCCTGCCACCTTGG + Intergenic
925725238 2:6865496-6865518 CCCCAGCAGCGCCGCCAGGCGGG + Exonic
926371005 2:12178595-12178617 GGACAGCAGCTCCTCCACACAGG - Intergenic
926411684 2:12609720-12609742 CGCCGCAAGCTCCGCCTCCCGGG - Intergenic
926471531 2:13265537-13265559 CACCACAAGCTCCGCCTCCCGGG - Intergenic
926565444 2:14464584-14464606 CACCAGAAACTCCGCCTCCCAGG - Intergenic
927578079 2:24217006-24217028 CGCTGCCAGCTCCGCCTCCCGGG - Intronic
927640191 2:24841144-24841166 TTCCAGCAGATCCCCCACCCAGG + Intronic
927722196 2:25390970-25390992 CACCACAAGCTCCGCCTCCCGGG + Intronic
927839707 2:26432034-26432056 CACCATCTGCTCCGCCACCCAGG - Intronic
927898702 2:26803123-26803145 CACCAGAACCTCCGCCTCCCAGG + Intergenic
927903942 2:26844107-26844129 CACCACAACCTCCGCCACCCGGG + Intergenic
927981074 2:27375623-27375645 AGCCTGCAGCTCCGCCTGCCTGG + Exonic
928317378 2:30256591-30256613 CACCACAAGCTCCGCCTCCCGGG + Intronic
928979687 2:37125086-37125108 CACCACAAGCTCCGCCTCCCGGG + Intronic
929107325 2:38377480-38377502 CGCCTGCAGATCCGTCTCCCCGG + Intergenic
929156841 2:38796076-38796098 CACCAGAACCTCCGCCTCCCAGG + Intergenic
929194781 2:39173732-39173754 TGCAAGCTGCTCCGCCTCCCGGG - Intergenic
929576227 2:43054554-43054576 CGCCAGCACCAGCGACACCCTGG - Intergenic
935196299 2:100818995-100819017 AGACAGCAGCCCCGGCACCCGGG + Intergenic
935337613 2:102031729-102031751 CGCCGCAAGCTCCGCCTCCCGGG + Intergenic
935594258 2:104867342-104867364 CTTCAGCAGCTCCCCCTCCCGGG - Intergenic
936021091 2:108995544-108995566 AGGCAGCAGCTCTGCCAGCCAGG - Intergenic
937992539 2:127672621-127672643 CTCCACCCGCTCAGCCACCCAGG + Intronic
938152866 2:128901946-128901968 CGCCAGCGCCACCCCCACCCTGG + Intergenic
938594063 2:132768713-132768735 CACCACAAGCTCCGCCTCCCAGG + Intronic
939565560 2:143782665-143782687 CACCACCACCTCCGCCTCCCAGG - Intergenic
939665770 2:144949727-144949749 CACCACAAGCTCCGCCTCCCGGG + Intergenic
940003327 2:148988518-148988540 AGCCAGAAGCTCTGGCACCCTGG - Intronic
940180798 2:150930537-150930559 GCCCAGCAGATCCTCCACCCAGG - Intergenic
941506338 2:166349894-166349916 CGCCACAACCTCCGCCTCCCAGG - Intronic
941903043 2:170696018-170696040 CCACAGCAGGTCTGCCACCCAGG + Intergenic
943238726 2:185357125-185357147 CACCGGAAGCTCCGCCTCCCGGG + Intergenic
944673581 2:202016384-202016406 CACCACAAGCTCCGCCTCCCGGG - Intergenic
945680177 2:212904137-212904159 CACCACAAGCTCCGCCTCCCGGG - Intergenic
946343541 2:219088886-219088908 CACCACAAGCTCCGCCTCCCAGG + Intronic
946410849 2:219514529-219514551 TCCCAGCAGCTCCGCAGCCCTGG - Exonic
948263637 2:236622216-236622238 TGCCAGCAGCTCCTCCAGTCAGG - Intergenic
948373545 2:237505548-237505570 GGCCACCAGCCCCGCCATCCTGG + Intronic
948894053 2:240920055-240920077 GGCCAGCAGGTCCCCCAGCCGGG - Exonic
1169262608 20:4149227-4149249 CGCCGGGATCGCCGCCACCCCGG - Intronic
1169698321 20:8417160-8417182 CACCACAAGCTCCGCCTCCCAGG + Intronic
1171962819 20:31507273-31507295 CACCACAACCTCCGCCACCCAGG + Intergenic
1172997800 20:39083770-39083792 AGCCAGCAGCTGCTCCTCCCGGG - Intergenic
1173874342 20:46360618-46360640 CACCACAAGCTCCGCCTCCCAGG + Intronic
1174402529 20:50283596-50283618 CCCCTGAAGCTCAGCCACCCAGG - Intergenic
1176049206 20:63107768-63107790 CACCAGCAGCTCTGCTCCCCTGG - Intergenic
1176060173 20:63169063-63169085 AGCCAGCAGTCCCGCCACGCAGG - Intergenic
1176148018 20:63574082-63574104 CGCCCCCGGCCCCGCCACCCTGG + Intronic
1177786981 21:25681904-25681926 CACTACCAGCTCCGCCTCCCGGG - Intronic
1178309807 21:31520253-31520275 CGCCACAACCTCCGCCTCCCAGG - Intronic
1178942970 21:36922987-36923009 CACCACCAGCTCCGCGGCCCGGG + Intronic
1179444263 21:41420412-41420434 CGCTAGCACCTCCCCCAGCCTGG - Intronic
1179610479 21:42547113-42547135 CGTCAGGTGCTCCTCCACCCTGG + Exonic
1179654634 21:42837655-42837677 CGGCAGCACCTTCTCCACCCGGG + Intergenic
1179816160 21:43907639-43907661 CACCACAAGCTCCGCCTCCCGGG - Intronic
1179926545 21:44538221-44538243 CGCATGGGGCTCCGCCACCCTGG - Intronic
1180630160 22:17223559-17223581 CACCACCACCTCCGCCTCCCGGG + Intergenic
1181297706 22:21854263-21854285 CGCCACAAGCTCCGCCTCCCAGG + Intronic
1181392959 22:22597045-22597067 CGCTGCCAGCTCCGCCTCCCGGG - Intergenic
1181666229 22:24399492-24399514 CACCACAAGCTCCGCCTCCCAGG - Intronic
1182692859 22:32175973-32175995 CGCCAGCGCCTCCCCCTCCCCGG - Intergenic
1182915551 22:34026147-34026169 CGGCAGCAGCTCCGACAGCTTGG + Intergenic
1183036881 22:35147284-35147306 CGCCAGCAGCTTGGCCTCCCAGG + Intergenic
1183404410 22:37623425-37623447 TGCCAGCTGCTGCGCCGCCCTGG - Exonic
1183643494 22:39107836-39107858 CGCTAGAACCTCCGCCTCCCGGG + Intergenic
1184352772 22:43955478-43955500 GACCTGCAGCTCCGCCACCGCGG + Exonic
1184385711 22:44173377-44173399 GGCCACCATCTCCGCCACACAGG - Intronic
1185182105 22:49369548-49369570 CGCCAGCTGCTCCTCCCCCTCGG + Intergenic
1185408685 22:50671886-50671908 CCCCAGCTCCACCGCCACCCCGG - Intergenic
949316571 3:2763015-2763037 CTCCACAAGCTCCGCCTCCCGGG + Intronic
949619023 3:5789283-5789305 CACCGCCAGCTCCGCCTCCCGGG + Intergenic
950492249 3:13313063-13313085 CACCGCAAGCTCCGCCACCCAGG + Intergenic
950556017 3:13696506-13696528 CACCAGCTGCTCCTCCAACCTGG + Intergenic
951214129 3:20007690-20007712 CACCACCACCTCCGCCTCCCGGG - Intronic
952099251 3:29992521-29992543 CGCAAGCTGCTCCGCCTCCCGGG - Intronic
952880652 3:37984282-37984304 CACCAGCATCTCCACTACCCGGG - Exonic
954230392 3:49212438-49212460 CACCACAAGCTCCGCCTCCCAGG - Intronic
954290865 3:49649302-49649324 CACCAGCAACTCTGCCACCGAGG - Intronic
954967517 3:54624544-54624566 CACCAGAAGCTCCGCCTCCCGGG - Intronic
956919074 3:73907128-73907150 CACCATAAGCTCCGCCTCCCGGG - Intergenic
957263120 3:77925496-77925518 CACCACAACCTCCGCCACCCAGG - Intergenic
958194906 3:90232042-90232064 CACCGGAAGCTCCGCCTCCCGGG + Intergenic
959085205 3:101845190-101845212 CACCACAAGCTCCGCCTCCCGGG - Intronic
961353899 3:126321823-126321845 CGCCTGCAGCAGTGCCACCCCGG - Intergenic
961678993 3:128586139-128586161 GGCCAGCAGCACGGCCTCCCCGG + Intergenic
961685996 3:128631400-128631422 CGCCACAACCTCCGCCTCCCAGG - Intronic
962307610 3:134302099-134302121 CGCTACAAGCTCCGCCTCCCGGG - Intergenic
962318795 3:134374632-134374654 GGCCAGCAGCGCCGCCTCCCCGG - Intronic
962615345 3:137121093-137121115 CGCTGCCAGCTCTGCCACCCGGG + Intergenic
962719238 3:138157556-138157578 CGCCACAAGCTCCGTCTCCCAGG + Intergenic
964700166 3:159557031-159557053 CACCACAAGCTCCGCCTCCCGGG + Intronic
966841662 3:184094296-184094318 CACCACAAGCTCCGCCTCCCAGG - Intergenic
966894276 3:184430842-184430864 CACCACAAGCTCCGCCTCCCAGG - Intronic
967271646 3:187737981-187738003 CCCCAGCGGCCCCGCCTCCCTGG - Intronic
968178079 3:196568681-196568703 CGCCAGCGGCTCCGCCATGCGGG - Exonic
969295855 4:6270305-6270327 CGCCGGCCGCTCCGCCTCTCGGG - Intronic
969371830 4:6736364-6736386 CACCACCAGCTCTGCCTCCCGGG - Intergenic
969629720 4:8329173-8329195 CCCCAGCAGCTCTGCGTCCCAGG - Intergenic
972371177 4:38424736-38424758 GGCCAGCAGCCTCGCCAACCAGG + Intergenic
975266708 4:72377665-72377687 TGCCAGCAACTCTGCCACCTTGG + Intronic
981348225 4:143699857-143699879 CCCCAGCAGCTCCACCATCATGG + Exonic
983206928 4:164920268-164920290 CACTACCAGCTCCGCCTCCCAGG + Intergenic
984686512 4:182674950-182674972 CGCCACAACCTCCGCCTCCCGGG + Intronic
985723357 5:1502248-1502270 CCCAGGCAGCTCCGCCCCCCAGG + Intronic
986813225 5:11381889-11381911 CACTATCAGCTCCGCCTCCCAGG - Intronic
986894685 5:12351301-12351323 CACCACAAGCTCCGCCTCCCGGG + Intergenic
987132691 5:14872813-14872835 CGCCAGCATCCCCGCACCCCAGG + Intergenic
987296416 5:16556232-16556254 CACCACAAGCTCCGCCTCCCAGG + Intronic
987348110 5:16996838-16996860 CACTACTAGCTCCGCCACCCGGG - Intergenic
988354134 5:30151245-30151267 TTCCAGCAGCTTCCCCACCCTGG + Intergenic
988549796 5:32189985-32190007 CACCACAAGCTCCGCCTCCCGGG - Intergenic
988966495 5:36423778-36423800 CGCCAGCAGTTCTGTCACCAGGG + Intergenic
991687121 5:69191434-69191456 CACCACAAGCTCCGCCTCCCGGG - Intronic
997013474 5:129904915-129904937 CTCGCTCAGCTCCGCCACCCTGG - Exonic
997467432 5:134097647-134097669 CACCAGCAGCCCCTCCACCGTGG - Intergenic
998366944 5:141637838-141637860 CGCCCGCACCTCCTCCACGCCGG - Exonic
999796989 5:154998091-154998113 AGCCAGCACCTCTCCCACCCGGG + Intergenic
1000118417 5:158174719-158174741 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1000220443 5:159209251-159209273 CGCCGGCAGCGCCGCTCCCCAGG - Intronic
1001255416 5:170179576-170179598 CACTGCCAGCTCCGCCACCCGGG + Intergenic
1001335583 5:170793854-170793876 CGCCACAAACTCCGCCTCCCAGG - Intronic
1001601439 5:172931473-172931495 CTTCAGCAGCTCCCCCATCCAGG + Intronic
1001852756 5:174983897-174983919 CGCTACAAGCTCCGCCTCCCGGG - Intergenic
1002036157 5:176471763-176471785 CGCAACCACCTCCGCCCCCCGGG + Intronic
1002040002 5:176506113-176506135 CACCACAAGCTCCGCCTCCCAGG - Intronic
1002352071 5:178590223-178590245 CCCCAGCAGCACCGCCCCCTCGG - Exonic
1002430882 5:179203198-179203220 CCCCACCAGCTCCTCCTCCCAGG + Intronic
1002618080 5:180467766-180467788 CGTCAGCCCCTCCTCCACCCAGG - Intergenic
1003856352 6:10279992-10280014 CGCCGCAAGCTCCGCCTCCCAGG - Intergenic
1004221173 6:13747650-13747672 CACCACAAGCTCCGCCTCCCAGG - Intergenic
1004282528 6:14293166-14293188 CGGCAGCAGCACTGCTACCCAGG - Intergenic
1004997294 6:21205908-21205930 CACCACAAGCTCCGCCTCCCGGG + Intronic
1005653128 6:27903258-27903280 GGCCAGCACCTCCGCCCCGCGGG + Intergenic
1006375274 6:33668410-33668432 AGCTGGCAGCACCGCCACCCTGG - Intronic
1006706360 6:36024558-36024580 CGTCCGCAGCGCCGCCAGCCAGG - Exonic
1007469745 6:42081442-42081464 CACCGCAAGCTCCGCCACCCAGG + Exonic
1010910511 6:81549542-81549564 CACCACAAGCTCCGCCTCCCGGG - Intronic
1011133982 6:84080107-84080129 CACCACAAGCTCCGCCTCCCGGG + Intronic
1012379254 6:98600343-98600365 CGCCATCTCCTCCGCCTCCCCGG - Intergenic
1014137653 6:117907600-117907622 CGCAGGCAGCACCGCCTCCCGGG + Exonic
1014844391 6:126258011-126258033 AACCAGCAGCTCCTCGACCCTGG + Intergenic
1015220629 6:130801467-130801489 CGCCACCGCCGCCGCCACCCCGG - Intergenic
1015234412 6:130954126-130954148 CACCACAAGCTCCGCCTCCCGGG + Intronic
1015466403 6:133553090-133553112 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1017176189 6:151506913-151506935 GGCCAGCAGCCCCGAGACCCAGG - Intronic
1018068036 6:160137288-160137310 CGGGAGCAGCTCCGCTACCCAGG + Intronic
1018370413 6:163162935-163162957 CTACAGCAGCTCCACCTCCCTGG - Intronic
1019171672 6:170136480-170136502 CTCCGGGAGCCCCGCCACCCCGG + Intergenic
1019343058 7:517554-517576 CGCCAGGAGCGCCGCCGCCCCGG + Intronic
1020181474 7:5926026-5926048 GGCCACCAGCTCCGTGACCCAGG + Intronic
1020301459 7:6798863-6798885 GGCCACCAGCTCCGTGACCCAGG - Exonic
1020997934 7:15288097-15288119 CGCCGCAAGCTCCGCCTCCCGGG + Intronic
1022490078 7:30810098-30810120 CGCCACAACCTCCGCCTCCCAGG - Intronic
1022714956 7:32891299-32891321 TGCCCGGAGCTCCGCCGCCCTGG + Intronic
1023079957 7:36517364-36517386 CACCGGAAGCTCCGCCTCCCAGG + Intronic
1023864671 7:44233091-44233113 CAGCAGCACCTCCGCCAGCCTGG - Intronic
1024346096 7:48315553-48315575 CACCACAAGCTCCGCCTCCCAGG + Intronic
1025953804 7:66167144-66167166 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1026212847 7:68322295-68322317 CTCCAGGTGCTCTGCCACCCGGG - Intergenic
1026463760 7:70636268-70636290 CACCAGCAGCATCGCCACCTGGG + Intronic
1026598191 7:71752149-71752171 TGCCAGCATCTCCGCCACACGGG - Intergenic
1026736193 7:72950127-72950149 CACCAGCAGCTCCGGCATCAAGG + Exonic
1026786533 7:73305028-73305050 CACCAGCAGCTCCGGCATCAAGG + Exonic
1026819133 7:73534981-73535003 CACCGCAAGCTCCGCCACCCGGG - Intergenic
1027107536 7:75414932-75414954 CACCAGCAGCTCCGGCATCAAGG - Intergenic
1027672457 7:81118826-81118848 GGCCAGCAACGCCCCCACCCAGG + Intergenic
1028121382 7:87059566-87059588 CGGCGGCAGCTCCGGCTCCCGGG + Exonic
1029493864 7:100886859-100886881 CCCCAGCAGCTCCTCCTCCTCGG - Exonic
1029639526 7:101811009-101811031 CGCCACAACCTCCGCCTCCCGGG + Intergenic
1031526515 7:122827554-122827576 CACCAGAACCTCCGCCTCCCAGG - Intronic
1032244140 7:130193461-130193483 CGCCACAACCTCCGCCTCCCGGG - Intronic
1032705494 7:134418074-134418096 CACCAGCAGCTCCCCGACCAGGG - Intergenic
1033670550 7:143488777-143488799 CACCAGCAGCACCACCACACTGG + Intergenic
1033817104 7:145085852-145085874 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1034130360 7:148710491-148710513 CGCCACAACCTCCGCCTCCCGGG - Intronic
1034156723 7:148961645-148961667 GGCCAGCTGCTCTGCCTCCCGGG - Intergenic
1034245280 7:149639175-149639197 TGCCAGGATCTCAGCCACCCCGG + Intergenic
1034383696 7:150720600-150720622 CCCCAGCAGCTGCTCCACCTGGG - Exonic
1035255458 7:157622987-157623009 CGTCACCAGCCCCGACACCCAGG + Intronic
1035761127 8:2069655-2069677 CACCATAAGCTCCGCCTCCCGGG + Intronic
1036200379 8:6766073-6766095 CACCTCAAGCTCCGCCACCCGGG + Intergenic
1036451003 8:8867631-8867653 CACCAAAAGCTCCGCCTCCCGGG + Intronic
1037404686 8:18529081-18529103 AGCAAGCAGCTCTGCCACCTTGG + Exonic
1038253122 8:25925074-25925096 CCCCAGCAGCTCTGTGACCCTGG + Intronic
1038816161 8:30906512-30906534 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1039063741 8:33592162-33592184 CGTGAGCCGATCCGCCACCCTGG - Exonic
1039263901 8:35803787-35803809 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1039561100 8:38513261-38513283 CACTGGCAGCTCCGCCTCCCGGG + Intronic
1040927323 8:52698396-52698418 CACCGGAAGCTCCGCCTCCCAGG + Intronic
1040973406 8:53162714-53162736 CACCACAACCTCCGCCACCCGGG - Intergenic
1042282940 8:67074854-67074876 CGCCACAACCTCCGCCTCCCAGG + Intronic
1042317291 8:67437317-67437339 CGCTACAAGCTCCGCCTCCCGGG - Intronic
1042566690 8:70118482-70118504 AGCCAGCACCTCTGCCACTCGGG + Intronic
1042854533 8:73253065-73253087 CGCTGGGAGCTCCGCCTCCCGGG - Intronic
1043471006 8:80562480-80562502 CGCCACAACCTCCGCCTCCCAGG + Intergenic
1044108151 8:88237571-88237593 CACCGCCAGCTCCGCCTCCCGGG - Intronic
1044263185 8:90151881-90151903 CACCACAAGCTCCGCCTCCCGGG - Intergenic
1045826335 8:106402894-106402916 CACCACAAGCTCCGCCTCCCAGG + Intronic
1045987121 8:108261658-108261680 TGCCAGCAGGAGCGCCACCCTGG + Intronic
1046412440 8:113864005-113864027 CACCAGAACCTCCGCCTCCCAGG + Intergenic
1047998594 8:130358686-130358708 CGCCCCCAGCCCCGCCCCCCCGG + Intronic
1048882047 8:138878930-138878952 CACCACAAGCTCCGCCTCCCGGG - Intronic
1048898499 8:139016139-139016161 CTCCAGCAGCTTGGCCATCCTGG + Intergenic
1049536079 8:143183149-143183171 CGCCCCCAGCTCCGGCTCCCCGG + Intergenic
1049643793 8:143727244-143727266 CTCCAGCAGCTCCGCCACCTTGG + Exonic
1049645330 8:143733508-143733530 TCCGAGCAGCCCCGCCACCCCGG + Intronic
1050639703 9:7654419-7654441 CGCCAGCAGCCCCCCGCCCCAGG + Intergenic
1050665711 9:7934703-7934725 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1051894226 9:21971167-21971189 CAGCAGCAGCTCCGCCACTCGGG + Exonic
1051897764 9:22006206-22006228 CAGCAGCAGCTCCGCCACGCGGG + Exonic
1053219776 9:36302349-36302371 CGCCACAACCTCCGCCTCCCGGG - Intronic
1053480817 9:38415013-38415035 GGACAGCAACTCAGCCACCCTGG + Intronic
1055934910 9:81595741-81595763 CACCACAAGCTCCGCCTCCCAGG - Intronic
1056166215 9:83943262-83943284 CACCAGAACCTCCGCCTCCCAGG - Intronic
1057260170 9:93578431-93578453 GGCCAGCAGCTCAGCATCCCTGG - Intronic
1057520058 9:95752762-95752784 CGCCAGCAAGTCCCTCACCCAGG + Intergenic
1057822439 9:98342813-98342835 CTCCAGCACTTCCCCCACCCAGG + Intronic
1058546853 9:106069684-106069706 CCCCAGCACCGCCGCCACCACGG - Intergenic
1058598664 9:106645227-106645249 CGCTACAAGCTCCGCCTCCCGGG + Intergenic
1059427153 9:114228274-114228296 CGCCAGCAGCTCAGAAACACAGG - Intronic
1060192017 9:121599456-121599478 CGCCCACAGCTCCGCCCGCCAGG - Intronic
1060358343 9:122931472-122931494 CGCCAGGAGCTCCGGCCCCTCGG + Exonic
1060549031 9:124476561-124476583 CGCCAGCAGCTCCCCCTCCCTGG - Intronic
1060816595 9:126638431-126638453 TGCCCGCAGCCCTGCCACCCTGG + Intronic
1060997714 9:127884559-127884581 CCCCAGCAGCTCGGGGACCCTGG + Intergenic
1061198095 9:129119479-129119501 CACCACAAGCTCCGCCTCCCAGG + Intronic
1061879223 9:133560401-133560423 CGGCAGCAGCTCCACAGCCCGGG - Intronic
1061970392 9:134041763-134041785 CTCCTGCAGCTCCGCCAGCCTGG + Exonic
1061987181 9:134136426-134136448 CGCCCCCACCTCCGCCTCCCCGG + Intronic
1062186335 9:135220555-135220577 CACCTCCAGCTCCGCCCCCCAGG - Intergenic
1062474720 9:136721294-136721316 GGCCAGGAGCTGCCCCACCCAGG - Intronic
1062517077 9:136942146-136942168 GGCCAGCAGCTCGGCCACCTTGG + Exonic
1062555770 9:137112843-137112865 CTCCACCAGCTCCGCCTCCCTGG + Intronic
1203441272 Un_GL000219v1:10837-10859 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1203512081 Un_KI270741v1:129745-129767 CACCACAAGCTCCGCCTCCCAGG + Intergenic
1185621477 X:1453388-1453410 CGCCCCCAGCTCCGCCTCCCGGG + Intronic
1186075146 X:5870359-5870381 GGCTAGCAGCTCCCACACCCAGG + Intronic
1187507253 X:19887728-19887750 CTCCTGCAGCTCCGCCTGCCGGG + Intergenic
1188395517 X:29678428-29678450 CACCACAAGCTCCGCCTCCCGGG + Intronic
1189717720 X:43882534-43882556 CGCCCGCAGCTCTGCAGCCCAGG + Intergenic
1189736895 X:44080644-44080666 CACCACAAGCTCCGCCTCCCGGG + Intergenic
1190002900 X:46706814-46706836 CACCACCACCTCCGCCTCCCAGG + Intronic
1193710488 X:84873271-84873293 GGCAAGCAGCTGTGCCACCCTGG + Intergenic
1193897020 X:87127169-87127191 AGCTACCAGCTCAGCCACCCTGG + Intergenic
1197612247 X:128652855-128652877 CACCATAAGCTCCGCCTCCCGGG + Intergenic
1198910201 X:141605376-141605398 CACCACAAGCTCCGCCTCCCAGG + Intronic
1199980676 X:152918768-152918790 ACCCAGCAGCTCCCCAACCCTGG - Intronic
1200211612 X:154349155-154349177 TGCCAGCACCTCCCCAACCCAGG + Intronic
1201948567 Y:19538630-19538652 CCCCAGAAGCTCCGCCTCCTGGG - Intergenic