ID: 1143873501

View in Genome Browser
Species Human (GRCh38)
Location 17:9974833-9974855
Sequence GGGTGGGGGTGAGCCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 2, 2: 9, 3: 114, 4: 881}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143873501_1143873512 15 Left 1143873501 17:9974833-9974855 CCACCCAGGGCTCACCCCCACCC 0: 1
1: 2
2: 9
3: 114
4: 881
Right 1143873512 17:9974871-9974893 TATCTCAGTACCGATCCCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1143873501_1143873513 16 Left 1143873501 17:9974833-9974855 CCACCCAGGGCTCACCCCCACCC 0: 1
1: 2
2: 9
3: 114
4: 881
Right 1143873513 17:9974872-9974894 ATCTCAGTACCGATCCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143873501 Original CRISPR GGGTGGGGGTGAGCCCTGGG TGG (reversed) Intronic
900018090 1:168578-168600 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
900048348 1:527174-527196 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
900070573 1:769026-769048 GGGTGGGGGTGGGGCTGGGGAGG - Intergenic
900092744 1:927517-927539 GGGTGTGGGACAGGCCTGGGAGG - Intronic
900195821 1:1375027-1375049 GCGCGGGGGTGAACCCGGGGAGG - Exonic
900211263 1:1456928-1456950 GAGTGGGGGTGAAGCCTGCGGGG + Intronic
900224171 1:1524976-1524998 GGGTGGGGGTGAAGCCTGTGGGG + Intronic
900244105 1:1629825-1629847 GGCCGGGTGTGAGCCTTGGGAGG - Intronic
900310659 1:2031803-2031825 GGGTGGCCGCTAGCCCTGGGTGG + Intergenic
900363006 1:2298975-2298997 TGGTGCCTGTGAGCCCTGGGTGG + Intronic
900387327 1:2416585-2416607 GAGGGGAAGTGAGCCCTGGGTGG + Intergenic
900411494 1:2514652-2514674 GGGTGGGGGCTAGCTATGGGGGG + Intronic
900420574 1:2554331-2554353 GGGGGGCGCTGAGCGCTGGGTGG + Intergenic
900813522 1:4826108-4826130 GGGTGGGGGTGGGGCCTGTGTGG - Intergenic
900822406 1:4899679-4899701 GGTAGGGGGTGATACCTGGGAGG - Intergenic
901251448 1:7783522-7783544 GTGTGGGGAGGAGCCCAGGGTGG - Intergenic
901511622 1:9720669-9720691 GGGTGGGGGTGTGGGGTGGGGGG + Intronic
901637809 1:10678442-10678464 GAGTGGGGCAGAGCCCAGGGAGG + Intronic
901927785 1:12577985-12578007 GGCTGGGGGTGTAACCTGGGAGG - Intronic
902286513 1:15411224-15411246 GGGTGGGTGTGGGACATGGGGGG - Intronic
902306317 1:15542395-15542417 GGAGGGTGGTGAGCCCTGGGAGG + Intronic
902331466 1:15733020-15733042 GGGAAGGGGTGGGCCCTGGGAGG + Intronic
902331990 1:15735267-15735289 GGGAAGGGGTGGGCCCTGGGAGG + Intergenic
902374270 1:16022971-16022993 AGGTGAGGGAGAGGCCTGGGTGG - Intronic
902379224 1:16044848-16044870 AGGTGAGGGAGAGGCCTGGGTGG - Intronic
902382808 1:16060521-16060543 TGCTGGAGGTGAGACCTGGGTGG + Intronic
902392726 1:16115751-16115773 GTGAGGAGGAGAGCCCTGGGGGG - Intergenic
902925591 1:19693875-19693897 GGCTGTTGGGGAGCCCTGGGTGG + Intronic
902929540 1:19721158-19721180 GAGTGAGGGGGAGGCCTGGGAGG + Intronic
902990746 1:20185816-20185838 GGGAGAGGGAGAGCCCTGGCCGG - Intergenic
903016192 1:20363688-20363710 GGGTGGGGGTGAGTGTTTGGAGG - Intergenic
903021928 1:20400721-20400743 GGGGGGTGGTGAGCCCAGAGAGG + Intergenic
903285405 1:22273691-22273713 GGGTGGTGCTGAGGCCTGAGGGG + Intergenic
903464686 1:23543915-23543937 GCGTGGGGGAGAGCAGTGGGCGG - Intergenic
903653725 1:24936156-24936178 GGGTGGGGTTCAGCTCTGGCGGG + Intronic
903661551 1:24981736-24981758 GGGTGGGGGTGAGACGTAAGGGG - Intergenic
903847701 1:26288292-26288314 GGGATGGGGTGAGACCAGGGAGG + Intronic
904237803 1:29125336-29125358 GGGTGGGAGGGAGAGCTGGGAGG - Intergenic
904831186 1:33307610-33307632 AGGTGGGGGTGAGGGTTGGGAGG - Intronic
904831196 1:33307637-33307659 GGGTGGGGGTGAGGATTGGGTGG - Intronic
904831307 1:33307919-33307941 AGGTGGGGGTGAGGGTTGGGTGG - Intronic
904910601 1:33931490-33931512 GGGTGGGGGGAAGCCCTAGGGGG + Intronic
904988734 1:34574032-34574054 GGAAGGGGGTGCACCCTGGGAGG + Intergenic
905404705 1:37724987-37725009 GGGTGGGGTTCAGCCATAGGTGG + Intronic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
906199017 1:43947471-43947493 GGGTGAGGGGGGGCCCAGGGCGG - Exonic
906244266 1:44262178-44262200 GGGTGGGGCTGGGCCCAGTGGGG - Intronic
906476002 1:46169948-46169970 GGGTGGGGTTGTGCCTAGGGGGG - Intronic
907053207 1:51343743-51343765 GGGTGGTGGAGAGCCATGGAAGG + Intronic
907239632 1:53074346-53074368 GAGTGGGGATGACCCCTGAGAGG - Intronic
907320664 1:53600137-53600159 GCTTGGGGGTGAGCCCGGGGCGG + Exonic
907668145 1:56451066-56451088 GTGTGGGCCTGAGCCCTGGCAGG + Intergenic
908558060 1:65277654-65277676 GGGAGGGGGTGAGCCAGTGGGGG + Intronic
908951939 1:69570422-69570444 GGGTGGGGGTGAAGGGTGGGCGG - Intronic
909266861 1:73570801-73570823 GTGTGAGAGTGAGCCCTGGGAGG - Intergenic
910083130 1:83365638-83365660 GGGTGGGGGTGAGGGTGGGGAGG + Intergenic
912566614 1:110592151-110592173 TGGTTGGGGTGAGCCCAGGGTGG + Intergenic
912687236 1:111777156-111777178 AGGTGGTAGTGAGGCCTGGGTGG + Exonic
912818862 1:112850974-112850996 GTGAGGGGGTGAGTCCTGGAAGG - Intergenic
912831555 1:112957495-112957517 GTGAGGGGGTGAGTCCTGGAAGG - Intergenic
914923129 1:151860806-151860828 GGCTGGGGGAGATCCTTGGGAGG - Intergenic
915087362 1:153397717-153397739 TGGTGGGGGTGGGCCCTGAGGGG - Intergenic
915972928 1:160366891-160366913 GGGCGGGGGCTGGCCCTGGGTGG - Intergenic
916863628 1:168833032-168833054 GGGTGGGGTGCAGCCATGGGTGG - Intergenic
917122033 1:171652769-171652791 GGGTGGGGCTGTGCACAGGGGGG + Intergenic
918015760 1:180631415-180631437 GGTTGGGGGTGAGGGTTGGGAGG - Intergenic
918562161 1:185881511-185881533 GGGTAGGGTGGAGCCATGGGTGG + Intronic
919754515 1:201058515-201058537 GCGAGGGGGTGAGCTTTGGGAGG + Intronic
919819168 1:201462110-201462132 GGGTGGGGGTGAGGCCACGCTGG + Intergenic
919820831 1:201470863-201470885 TGGTGGGGAGGAGCCATGGGAGG - Intergenic
919847858 1:201652679-201652701 GGGTAAGGATGAGCCATGGGAGG - Intronic
920177632 1:204113022-204113044 GGCAGTGGCTGAGCCCTGGGGGG - Exonic
920252373 1:204630312-204630334 GGGGGTGGGTGAGGCCTGGTCGG + Intronic
920306839 1:205023878-205023900 GGGTTGGAGTGAGCACTGAGAGG + Intergenic
920607063 1:207399062-207399084 GGTTGGGGGTGGGGGCTGGGAGG + Intergenic
921201882 1:212814862-212814884 AGGTGGGGATGAGGGCTGGGAGG - Intronic
921536028 1:216350204-216350226 GGGTGGAGGTGATACCTGGTGGG - Intronic
922105933 1:222514442-222514464 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
922266272 1:223987053-223987075 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
922603968 1:226877528-226877550 GGGTGGGGGTGACAGGTGGGAGG - Intronic
922717888 1:227886567-227886589 AGGTGGGGGAGAGGCCTGGGGGG - Intergenic
922741287 1:228015695-228015717 GGGTGGGGGGGAGGCGGGGGTGG - Intronic
922750105 1:228066243-228066265 GGGAGGGGGTGGGGCCTGTGGGG - Intergenic
923169904 1:231405971-231405993 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
923545470 1:234920249-234920271 GGGTGGTGGTGAGCCCAGCCTGG - Intergenic
924348118 1:243092009-243092031 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
1063077760 10:2733388-2733410 GGATGGGGGGCAGCCCTGGAGGG + Intergenic
1063368705 10:5507385-5507407 GGGTGGGGCTGCGTCCTGGGAGG + Intergenic
1063662671 10:8044885-8044907 GGGAGAGGGAGAGCCCTGGAGGG + Intergenic
1063979922 10:11444766-11444788 AGGTGGGGGTGAGTGGTGGGGGG - Intergenic
1064712388 10:18140618-18140640 GGCCGGGCCTGAGCCCTGGGCGG + Intergenic
1065741626 10:28802316-28802338 TGGTGGGGGGCACCCCTGGGAGG - Intergenic
1066253072 10:33652944-33652966 TGTTGGGGGTGAGGCCTGGTAGG - Intergenic
1066439902 10:35428470-35428492 TGATGAGGGTGAGCCCTGAGAGG + Intronic
1066728241 10:38412892-38412914 GGGTGGGGGTGGGGCTAGGGAGG + Intergenic
1067090978 10:43265817-43265839 GGGGGCGGGAGAACCCTGGGGGG + Intronic
1067295686 10:44974121-44974143 GGGTGGCAGTGAGACCTGGAGGG - Intronic
1067722934 10:48743341-48743363 GGGTGGGAGTGAGCCGCTGGAGG - Exonic
1067803603 10:49377429-49377451 ACGTGGGTGTGAGTCCTGGGAGG - Intronic
1068372254 10:56131949-56131971 GGGTGGGGGTGAGGGGAGGGAGG + Intergenic
1068904454 10:62307493-62307515 GGGGTGGGGTGAGCCATGGGTGG + Intergenic
1069884728 10:71616389-71616411 AGGTGTGGGTTAGCCATGGGAGG + Intronic
1070669996 10:78371068-78371090 CTGTGGGGGTGAGCTTTGGGTGG + Intergenic
1070708376 10:78657953-78657975 GGGTGGGGGTGGGGGGTGGGGGG + Intergenic
1070952749 10:80444151-80444173 GGGTGGGGCAGAGCCCTGGTGGG + Intergenic
1071499581 10:86193819-86193841 GGGAGGTGGTGAGGGCTGGGTGG - Intronic
1071553499 10:86585224-86585246 GGGGTGGGGTGTGCCCAGGGAGG - Intergenic
1071618292 10:87095277-87095299 GGGTTGGGGGTAGCCCAGGGAGG + Intronic
1072189826 10:93070227-93070249 GGGTGGAGGAGAGCACTGGCTGG - Intergenic
1073432300 10:103494334-103494356 GGGTGGGGGCGAGGCCGGGCAGG - Exonic
1073445636 10:103578771-103578793 GGGTGGAGGTGGGTGCTGGGAGG + Intronic
1074058314 10:109942565-109942587 GGGTGGGCATGGGCCTTGGGAGG - Intronic
1074364192 10:112845118-112845140 GAGTTGGTGTGAGGCCTGGGAGG + Intergenic
1074546362 10:114404615-114404637 CGCTGGGGGCGAGCCCTGGCGGG - Intronic
1074687229 10:115972149-115972171 GGCTGTGGGTGAGCCGTGGGAGG + Intergenic
1075404325 10:122184308-122184330 GGGTGGGGGGGTGCCCTGGTGGG + Intronic
1075631563 10:124003787-124003809 GGAAGAGGGTGAGCCCTGAGTGG - Intergenic
1076191344 10:128485641-128485663 TGGTGGAGGTGGGCCCTGTGGGG - Intergenic
1076584639 10:131537252-131537274 GGCTGGGGGTGGGGGCTGGGTGG - Intergenic
1076595642 10:131623173-131623195 AGGTGGGGGAGAGAGCTGGGGGG + Intergenic
1076612271 10:131733762-131733784 GGCTGGGGGTGACCTCTGGAGGG + Intergenic
1076673158 10:132134081-132134103 GGGTGGAGCTCAGCCCGGGGTGG - Intronic
1076750431 10:132539454-132539476 GGGTGGGAATGAGGCTTGGGTGG - Intronic
1076821773 10:132943230-132943252 GGGAGGTGGGGAGCCCCGGGGGG - Intergenic
1076868152 10:133179445-133179467 GGGTCCAGGTCAGCCCTGGGAGG - Intronic
1076974692 11:163774-163796 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
1077026191 11:441101-441123 GGGCCGAGGAGAGCCCTGGGCGG + Intronic
1077080541 11:722868-722890 GGGTGGGTGTCAGGGCTGGGGGG - Intronic
1077080558 11:722905-722927 GGGTGGGTGTCAGGGCTGGGGGG - Intronic
1077090519 11:776501-776523 GAGTGGGGTTCAGTCCTGGGGGG - Intronic
1077160422 11:1110059-1110081 GGGTGGTGGAGACCCCAGGGAGG + Intergenic
1077187823 11:1243354-1243376 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188245 11:1245025-1245047 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077188778 11:1247125-1247147 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077189199 11:1248796-1248818 CGGTGGTGGTCAGCACTGGGGGG - Exonic
1077211769 11:1374453-1374475 AGTTGGGGGTGAGGCCTGGTGGG + Intergenic
1077328513 11:1973877-1973899 TGGTGGGGGGCAGCCCGGGGGGG + Intronic
1077334659 11:1997944-1997966 GGGCGGAGGTGGGCCCTGCGGGG - Intergenic
1077406279 11:2383834-2383856 GGGTGGGGGTAAGGTATGGGTGG + Intronic
1077408440 11:2392812-2392834 GGGTGGGGCTGGGGCCTGGCAGG + Intronic
1077534108 11:3111137-3111159 GGGTGGGGGTGGGGCACGGGGGG - Intronic
1078413455 11:11146769-11146791 GGGAGGTGGTGAGCCCAGTGGGG + Intergenic
1078550914 11:12280144-12280166 GGGTGGGGGTGAGGGGTGGGTGG - Intronic
1078922764 11:15845635-15845657 GCCTGGGGGTGAGGGCTGGGGGG + Intergenic
1079320570 11:19448205-19448227 AGGTGGGGGCCAGCCCTGGGAGG + Intronic
1079320747 11:19449548-19449570 AGGTGGGGGCCAGCCCTGGGAGG - Intronic
1080460267 11:32448591-32448613 GGGTGGGGGTGAGTGCGAGGGGG + Intergenic
1080610526 11:33900202-33900224 GGGTTGGAGGGAGCCATGGGTGG - Intergenic
1080628280 11:34051352-34051374 GGGTGGGGGTGGGGGTTGGGGGG - Intergenic
1081369107 11:42276824-42276846 TGTTGGAGGTGAGCCCTGGTGGG - Intergenic
1081674185 11:44958749-44958771 GGGTGGGGCTGAGCAGGGGGAGG + Intergenic
1081675716 11:44967870-44967892 GGGTGGAGATGGGCCCTGGGAGG + Intergenic
1081804971 11:45885576-45885598 GGGTGGGGGCGGGGCCTGGGCGG + Intergenic
1081925976 11:46828853-46828875 GGGTGGGGGTGTGGCTTGGGAGG + Intronic
1081993382 11:47349469-47349491 GGGTGGGGGGTCGCCCAGGGTGG - Intronic
1082005720 11:47418018-47418040 GGGTGGGTGTGGTCCCTGTGGGG + Intergenic
1082795613 11:57376339-57376361 GGGTGGGGGTGGGAGATGGGGGG - Intergenic
1082808424 11:57464129-57464151 TGGGGGAGGTGAGCCCTGGTTGG + Intronic
1083224042 11:61273522-61273544 GGCTGGGTGTGAGCCCAGGAGGG + Intronic
1083340815 11:61957319-61957341 AGGTGGGGGCGAGCCCAGGGTGG + Intronic
1083595044 11:63915153-63915175 GAGTGGGGCACAGCCCTGGGAGG - Intronic
1083619025 11:64039875-64039897 GGGTGGGGGAGAGGACAGGGAGG + Intronic
1083629239 11:64087323-64087345 GGGTTGGGGTGAGGTCTGGGTGG - Intronic
1083685414 11:64372102-64372124 GGCTGGGGGTGGGGCCTTGGGGG + Exonic
1083720072 11:64599629-64599651 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
1083764815 11:64836690-64836712 AGGTGGGACTCAGCCCTGGGGGG + Intronic
1083887718 11:65580986-65581008 GGGAGGGGGTCAGGCCTGTGGGG + Intronic
1084063362 11:66689786-66689808 GGAGGTGGGTGAGGCCTGGGTGG - Exonic
1084274667 11:68045155-68045177 GGGTGGGTGTGAGCCTGAGGGGG + Intronic
1084315725 11:68344106-68344128 GGGTAGGGGTGGAGCCTGGGTGG + Intronic
1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG + Exonic
1085313677 11:75530871-75530893 GGGTGGAGGGGAGCCATGGGAGG + Intergenic
1085517395 11:77119440-77119462 GGTTGGGGCCGGGCCCTGGGAGG + Intronic
1085790289 11:79491948-79491970 GGGTGGGGCAGAAGCCTGGGGGG - Intergenic
1086366883 11:86116172-86116194 AGGTAGAGGTGAGCCGTGGGAGG - Intergenic
1086431780 11:86743168-86743190 GGGTGGGGTTGTGACCTGGATGG + Intergenic
1087732700 11:101796853-101796875 GGGTGGAGGTGGGGCCTGGTGGG + Intronic
1088598738 11:111457735-111457757 GGGTGGAAGTGAGCTGTGGGAGG - Intronic
1089144028 11:116311303-116311325 TGGAGGGGGTGTGGCCTGGGGGG - Intergenic
1089195538 11:116692262-116692284 GAGTGGGGGAGAGCCTTGGAGGG - Intergenic
1089201142 11:116725467-116725489 GGGTGGGGGTGAGGGTGGGGAGG + Intergenic
1089294297 11:117458694-117458716 GGCTGGGGGTTAGCAGTGGGTGG + Intronic
1089301405 11:117501327-117501349 GGGTGGAAGTGGGCACTGGGTGG - Intronic
1089519834 11:119056531-119056553 GGAGGTGGTTGAGCCCTGGGCGG - Intronic
1089865494 11:121627796-121627818 GCGTGGGGGTCAGCCCTGGGAGG - Intronic
1090972384 11:131654580-131654602 GGTTGGAGGTGAGGCCTGGTGGG + Intronic
1090977291 11:131688711-131688733 GGGTGGGGGTGATGCGTGTGTGG + Intronic
1202811491 11_KI270721v1_random:29056-29078 TGGTGGGGGGCAGCCCGGGGGGG + Intergenic
1202817642 11_KI270721v1_random:53126-53148 GGGCGGAGGTGGGCCCTGCGGGG - Intergenic
1092214574 12:6672238-6672260 GGGCGGGGGAGAGACCTGGCTGG - Intronic
1092217891 12:6695344-6695366 GGGTGGGGGTGCCCTCTGGATGG - Intronic
1092256260 12:6928120-6928142 GGGAGGCGGCGAGCCCGGGGAGG + Intronic
1092409524 12:8243036-8243058 GGGAGGGGGCGGGGCCTGGGGGG + Intergenic
1092575865 12:9782072-9782094 GGGGGGGGGTGGGCACTGGTGGG + Intergenic
1093703172 12:22245924-22245946 GGGGGGTGGTGTGCCCAGGGAGG + Intronic
1094317525 12:29149543-29149565 GGGTGGGTGTGAGGCCGGGTGGG + Intronic
1094840088 12:34339218-34339240 GGGAGCGGCTGAGCCCTAGGGGG + Intergenic
1095825839 12:46530490-46530512 AGGTGGAGGTGGGCCCGGGGCGG + Intergenic
1096197604 12:49658662-49658684 GGGTGGGGGTGGGCTCACGGGGG - Intronic
1096226071 12:49867656-49867678 GGGTGGGGCTGGGCCCAGGAAGG - Exonic
1096465460 12:51845997-51846019 GGGTGGTGGAGACCCCTGGGTGG - Intergenic
1096678920 12:53242059-53242081 GGGTGGGGGACAGCCATGGCAGG - Intergenic
1097188425 12:57208215-57208237 GGGTGGGCAAGGGCCCTGGGGGG + Exonic
1097223538 12:57463838-57463860 GGGTGGGGGTGGGCCCAAGTGGG - Intronic
1097779006 12:63682051-63682073 GGGGCGGGGTGAGGCGTGGGAGG + Intergenic
1098547559 12:71728310-71728332 TGTTGGGGGTGGGGCCTGGGGGG - Intergenic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1099511341 12:83542539-83542561 GGGTGGGGGTGGGGCAGGGGGGG + Intergenic
1099684434 12:85866610-85866632 GGGTGGGGCTGAGGCCAAGGTGG - Intergenic
1100221207 12:92506214-92506236 GGGTAGGGGTGAGGGATGGGAGG + Intergenic
1101436355 12:104668071-104668093 GTGTGGGGGTAAGCCAGGGGTGG - Intronic
1101948260 12:109154613-109154635 GTGTGGGGGCGGGGCCTGGGTGG + Intronic
1101953386 12:109193610-109193632 GGGTTGTGGTCAGCCTTGGGAGG - Intronic
1101967816 12:109293024-109293046 GCGTGGAGGTGAGCCCTGCCTGG - Intronic
1102113228 12:110381034-110381056 GGATGGGGGCGAGCGGTGGGAGG + Intronic
1102225835 12:111227711-111227733 GGGTGGGGGTGTGCCCTCTAGGG - Intronic
1102244175 12:111344623-111344645 AGGTGGGGGAGAGCTCTGGAAGG + Intronic
1102590096 12:113950424-113950446 GGATGGGGGTGAGGCTTGGAGGG - Intronic
1102961839 12:117098547-117098569 CGGAGGCGGGGAGCCCTGGGAGG - Intronic
1103526910 12:121575251-121575273 GGTTGGGGGAGAGGTCTGGGAGG - Intronic
1103739899 12:123084061-123084083 GGGTTGGGGTGACCCCGGGAAGG + Intronic
1103847564 12:123911595-123911617 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847601 12:123911672-123911694 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847630 12:123911733-123911755 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847650 12:123911778-123911800 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847665 12:123911809-123911831 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847744 12:123911988-123912010 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847780 12:123912064-123912086 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847795 12:123912095-123912117 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103847965 12:123912475-123912497 GGGGGGGGGTCTGTCCTGGGGGG + Intronic
1103920363 12:124396175-124396197 GGCTGGGGCGGGGCCCTGGGAGG + Intronic
1103965013 12:124633079-124633101 GGGTGTGTATGAGCTCTGGGGGG - Intergenic
1103979445 12:124726943-124726965 GGGTGGGGGTGGGTTCTGGTGGG - Intergenic
1104276188 12:127330054-127330076 GGATGGGGGTGAGGTATGGGAGG + Intergenic
1104810973 12:131620291-131620313 GGGTGAGGGTGACGCCCGGGCGG - Intergenic
1105069743 12:133227322-133227344 GGATGGGGATCAGCCCAGGGAGG - Intronic
1105211458 13:18259451-18259473 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1105557326 13:21459345-21459367 GGGTGGGGGCGGGGCCTGGCTGG - Exonic
1105608581 13:21947693-21947715 GGGTGGTGCTGGGCACTGGGTGG + Intergenic
1107875104 13:44783341-44783363 GGGTTGGGGTGGGCCATGGGTGG + Intergenic
1108408758 13:50127653-50127675 GGGTGGGGGCGGTCCCTGGAGGG + Intronic
1108534038 13:51354857-51354879 AGGTGGGGAAGAGCCCTGTGTGG + Intronic
1108573029 13:51769042-51769064 GGGTGGGACTGTCCCCTGGGGGG - Intronic
1110654813 13:77985451-77985473 GGCTGGAGGTGAGAGCTGGGTGG - Intergenic
1110938277 13:81319089-81319111 GGGTGGGGCAGAGACATGGGTGG - Intergenic
1112937185 13:104815696-104815718 GTGTGTGAGTGTGCCCTGGGAGG + Intergenic
1113733175 13:112657215-112657237 GTGTGGGTGTGAGCCCTGAGTGG - Intronic
1114055981 14:18967308-18967330 GGGTGTGGGTTTTCCCTGGGTGG + Intergenic
1114106568 14:19434445-19434467 GGGTGTGGGTTTTCCCTGGGTGG - Intergenic
1114383578 14:22233678-22233700 TGGTGGAGGTGGGGCCTGGGGGG - Intergenic
1117552164 14:56847400-56847422 GGGGGTTGGTGAACCCTGGGAGG + Intergenic
1118087209 14:62431561-62431583 AGGTTGTGGTGAGACCTGGGAGG + Intergenic
1118163934 14:63317645-63317667 GGGTCGCTGTGAGACCTGGGAGG - Exonic
1118454067 14:65929426-65929448 GGGAGGCTGAGAGCCCTGGGGGG + Intergenic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1118726834 14:68634683-68634705 GGGTGGGGGTGAGACGGAGGTGG + Intronic
1118821146 14:69346982-69347004 GGGTGTAGGTAAGCCTTGGGGGG + Intronic
1119130194 14:72164989-72165011 GGGTGGAGGTGAGACCAGGAAGG + Intronic
1119264502 14:73256023-73256045 GGGTGGTGGTGAGGCCTTGTGGG + Intronic
1119642949 14:76328554-76328576 AGGTGGGTGTGAGCCCTGGGAGG - Intronic
1120684523 14:87522835-87522857 GGTTGGGGGTGGGGCCTGGTGGG - Intergenic
1120915469 14:89706426-89706448 GGTTGGAGGTGAGACCTGGTGGG - Intergenic
1121053790 14:90836822-90836844 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121053806 14:90836867-90836889 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121336713 14:93082141-93082163 GGGTGGGGGGCAGCCCTTGCAGG + Intronic
1121449241 14:93996934-93996956 GGGTGGGGCTGAGCCTTGGGGGG + Intergenic
1121886393 14:97546728-97546750 CGGTGGGGGTGAGCCGTGAAAGG + Intergenic
1122145066 14:99684150-99684172 GGTTGGGGCGGAGCTCTGGGGGG + Intergenic
1122272041 14:100572615-100572637 GGGCAGAGATGAGCCCTGGGGGG + Intronic
1122272203 14:100573314-100573336 AGGGGCGGGTGAGTCCTGGGAGG + Intronic
1122324273 14:100873376-100873398 GGGTTGGTGTGACCCATGGGTGG - Intergenic
1122359624 14:101151658-101151680 GGGAGGGAGTGGGCACTGGGAGG - Intergenic
1122414440 14:101542121-101542143 GGGTGATGGGGAGCCATGGGAGG - Intergenic
1122499935 14:102190641-102190663 GGATGGGGCTGAACCCTGGAGGG + Intronic
1122630177 14:103104088-103104110 TGGAGGGGGCGGGCCCTGGGGGG + Intronic
1122641648 14:103163564-103163586 GGGTGGGGGTGGGCCATGGGTGG - Intergenic
1122643296 14:103175168-103175190 GTGTGGGGGCGGGCCATGGGTGG - Intergenic
1122664487 14:103319199-103319221 GGGCGGGGTGGAGCCCTGGAAGG - Intergenic
1122768137 14:104085485-104085507 GGGTGGGGGCGGGGCCTGGCGGG - Intergenic
1122770845 14:104097045-104097067 TGGTGGGGGTGAGGGGTGGGTGG - Intronic
1122807065 14:104265030-104265052 GGGTGGGGGTGCTTCCTGGAGGG + Intergenic
1122917335 14:104865214-104865236 GGGCGGGGGCGTGCCCGGGGCGG + Intergenic
1123025001 14:105420207-105420229 GGGTTGGGGTGAGCACGGCGGGG - Intronic
1123403639 15:20008258-20008280 TGGTGGGGGTGATGTCTGGGGGG + Intergenic
1123499380 15:20866441-20866463 GGGTGTGGGTTTTCCCTGGGTGG - Intergenic
1123512975 15:21014903-21014925 TGGTGGGGGTGATGTCTGGGGGG + Intergenic
1123556632 15:21440171-21440193 GGGTGTGGGTTTTCCCTGGGTGG - Exonic
1123592854 15:21877406-21877428 GGGTGTGGGTTTTCCCTGGGTGG - Intergenic
1123873563 15:24600658-24600680 GGGGTGGGGTGGGCCATGGGTGG - Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1124371445 15:29106839-29106861 GGGTTGAGGTGACCCCTGGGCGG - Intronic
1124426434 15:29567222-29567244 GGGTGGGTGTCAGGCCTGGCCGG - Intronic
1124437929 15:29666404-29666426 GGGTGGGGGTGAGTGGGGGGAGG - Intergenic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1125003738 15:34795865-34795887 GGGTGTGGGTGCTCCCTGGATGG + Exonic
1125200000 15:37095163-37095185 GGCTGGGGGTGGGGGCTGGGGGG - Intronic
1125385388 15:39131195-39131217 GGGTGCTTGTGAGTCCTGGGAGG - Intergenic
1125999345 15:44194852-44194874 GGGCTGGGGCGACCCCTGGGCGG + Intronic
1126414776 15:48406306-48406328 TGGTAGGGGTGAGGCCTGTGGGG + Intergenic
1127562077 15:60149261-60149283 GGGTGGGGGTGGGGCTGGGGAGG + Intergenic
1128232891 15:66047898-66047920 GGGTGGAGGGGAGGCCTGAGGGG + Intronic
1128346355 15:66854838-66854860 GGGTTGGGGTGACCAGTGGGCGG - Intergenic
1128511643 15:68317216-68317238 GGGTCAGGGTGGGCACTGGGAGG - Intronic
1128711805 15:69877873-69877895 GGGAGGGGGTAATTCCTGGGAGG - Intergenic
1128997326 15:72306616-72306638 GGGTGTGTCAGAGCCCTGGGTGG - Intronic
1129322832 15:74784072-74784094 GGGTGAGGTTGAGGCCTGGCAGG + Intronic
1129457612 15:75684016-75684038 GGGTGGGGGCGGGGCCTTGGTGG - Intronic
1129466978 15:75729634-75729656 GGGTGGGGGTGGGAGCTGGCAGG + Intergenic
1129720261 15:77874117-77874139 GGGTGGGGGTGGGAGCTGGCAGG - Intergenic
1129879563 15:78997936-78997958 GGGTAGAGGTGAGCTCTTGGGGG - Intronic
1129894137 15:79091151-79091173 GGGGGGGGGCGAGCCTTTGGAGG - Intergenic
1129924273 15:79348940-79348962 GGGTGGGGGAGGGCCCGAGGTGG - Intronic
1130018048 15:80202297-80202319 GGGTGGGGCTGAGGGTTGGGTGG + Intergenic
1130540537 15:84817973-84817995 GGGAGGGGGAGAGCACTGGTGGG + Intronic
1130653671 15:85777043-85777065 GGGTGAGGCTGAGGGCTGGGAGG - Intronic
1130669000 15:85893703-85893725 GTGTGAGGGTGACCCCTGAGAGG + Intergenic
1130891977 15:88141095-88141117 GGATGGGGGTGAGGCTGGGGAGG + Intronic
1131050410 15:89343730-89343752 GGGTGGAGGTGAGGCCATGGAGG - Intergenic
1131054929 15:89369449-89369471 GGATGGGGGTCAGGGCTGGGTGG - Intergenic
1131261795 15:90891492-90891514 GAGGGGGCGTGAGCCCTGGGAGG - Intronic
1131298025 15:91169419-91169441 GGGTGGGGGTGGGGGATGGGGGG - Intronic
1131740923 15:95390435-95390457 GGGTGGGGGTGGGCTAGGGGAGG + Intergenic
1131814765 15:96211157-96211179 GGGACGGGGTGGGCCATGGGTGG - Intergenic
1132232231 15:100192843-100192865 GGTTGGGGGAGAGCCATGTGGGG - Intronic
1132302851 15:100787200-100787222 GGGTGGGGAGCAGACCTGGGTGG + Intergenic
1202964971 15_KI270727v1_random:167360-167382 GGGTGTGGGTTTTCCCTGGGTGG - Intergenic
1132551594 16:555965-555987 TGGTGGGGGTGAGACCCAGGAGG - Intergenic
1132590356 16:723820-723842 GGGTGTGGGGGAGGCCTGTGGGG - Intronic
1132592238 16:731099-731121 GAGAGGGAGAGAGCCCTGGGAGG - Intronic
1132597584 16:760474-760496 GGGTGGGTGTGGGGCGTGGGTGG - Intronic
1132606901 16:797344-797366 GGGTGGGGCTGAGCCACAGGAGG + Intronic
1132691518 16:1183722-1183744 GGCTGGGGGGCGGCCCTGGGGGG + Intronic
1132844130 16:1992259-1992281 GGGAGGGGGCGGGGCCTGGGCGG + Intronic
1133125175 16:3641769-3641791 GGGTGGGGCTGCCCACTGGGAGG + Intronic
1134685058 16:16152725-16152747 GGGTGGGGGTGTGGGGTGGGGGG + Intronic
1134748293 16:16605025-16605047 GTGTGGGGATGTGACCTGGGAGG - Intergenic
1134997170 16:18748590-18748612 GTGTGGGGATGTGACCTGGGAGG + Intergenic
1135040434 16:19113868-19113890 GGATGGGGGTGGGCCGCGGGAGG + Intergenic
1135408909 16:22218444-22218466 GGGTGAGGGTGAGCCCCGAGGGG + Intronic
1135544222 16:23355038-23355060 TGCTGAGGGTGAGGCCTGGGAGG - Intronic
1135718447 16:24793471-24793493 AGGCTGGGGTGAGCCCTGGGGGG + Exonic
1136499756 16:30664442-30664464 GGGTGGGGGTGGGGGCAGGGTGG - Exonic
1136538342 16:30913599-30913621 GGGTGGTGGTGGGCTCTGGTGGG - Intergenic
1136542731 16:30937369-30937391 GGGTGGGGGAGCCTCCTGGGGGG - Intronic
1137293115 16:47065821-47065843 GGGTGGGCCTCAGCCATGGGTGG - Intergenic
1138318019 16:56087028-56087050 GGGTGGAGGTCAGGACTGGGAGG + Intergenic
1138420304 16:56894698-56894720 GGGTAGGGGACAGCCTTGGGTGG - Intronic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1139946775 16:70647276-70647298 GGGTGTTGGGGAGCCCCGGGCGG + Intronic
1140593544 16:76381330-76381352 GGGTGGGAGGGGGCACTGGGAGG - Intronic
1141251232 16:82360859-82360881 GGGTGGGGGTGGGGAATGGGAGG - Intergenic
1141657437 16:85423627-85423649 GGGTAGGGGTGGGACCTGGGTGG + Intergenic
1141756695 16:85996044-85996066 GGGTGGGGGAAAGGCCAGGGTGG + Intergenic
1141886036 16:86893019-86893041 TGGTGGGAGGGAGCCCTGGAGGG - Intergenic
1141899795 16:86983735-86983757 GGCTGGGGGTGAAGGCTGGGAGG + Intergenic
1141915504 16:87093934-87093956 GGGTCTGGGTGGGACCTGGGGGG - Intronic
1142029168 16:87829863-87829885 GGGTGGGGGTGAGCCATGGGCGG - Intergenic
1142030524 16:87836195-87836217 GGGCGGTGGTGAGCCCCGGCAGG - Intronic
1142103371 16:88287664-88287686 GGGTGGGGGCTGGACCTGGGAGG - Intergenic
1142176616 16:88648203-88648225 GGGTAGGGGGCAGCTCTGGGTGG - Intronic
1142177297 16:88651085-88651107 GGCTGGGGGCGGGGCCTGGGCGG - Exonic
1142199230 16:88753259-88753281 GGGGGCGGGTGAGCTCTGGGGGG - Intronic
1142234631 16:88915801-88915823 GGGTGGGCGGGCGCCCTGGTGGG + Intronic
1142429628 16:90019224-90019246 GGCGAAGGGTGAGCCCTGGGGGG + Intronic
1142461940 17:101587-101609 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
1142749183 17:1977508-1977530 GGGTGGGGGGCGGCACTGGGCGG - Intronic
1143003178 17:3808528-3808550 GGGAGGGGGAGAAGCCTGGGCGG + Intergenic
1143034977 17:3989591-3989613 GGGTGGGCGTGAGGCCTGGCCGG + Intergenic
1143096928 17:4483145-4483167 GTCTGGGGGCGAGGCCTGGGTGG + Intronic
1143112563 17:4560524-4560546 GGGCTGGGGCGAGCACTGGGGGG - Exonic
1143189594 17:5031856-5031878 AGGTGGGCGGGAGCCCTGCGGGG + Intergenic
1143392729 17:6569645-6569667 GTCTCGGGGTGAGCTCTGGGGGG - Intergenic
1143486855 17:7260199-7260221 GGGTGGGGGGGTGCCGTTGGTGG - Exonic
1143527235 17:7479640-7479662 GGGTGGGGGTAGGACCGGGGCGG - Intronic
1143540132 17:7563639-7563661 GGGTGGAGGTGGCCCCCGGGGGG - Exonic
1143866281 17:9926219-9926241 GGATGAGGCTGAGTCCTGGGTGG - Intronic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1143949743 17:10623156-10623178 GGATGAGAGTGAGCCCTGCGGGG + Intergenic
1145265864 17:21379382-21379404 GGGTGAGGGTGGCCACTGGGTGG - Intronic
1145394954 17:22487494-22487516 GGGTAGGGATCTGCCCTGGGTGG - Intergenic
1146935282 17:36809132-36809154 GGGAGGGGGTGTGTCCTGGGAGG - Intergenic
1147037024 17:37689273-37689295 GAGTGGGGGTGGGCCAGGGGAGG - Intronic
1147139185 17:38452069-38452091 GGGTGAGGGTGAGGCGTGTGGGG - Intronic
1147386245 17:40084023-40084045 GGGTGGGGATGAGTTCTGGGAGG + Intronic
1147491077 17:40866915-40866937 GGTTATGGGAGAGCCCTGGGTGG - Exonic
1147652216 17:42069142-42069164 GGTAGGGGTTGGGCCCTGGGAGG + Intergenic
1147775624 17:42898717-42898739 GGCTGGGTGCGAGCCCTTGGTGG + Intergenic
1147977142 17:44254463-44254485 GGGTGGGGGCTGGGCCTGGGAGG - Intronic
1147985792 17:44307471-44307493 AGGTGTGAGTGAGTCCTGGGAGG + Intergenic
1148123183 17:45224096-45224118 GGTAGGGGGTAAGCCCTGGTGGG - Intronic
1148159597 17:45442345-45442367 GTGAAGGGGAGAGCCCTGGGTGG - Intronic
1148377059 17:47158177-47158199 GGGTGGGGTTGAGAGGTGGGTGG - Intronic
1148484842 17:47984039-47984061 GAGTGGGGCTGAGCCATGGCTGG - Intergenic
1148551321 17:48552199-48552221 GGGCGGGGGTGAGCCAGGCGGGG + Exonic
1149428355 17:56577019-56577041 GGTTGGGGGTAGGACCTGGGAGG - Intergenic
1149626448 17:58083693-58083715 GGGTGGGGGCGTCCCCCGGGTGG + Intronic
1150251057 17:63704624-63704646 GGGGGGGGGTGGTCCCTGGAAGG + Intronic
1150390885 17:64789217-64789239 GTGAAGGGGAGAGCCCTGGGTGG - Intergenic
1151431488 17:74066478-74066500 GGGTGTGGCTGAGCCCCAGGTGG - Intergenic
1151447631 17:74177525-74177547 GGGTTGGGGTGAGCCCTTGGTGG - Intergenic
1151455821 17:74225291-74225313 GGGTCGGGGTGAGCAATGAGTGG + Intronic
1151474364 17:74337338-74337360 GGGTGGGGGGGGTGCCTGGGTGG + Intronic
1151542536 17:74771918-74771940 GAGTGGGGCTTAGACCTGGGTGG - Intronic
1152030306 17:77838091-77838113 GGGTGGGTGGGAGAGCTGGGGGG + Intergenic
1152091935 17:78252000-78252022 GGTTGGTGGGGAGCCCTGGAAGG - Intergenic
1152561047 17:81078946-81078968 TGGTTGGGGTAAGACCTGGGGGG + Intronic
1152574193 17:81132976-81132998 GAGTGGAGGTGGGGCCTGGGTGG - Intronic
1152689523 17:81711860-81711882 GGCCGGGGCTGAGCCCTCGGTGG + Intergenic
1152695092 17:81740177-81740199 GGGTGGGGGTGGGCCAGGCGCGG + Intergenic
1152735821 17:81996315-81996337 GGGAGAGGGTGAGCCGGGGGCGG + Intronic
1152822857 17:82446016-82446038 GGGTGGGGGTGAGGCCCCAGCGG - Intronic
1152898152 17:82925444-82925466 GCGTGGGGCTGACCTCTGGGAGG - Intronic
1153515158 18:5895427-5895449 GGGTGGAGTTGAGCCCGCGGCGG + Exonic
1153883951 18:9446554-9446576 GGTTGGAGGTGAGGCCTGGTAGG + Intergenic
1154457439 18:14543306-14543328 GGGTGTGGGTTTTCCCTGGGTGG - Intronic
1155064684 18:22258121-22258143 GGGTGGTGGAGAGCGGTGGGAGG + Intergenic
1155333147 18:24738141-24738163 GTGTGGGGGTGGGGGCTGGGGGG + Intergenic
1156036835 18:32773573-32773595 GGGTGGGGGGGAGGTGTGGGGGG - Exonic
1156670130 18:39458823-39458845 TGTTGGGGGTGGGGCCTGGGAGG + Intergenic
1157160795 18:45312815-45312837 GGGGTGGGGTGAGGCCTGAGAGG - Intronic
1157272082 18:46283806-46283828 GGGAGGGGCAGAGACCTGGGAGG - Intergenic
1159119412 18:64151516-64151538 GGGTGGGGGTGTGGCGGGGGCGG - Intergenic
1160134911 18:76263647-76263669 GGGTGGGTGTGGCCCATGGGAGG - Intergenic
1160146261 18:76367524-76367546 GGGTGGGGGTCAGCTCACGGAGG - Intronic
1160425102 18:78773898-78773920 GGCTGGGGCTGGGCACTGGGTGG - Intergenic
1160433864 18:78831234-78831256 GGGTGGGCCTGGGCCCTGGCAGG - Intergenic
1160499668 18:79395652-79395674 GGGAGGGGGGGCGCCCGGGGAGG - Intergenic
1160562961 18:79771018-79771040 GTGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160562973 18:79771052-79771074 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160563137 18:79771511-79771533 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160630975 18:80246613-80246635 GGGTGGGGGCGCGCCCGTGGGGG + Intronic
1160651644 19:233955-233977 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
1160712137 19:557049-557071 GGGTGGGCGTGAGTTTTGGGGGG + Intergenic
1160797875 19:954114-954136 GGGTGCTGGGGGGCCCTGGGAGG + Intronic
1160843611 19:1157133-1157155 GGGTGGGAGCCAGCCCTTGGGGG - Intronic
1160869246 19:1269503-1269525 GGGAGGGGGCGGGCCCGGGGTGG + Intronic
1160873429 19:1286893-1286915 AGCTGGGGGTCAGCCCCGGGAGG + Intronic
1160879176 19:1311733-1311755 GGGTGGCAGGGAGCCCTCGGAGG + Intergenic
1161007013 19:1941875-1941897 CGGTGGGCTTGAGCACTGGGTGG - Intronic
1161015089 19:1979440-1979462 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
1161270146 19:3385188-3385210 GGGGGGGGGTGTGCCCTGCTGGG - Intronic
1161396345 19:4046930-4046952 GGGTGGGGGGGCGCCCTGAGGGG + Exonic
1161399988 19:4063002-4063024 GGGTGGGGGTGAGCCTTGGGTGG - Intronic
1161438575 19:4278563-4278585 GGGTGGGGGGGAGCGGTGGCGGG - Intergenic
1162029472 19:7911182-7911204 GGGAGGGGGTGGGGGCTGGGAGG + Intronic
1162143128 19:8596478-8596500 GGGCTGGGGTGAGACCTGGCAGG - Intronic
1162144840 19:8607337-8607359 GGGTGGAGGAGAGGCCTGGGAGG - Intronic
1162273380 19:9634284-9634306 GGGTGGGGGAGAGTTGTGGGAGG - Exonic
1162340298 19:10087639-10087661 GGGGAGGAGTGAGCCCTGGGAGG + Intronic
1162401857 19:10451257-10451279 GGGTGGGGCCAACCCCTGGGCGG + Intronic
1162452533 19:10763701-10763723 GGGAGGTGGTGAGGCTTGGGAGG + Intronic
1162552279 19:11364483-11364505 GGCTGGGGGTGGGCGCTGGCAGG - Exonic
1162809266 19:13154415-13154437 GCGTGGGTGTGGGGCCTGGGAGG + Exonic
1162854793 19:13460054-13460076 GGGTGCGGGTGAGCAGAGGGAGG - Intronic
1162936320 19:13983442-13983464 GGGTGGGGGAGGGCCCGGGAGGG - Intronic
1162944169 19:14032166-14032188 GGGTGGGGGAGCTCTCTGGGTGG + Intronic
1163007544 19:14406168-14406190 TGTTGGGGGTGGGCCCTGGGGGG + Intronic
1163032326 19:14552852-14552874 GGGCCTGGGTGAGGCCTGGGTGG + Intronic
1163469702 19:17489156-17489178 GGGAGGGGGTGAGGCCTGGCTGG - Intronic
1163651447 19:18520701-18520723 GGGTGGGGGGGTGCCGCGGGCGG - Intronic
1163678888 19:18669384-18669406 GGGAGGGAGGGACCCCTGGGAGG - Exonic
1163726418 19:18925659-18925681 GTGTGGGGCTGCCCCCTGGGAGG + Intronic
1163752629 19:19086968-19086990 GTGTGGGGGGGTGCGCTGGGTGG + Intronic
1164967629 19:32499161-32499183 GAATGAGGGTGAGCCTTGGGAGG - Intergenic
1165022792 19:32937413-32937435 GGGTGGGGGTTGGACCTGGGGGG - Intronic
1165046364 19:33108142-33108164 GGGTGGGGCTCAGACCCGGGAGG - Intronic
1165309649 19:35022514-35022536 GGGAGTGGGGAAGCCCTGGGAGG + Intronic
1165896708 19:39145793-39145815 GGGTGAGGGTGGGCAGTGGGCGG - Intronic
1165959179 19:39520213-39520235 GGGCTGGGGTGAGCTCAGGGAGG + Exonic
1166144810 19:40826494-40826516 GGGAGGGGGCGGGCCCTGGGCGG + Intronic
1166182932 19:41121713-41121735 GGGAGGGGGCGGGCCCTGGGCGG - Intronic
1166254424 19:41592254-41592276 TGGTGAGGGTGAACCATGGGGGG - Intronic
1166294135 19:41880780-41880802 GGGTGGGGGTGTTCCCTCTGGGG + Intronic
1166305691 19:41935857-41935879 GGGTGGGGGGGGAGCCTGGGAGG - Intergenic
1166513075 19:43424090-43424112 GGGTGGGGGTGGGAGGTGGGAGG - Intergenic
1166516908 19:43454000-43454022 GGGTGAGTGTGAGCCCTTGGTGG + Intergenic
1166651759 19:44580500-44580522 TGGCTGGGGTGAGCCCTGGATGG - Intergenic
1166681548 19:44770712-44770734 GGGTGGGGCTAGGCCCTTGGGGG + Intergenic
1166812223 19:45521405-45521427 AGGTGGGGCTGGGCCCTGGGTGG + Exonic
1166885191 19:45956230-45956252 GGGTTGGGGTGGGAACTGGGGGG + Intronic
1166965362 19:46526663-46526685 GGGTGGGGATGAGATTTGGGTGG + Intronic
1167006134 19:46777626-46777648 TGGTGTGGGTGGGCTCTGGGTGG - Intronic
1167080750 19:47274850-47274872 GGGTGGGGGCGGGGCCTGGTGGG + Exonic
1167093361 19:47359783-47359805 GGGTGGGGGAGGGCCCAGGATGG + Intronic
1167237016 19:48321386-48321408 GGGCGGGGCTGAGACCTGTGAGG + Intronic
1167247560 19:48382905-48382927 GGCTGGGGGTGGGATCTGGGAGG + Exonic
1167397838 19:49243228-49243250 GGGTGGGGGTGAGGGTGGGGAGG + Intergenic
1167533444 19:50033357-50033379 GGGAGAAGGTGAGCCCTGAGTGG + Intronic
1167648084 19:50716563-50716585 GTGTGGGGGTGATTCCTGGGAGG + Intronic
1167980577 19:53271893-53271915 GGGTGGGTGTGAGCCTGTGGTGG - Intergenic
1168713296 19:58513702-58513724 GGGTGGTGGTGGGGGCTGGGGGG - Exonic
925365985 2:3312519-3312541 TGGTGGGAGGGAGCCTTGGGAGG - Intronic
925411566 2:3642799-3642821 GGCCGTGGGTGAGGCCTGGGAGG - Intronic
925859728 2:8162890-8162912 GGGTGGGGGCCAGCCCTGGGTGG - Intergenic
925891656 2:8439520-8439542 GGGAGAGGGTGAGCCCCGGGAGG + Intergenic
925929318 2:8694225-8694247 GGGTGGGGGAGAGCTGTTGGGGG + Intergenic
925929344 2:8694280-8694302 GGCTGGGGGAGAGCGGTGGGTGG + Intergenic
926103067 2:10132988-10133010 GTCTGGGGGTGAGGCCGGGGAGG - Intergenic
926542976 2:14204394-14204416 GGGCTGGGGTGGGCCATGGGTGG - Intergenic
926796837 2:16626432-16626454 GGGTGAGGGTGAGAGCTGAGTGG - Intronic
927047190 2:19291125-19291147 GGGTGGGAGCTAGTCCTGGGCGG - Intergenic
927136133 2:20097774-20097796 GGGAGGGGATGGGCACTGGGAGG - Intergenic
927490737 2:23519331-23519353 GGGTGGGAGGGAGCCTGGGGGGG - Intronic
928058070 2:28078670-28078692 GGGTGGGGGTGAGCACACTGAGG + Intronic
930124317 2:47783821-47783843 GGGTGGGGAGGGGGCCTGGGAGG + Intronic
931634273 2:64327788-64327810 GGGTGGGGGTGAGCGAGGGGAGG + Intergenic
932257816 2:70302113-70302135 GGGGGGGCGTGGGCCCTGGAAGG - Intergenic
932271875 2:70418276-70418298 GGGTGTGGGTGTGCCCTGCTTGG - Intergenic
932961245 2:76415025-76415047 GGGTGGGGGAGAGCCCTCTCAGG - Intergenic
933692971 2:85194050-85194072 GGGTGGGGCAGAACCCTGGAAGG + Intronic
933854800 2:86402780-86402802 GGGTTGGGGTGAGATCTGAGGGG + Intergenic
934517096 2:94995533-94995555 GGTTGTGGGTGAGAACTGGGAGG - Intergenic
934652469 2:96100389-96100411 GGGGTGAGGTGAGCCCAGGGTGG - Intergenic
934924546 2:98372897-98372919 GGGTGGGGCCGAGACCTGAGTGG - Intronic
935678528 2:105616969-105616991 GGTTGGGGTGGAGCCCAGGGAGG - Intergenic
935710410 2:105893331-105893353 GTGTGGGTGTGAGGCCTGGATGG - Exonic
936010736 2:108923793-108923815 TGGTTGGTGTGACCCCTGGGGGG - Intronic
936160219 2:110079216-110079238 GGTTGGGGGTGAGGACTAGGAGG + Intergenic
936184445 2:110292138-110292160 GGTTGGGGGTGAGGACTAGGAGG - Intergenic
936228902 2:110682245-110682267 GGGTTGGGGTGGGCAGTGGGTGG + Intergenic
936412524 2:112273425-112273447 GTGTGGGGGTGAGCATTGAGGGG - Intergenic
936584734 2:113746223-113746245 AGGTGGGGTTGAGCCATGGTAGG - Intronic
936713620 2:115161465-115161487 GGGGGGGGGAGAGCCCGGAGCGG - Intronic
936860517 2:117012469-117012491 GCGGGGGGGTGAGCCCCGAGGGG + Intergenic
937012110 2:118572121-118572143 GGTGGAGGGTGGGCCCTGGGAGG + Intergenic
937251668 2:120527792-120527814 GCCTGGGGATGAGTCCTGGGTGG + Intergenic
937890810 2:126937081-126937103 AGGTGGGGGTGAGAAGTGGGAGG + Intergenic
937909070 2:127066648-127066670 GGCTGGGGGTGATGCCTAGGGGG - Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938081504 2:128372773-128372795 GGCTGGGAGTGAGCCATGGTGGG + Intergenic
938114736 2:128595395-128595417 GGGTGGTGGTGTGCACTCGGCGG + Intergenic
938286329 2:130120680-130120702 GGGTGTGGGTTTTCCCTGGGTGG - Intronic
938336968 2:130509395-130509417 GGGTGTGGGTTTTCCCTGGGTGG - Exonic
938352873 2:130611351-130611373 GGGTGTGGGTTTTCCCTGGGTGG + Intergenic
938429278 2:131218216-131218238 GGGTGTGGGTTTTCCCTGGGTGG + Exonic
938802174 2:134773649-134773671 GAGTGGGGGGAAGCCCAGGGCGG - Intergenic
940862786 2:158787617-158787639 GGGTGGGGCAGGGCCCTGGGTGG + Intergenic
942324665 2:174765772-174765794 GGGCGGGGCTGAGCTCTGGTAGG - Intergenic
942558748 2:177198650-177198672 GGTTGGGGCTGAGCCTCGGGTGG - Intergenic
944168030 2:196743556-196743578 GGGTGGGGGTGGGGGGTGGGAGG - Intronic
944221435 2:197308489-197308511 GGGTGGGGAAGTGGCCTGGGTGG - Intronic
944668073 2:201973104-201973126 CGGTGGGGGTGAGGGGTGGGGGG - Intergenic
945175785 2:207041752-207041774 GGGTGGGGGTGGGGGCTGGGGGG - Intergenic
946247497 2:218396117-218396139 GGGGAGGGGTGAGGCCGGGGCGG - Exonic
946306847 2:218860886-218860908 GGGTGGGGGTGGGGCCGGGGCGG + Intronic
946372534 2:219289749-219289771 GGCTGGGCGTGAGGCCAGGGAGG + Exonic
946684878 2:222257828-222257850 GCGTGGGGGTGACCCTGGGGAGG - Intronic
947518741 2:230828489-230828511 GCGCTGGGCTGAGCCCTGGGTGG - Intergenic
947866730 2:233402998-233403020 TGGTGGTGGTTAGCCTTGGGAGG + Intronic
948246240 2:236488923-236488945 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246284 2:236489095-236489117 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246315 2:236489210-236489232 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246323 2:236489238-236489260 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246363 2:236489382-236489404 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948501075 2:238395041-238395063 GGGTGGGGGGGTGTCCAGGGAGG + Intronic
948543848 2:238711413-238711435 GGGTTGGGGTGGGTGCTGGGGGG + Intergenic
948869902 2:240792527-240792549 GGGTTGGGGTGAGGAGTGGGGGG + Intronic
948883207 2:240870721-240870743 GGGTGGGGGTCAGGGCCGGGAGG + Intronic
948963138 2:241355953-241355975 GGGTGGGGCTAGGTCCTGGGCGG - Intergenic
948990505 2:241551652-241551674 GGGCTGTGGTGAGCCCTGAGTGG - Intergenic
949045512 2:241871068-241871090 GGTTTGGGGAGAGCACTGGGAGG - Intronic
1168830942 20:845050-845072 GGCTGGGCGTGAGCACTGTGCGG - Exonic
1168952205 20:1810262-1810284 GGGCTGGGGAGAGCTCTGGGAGG - Intergenic
1169268598 20:4182364-4182386 GGGTGGAGAGGAGCCCCGGGGGG + Exonic
1169699643 20:8432031-8432053 TGGTGGGGGTGGGAGCTGGGAGG + Intronic
1170114163 20:12838865-12838887 GGGTGGGGGTGTGGTGTGGGTGG + Intergenic
1170449476 20:16467298-16467320 AGGTGGTGGTGAGGCGTGGGGGG - Intronic
1170524777 20:17226868-17226890 GGGCGGGGGCGGGCCCGGGGCGG + Intronic
1170653904 20:18268229-18268251 GGAGGGTGGTGAGCCCAGGGAGG + Intergenic
1171293212 20:23994379-23994401 GGGTGTGGGTGAGCACAGGCAGG - Intergenic
1171869190 20:30512541-30512563 GGCAGGGGGTGAGCCCCGAGGGG - Intergenic
1171959930 20:31486002-31486024 GGGCCGGAGTGGGCCCTGGGAGG + Intergenic
1172025084 20:31943059-31943081 GAGTGGGGGGGAGGCCTGGGTGG - Exonic
1172629577 20:36368941-36368963 GGGTGGAGGTGGGCACTGGATGG - Intronic
1172773229 20:37393384-37393406 GGGAGCTGGTGAGACCTGGGTGG - Intronic
1172993112 20:39050317-39050339 GGGAGGGGGTGAGTGCGGGGAGG + Intergenic
1173559169 20:43990359-43990381 GGGAGTGGATGAGCTCTGGGTGG + Intronic
1173579201 20:44135015-44135037 GGGTAGGGGGGATGCCTGGGGGG + Intronic
1173659513 20:44723611-44723633 GCGTGTGTGTGAGACCTGGGTGG - Intronic
1173821403 20:46022395-46022417 GGATGGGAGTGGGGCCTGGGAGG + Intronic
1173864840 20:46307368-46307390 GGGTGCCGGGCAGCCCTGGGTGG - Intronic
1173915140 20:46702116-46702138 GGGTGGGGGTGGGGGGTGGGGGG + Intergenic
1174036340 20:47670703-47670725 GGGTGGGGGTGGGAGCGGGGTGG + Intronic
1174066796 20:47871629-47871651 TGGCTGGGGTGAGCCCTGAGTGG + Intergenic
1174157417 20:48524783-48524805 GACTTGGGGTGAGCCCTGAGTGG - Intergenic
1174299081 20:49568751-49568773 GGGTGAGGAGGAGCCTTGGGGGG - Intergenic
1174350736 20:49965852-49965874 GGGTGGGGTTGGGCCCTGGGAGG - Intergenic
1174500513 20:50980918-50980940 GGGTGGGAGTGAGCCCTCTGGGG + Intergenic
1174522241 20:51140775-51140797 TGGTGGGGGAGAGCACTTGGAGG + Intergenic
1175253923 20:57627409-57627431 GTGTGGAGGTGAGCCCAGGAAGG + Intergenic
1175376154 20:58525359-58525381 GGGTGGGGATGAGCCCCTGGTGG + Intergenic
1175381185 20:58565630-58565652 GGGTGGGGGAGAGAGCTGCGGGG + Intergenic
1175439672 20:58981604-58981626 GGGTGGGGGTGAGGCGCCGGAGG + Intronic
1175538024 20:59729022-59729044 AGGTGGGGATGAGCCTGGGGAGG + Intronic
1175865298 20:62172828-62172850 GGGCAGGGGTGGGCGCTGGGGGG - Intronic
1175865330 20:62172945-62172967 GGGCAGGGGTGGGCGCTGGGGGG - Intronic
1175902293 20:62364754-62364776 GGGTCGGGGTGAACCCTGCTGGG - Intronic
1175944973 20:62554456-62554478 TGGTGGGGGTGAGGCTGGGGCGG + Intronic
1176128226 20:63485413-63485435 GGGTGGGGAGGAGCACAGGGAGG - Intergenic
1176218554 20:63959415-63959437 GGGTGGAGGTGAGGCCAGGATGG + Exonic
1176232080 20:64037890-64037912 AGGTTGGGGTTAGGCCTGGGGGG - Intronic
1176241676 20:64078477-64078499 GTGTGGGGGAGGACCCTGGGTGG - Intronic
1176389774 21:6157481-6157503 GAGTTGGAGTGAGTCCTGGGAGG + Intergenic
1176816718 21:13610047-13610069 GGGTGTGGGTTTTCCCTGGGTGG + Intronic
1177821612 21:26036273-26036295 GGGTGGGGGGTAGAACTGGGGGG + Intronic
1178455565 21:32747083-32747105 GGGTGGGGGTGGGGACTTGGGGG + Intronic
1178491855 21:33057566-33057588 GGATGGGGGCAAGCTCTGGGTGG + Intergenic
1178911380 21:36676514-36676536 GGGTGGGGGTGGGCACTGCATGG + Intergenic
1178955515 21:37018126-37018148 AGGAGGGGGTGACCACTGGGGGG + Exonic
1178974411 21:37209013-37209035 GGATGGGGGTGGGGGCTGGGGGG + Intergenic
1179642763 21:42758057-42758079 GGCTGGAGGTGGGCCCTGGGTGG + Intronic
1179733693 21:43380757-43380779 GAGTTGGAGTGAGTCCTGGGAGG - Intergenic
1179888318 21:44323964-44323986 GGGTGGGGCTGAGCCTACGGAGG + Intronic
1179939617 21:44629105-44629127 GGGTGTGGGTGAGGACTGGAGGG - Intronic
1180008184 21:45032978-45033000 GGGCGGGGGTGGGCGGTGGGGGG - Intergenic
1180030334 21:45202314-45202336 GGGTGAGGGTGACCCCAGAGTGG + Intronic
1180035376 21:45245584-45245606 GGGTGGGGGTGAGGGGTGGGGGG + Intergenic
1180035391 21:45245620-45245642 GGGTGGGGATGAGGGGTGGGGGG + Intergenic
1180035405 21:45245656-45245678 GGGTGGGGGTGAGGGGTGAGGGG + Intergenic
1180035421 21:45245692-45245714 GGGTGGGGGTGAGGGGTGGGGGG + Intergenic
1180035435 21:45245728-45245750 GGGTGGGGGTGAGGGGTGAGGGG + Intergenic
1180070875 21:45435303-45435325 GGGTGGGGGTGGGCGGAGGGAGG + Intronic
1180079582 21:45480636-45480658 GGGTGGTGGTCATCCCTGGTGGG + Intronic
1180155551 21:45975534-45975556 GGGTGGCTGAGAGACCTGGGAGG + Intergenic
1180193976 21:46182650-46182672 GGGTAGGCATGCGCCCTGGGTGG + Exonic
1180474460 22:15689900-15689922 GGGTGTGGGTTTTCCCTGGGTGG + Intergenic
1180694345 22:17742471-17742493 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
1180764770 22:18339987-18340009 GGGTGGGACTGTGCCCTGGGAGG - Intergenic
1180802515 22:18638435-18638457 GGGTGGGGGTGGGGTCAGGGAGG + Intergenic
1180814259 22:18779697-18779719 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1180824271 22:18852093-18852115 GGGTGTGGGTGAGCACAGGCAGG - Intronic
1181043660 22:20204612-20204634 GGGTGGGGGGGAGCACAGCGTGG - Intergenic
1181124699 22:20695247-20695269 GGGTGCGGGTGAGCACAGGCAGG - Intergenic
1181188463 22:21122455-21122477 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181200445 22:21214032-21214054 GGGTGGGACTGTGCCCTGGGAGG + Intronic
1181210735 22:21288038-21288060 GGGTGTGGGTGAGCACAGGCAGG - Intergenic
1181219208 22:21356826-21356848 GGGTGGGGGTGGGGTCAGGGAGG - Intergenic
1181398773 22:22638850-22638872 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181411149 22:22720715-22720737 ATATGGGGTTGAGCCCTGGGAGG - Intergenic
1181411340 22:22722112-22722134 GTGTGGGAGTGAGCTCTGTGAGG - Intergenic
1181466440 22:23113055-23113077 GCCTGGAGGTGAGCCCTGTGAGG - Intronic
1181501504 22:23318206-23318228 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181557969 22:23683075-23683097 GGGTGGGGGTTAGTCCAGTGAGG - Intergenic
1181651524 22:24261685-24261707 GGGTGCTGCTGAGCCCTGCGAGG - Intergenic
1181701293 22:24622927-24622949 GGGTGGGACTGTGCCCTGGGAGG - Intronic
1181706733 22:24653529-24653551 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1182792904 22:32967798-32967820 GGGCTGGGGTGAGCCCAGTGGGG + Intronic
1183055366 22:35301805-35301827 GGGTGGGTGTGTGTCCGGGGAGG - Intronic
1183196690 22:36358457-36358479 GTGTGGGGGAGAGCTCTGGGCGG - Intronic
1183321822 22:37169655-37169677 GGGAGGGGGCAAACCCTGGGAGG - Intronic
1183361113 22:37384051-37384073 GGGACCGGGTGAGCCATGGGGGG - Intronic
1183522401 22:38303123-38303145 GGGTGGCGGTGAGCGCAGGGTGG - Exonic
1183726650 22:39593639-39593661 GGGTGATGGGGAGCCATGGGAGG + Intronic
1183949464 22:41344601-41344623 GAGTGGGGCAGATCCCTGGGTGG - Intronic
1184197129 22:42937383-42937405 GGCTGTGGGTGAGCCCAGGCAGG + Intronic
1184413304 22:44338121-44338143 GGCTGGGGGTGGTCCTTGGGAGG - Intergenic
1184520910 22:44993437-44993459 GGCTGTGGGAGAGCCCTGGCGGG - Intronic
1184629453 22:45764229-45764251 GAGTGGGGGTGGGGGCTGGGGGG - Intronic
1184706973 22:46221278-46221300 TGGTGGAGGTGAGGCCTGGCGGG - Intronic
1184727662 22:46356082-46356104 GTGTGGGGGTGAGCCCGGGGAGG + Intronic
1184784486 22:46665138-46665160 GGATGGAGGTGAGGCCTGGAAGG - Intronic
1184880243 22:47299998-47300020 GGGTGCGTGAGGGCCCTGGGTGG + Intergenic
1185010129 22:48308261-48308283 GGGTGAAGGTTAGCCCAGGGAGG + Intergenic
1185056990 22:48586333-48586355 AGGTGGGTGTGACCCTTGGGAGG - Intronic
1185149134 22:49154217-49154239 GGGTGGGGGTCCTTCCTGGGTGG + Intergenic
1185223735 22:49641711-49641733 GGGTGAGGGTGAGCCCAGGAGGG - Intronic
1185239909 22:49736979-49737001 GGTTGGGGATAAGCCCGGGGTGG - Intergenic
1185274190 22:49943312-49943334 GGGGTGGGGTGGCCCCTGGGTGG + Intergenic
1185385604 22:50530179-50530201 CGGCGGGGGTGATCCCTGGCCGG + Intronic
1203216212 22_KI270731v1_random:7392-7414 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1203226393 22_KI270731v1_random:80892-80914 GGGTGGGACTGTGCCCTGGGAGG - Intergenic
1203264358 22_KI270734v1_random:5384-5406 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1203274410 22_KI270734v1_random:77997-78019 GGGTGTGGGTGAGCACAGGCAGG - Intergenic
949658298 3:6247360-6247382 AGGTTGCAGTGAGCCCTGGGAGG + Intergenic
949941010 3:9154428-9154450 GGGTGGGGCTGAGCAGGGGGAGG - Intronic
950256750 3:11512211-11512233 GGGTGTGGGGGACCTCTGGGAGG - Intronic
950388422 3:12677733-12677755 GGGTGGGGGTGAGAGAGGGGAGG - Intergenic
950494216 3:13324141-13324163 GGATGGTGGTAAGCCCTGAGCGG - Intronic
950510315 3:13421547-13421569 GGGTGAGGGTCGGCCCTGTGTGG + Intergenic
950544124 3:13628840-13628862 GGGAGGGGCTGGGGCCTGGGAGG + Intronic
952132648 3:30383330-30383352 GGCTGGAGGTGAGGCCTGGTGGG + Intergenic
952181418 3:30920521-30920543 GGGTGGGGCGGGGCCATGGGTGG - Intergenic
952377696 3:32781064-32781086 GGGTGGGGGAGGGCCGAGGGTGG - Intergenic
953013090 3:39047019-39047041 GGGTGGGGGTGGGGGGTGGGGGG - Intergenic
953343996 3:42160098-42160120 GGGTGGGGTGGAGCACTTGGCGG - Intronic
953410541 3:42688316-42688338 GGGTGGGGCTGAGCTCCGTGGGG + Intronic
953506001 3:43485886-43485908 GGGTGGCGGTGAGCGCGGAGAGG - Intronic
953571941 3:44078191-44078213 GGGTGGGGGTGAGCTGGGGCTGG - Intergenic
953661346 3:44893966-44893988 GGGTGGGAGAGAGCCATGGGGGG - Intronic
953661354 3:44893986-44894008 GGGTGGGAGAGAGCCGAGGGGGG - Intronic
953661362 3:44894006-44894028 GGGTGGGAGAGAGCCGTGGGGGG - Intronic
953661391 3:44894083-44894105 GGGTGGAAGAGAGCCATGGGAGG - Intronic
953661396 3:44894103-44894125 GGTTGGGAGAGAGCCGTGGGGGG - Intronic
953661428 3:44894191-44894213 GGGTGGGAGAGAGCCATGGGGGG - Intronic
953661436 3:44894211-44894233 GGGTGGGAGAGAGCCATGGGGGG - Intronic
953661444 3:44894231-44894253 GGGTGGAAGAGAGCCATGGGGGG - Intronic
953661451 3:44894251-44894273 GGTTGGGAGAGAGCCATGGGGGG - Intronic
953661490 3:44894349-44894371 GGGTGGGAGAGAGCCGTGGCGGG - Intronic
953667052 3:44933061-44933083 GGGTGGGTGTGTGACCTGAGTGG - Intronic
954010260 3:47630170-47630192 GGGTGGGGGTGGGGGGTGGGGGG + Intronic
957165882 3:76673326-76673348 GGGTGGGGCTCAGCCCTCTGTGG - Intronic
959358846 3:105366197-105366219 TGGTGGGGGTGAGCAGGGGGAGG + Intergenic
959561624 3:107789013-107789035 GGGTGGGGCTATGCCATGGGTGG + Intronic
960385073 3:117012817-117012839 GGGCTGGGGTGGGCCCAGGGTGG + Intronic
961185494 3:124911611-124911633 TGGTGGGGGTGGGGCATGGGAGG + Intronic
961667807 3:128504501-128504523 GGGAGGGGGTGGTCCCTGGAGGG - Intergenic
961707978 3:128804105-128804127 GGGCGGGGGGGGGCCCAGGGAGG - Intronic
961811363 3:129523622-129523644 TGGTGGGGCTGAGCCATGTGGGG + Intergenic
961858299 3:129893820-129893842 GGGCGGGGATGGGCCCTGGAAGG + Intergenic
962259746 3:133895168-133895190 AGGTGAGGGTGGGCTCTGGGTGG - Intronic
962479075 3:135782818-135782840 GGCTTTGGGTGAGCCCTTGGGGG + Intergenic
962920348 3:139944578-139944600 GGGTGGCTGTGAGCCCTTGGAGG + Intronic
963028385 3:140942196-140942218 GGGCGGGAGTGAGGCCTGGGCGG + Intronic
963742900 3:149097814-149097836 GGGTGGGGGGGAGAGATGGGGGG + Intergenic
965586481 3:170323219-170323241 GGGAGGGGGTGATGTCTGGGTGG + Intergenic
966410604 3:179642634-179642656 GGGATGGGGGGAGTCCTGGGTGG + Intergenic
967258598 3:187619385-187619407 GGGTAGGGGTGAACCCTAGCAGG - Intergenic
967277914 3:187794901-187794923 AGTTGGGGGTTAGCTCTGGGAGG - Intergenic
967330940 3:188288812-188288834 GGGTGGGGGTGGGGGGTGGGGGG - Intronic
967390093 3:188947110-188947132 GGGTGGGGGTGGGGACTGGAGGG + Intergenic
967473449 3:189889433-189889455 AGGTGGGGGTGTGCAGTGGGAGG - Exonic
967892775 3:194374972-194374994 GGGTGGAGGAGAGCCCAGTGTGG - Intergenic
968088439 3:195885195-195885217 GTTTGGGGGTGTGCCCTGGACGG - Intronic
968366188 3:198186014-198186036 GGGTGGGGGTGGGGCTAGGGAGG + Intergenic
968434380 4:576907-576929 GGGTGGGAAGGAGCCCGGGGAGG + Intergenic
968434408 4:576957-576979 GGGTGGGAAGGAGCCCGGGGAGG + Intergenic
968529984 4:1086606-1086628 GGGTGGGGGTGAGGAAGGGGTGG + Intronic
968552608 4:1231404-1231426 GAGTGGGGCTGAGCCCCTGGCGG - Intronic
968650292 4:1757722-1757744 GGGTGGGGGTGGGGGTTGGGTGG - Intergenic
968754688 4:2409229-2409251 TGGTGGGGGTGGGACCTGGCTGG - Intronic
969314372 4:6372650-6372672 TGGTGGAGGTGAGCCCTCGGAGG - Exonic
969330306 4:6470901-6470923 GGCTGGGCGTGGGACCTGGGCGG - Intronic
969443567 4:7231896-7231918 GGGTGGGGATGAGACTGGGGTGG + Intronic
969496972 4:7531758-7531780 GGGTGGCAGTGAGAGCTGGGAGG - Intronic
969733753 4:8973246-8973268 GGGTGGCGGTCAGCCCAGGTGGG - Intergenic
969818717 4:9705021-9705043 GGGTGGGTGGGAGCCCTGGTGGG - Intergenic
970131582 4:12877027-12877049 AGGTGGAGGAGAGCCATGGGTGG + Intergenic
970801157 4:19975294-19975316 TGTTGGAGGTGGGCCCTGGGGGG + Intergenic
971441081 4:26686600-26686622 GGGTAGGGATGAGCTCTGGTCGG + Intronic
972290619 4:37686727-37686749 GGGTCGGGCTGAGCTGTGGGTGG - Intergenic
972909423 4:43796830-43796852 GGGTGGGGGTGGGGGCAGGGTGG - Intergenic
973641299 4:52905448-52905470 GGGTGGGGGAGAGTTCTGGTGGG - Intronic
974119242 4:57618952-57618974 CGGTGGAGGTGAGGCCTGTGAGG + Intergenic
975386217 4:73763378-73763400 GGGTGGGGCAGGGCCATGGGTGG - Intergenic
975802331 4:78074159-78074181 GGGTGGGGGTGGGATCAGGGAGG + Intronic
979333729 4:119444842-119444864 GGGTGGGGGTGGGGCTAGGGAGG - Intergenic
981942410 4:150296899-150296921 CGGTGGGGGTGGGCGCGGGGGGG - Intronic
984767234 4:183408954-183408976 GGTTGGGAGGGGGCCCTGGGAGG - Intergenic
985048938 4:185970568-185970590 GGGGTGGGGCGAGCCATGGGTGG + Intergenic
985484596 5:141101-141123 GGGTGGGGGTGTGCAGGGGGAGG - Intronic
985496317 5:208576-208598 GGGTCGGGGGGAGCCATGTGGGG + Intronic
985517568 5:354773-354795 GGGTGGGGGCCTCCCCTGGGCGG + Intronic
985574093 5:665679-665701 GGGGGTGGGTGGGTCCTGGGAGG - Intronic
985574177 5:665911-665933 GGGTGGGGGCGGGGCCTGGAAGG - Intronic
985579512 5:689537-689559 GGGTGGGGGAATACCCTGGGTGG + Intronic
985594358 5:781596-781618 GGGTGGGGGAATACCCTGGGTGG + Intergenic
985635814 5:1035492-1035514 GGGTGGGGCTGTGCCTTAGGCGG + Intronic
985664680 5:1175882-1175904 GGGCGGGGGTAAGGCCTGGTAGG + Intergenic
985666060 5:1181995-1182017 AGGTCGGGGTGTGGCCTGGGAGG - Intergenic
985723360 5:1502262-1502284 GGCTGGGGGTGTGTCCTGGGGGG - Intronic
985732463 5:1556786-1556808 GGGTGGGGGGGGGGCGTGGGGGG + Intergenic
985748883 5:1663345-1663367 GGGCGGGGCTGAGACCTGGAGGG + Intergenic
985827682 5:2204999-2205021 GGGTGGGGCTGGGGCTTGGGCGG + Intergenic
985997771 5:3606311-3606333 GGATGGAGCTGCGCCCTGGGTGG + Intergenic
986315136 5:6582210-6582232 GTGTGGGGGTGAGCACAGGGTGG - Intergenic
988611829 5:32734195-32734217 GGGTGGGGGTAAGCCAAGGAAGG + Intronic
988825254 5:34929499-34929521 GGGAGGGGGTGGGGCCTCGGCGG - Intergenic
989229792 5:39073850-39073872 GGGTGCGGGGGAGCCCCGAGTGG - Intronic
990128371 5:52548120-52548142 GGGAAGGGGTGGGCCATGGGTGG - Intergenic
993189828 5:84668288-84668310 GGAGGGTGGTGAGCCCAGGGAGG + Intergenic
993502395 5:88678488-88678510 GGATGGGGGTGAGGGCGGGGTGG - Intergenic
993903358 5:93598709-93598731 GGGTGGTGGGGAGGCCCGGGAGG + Intergenic
994063142 5:95504083-95504105 GGGTGGGGGTGGGGGGTGGGGGG + Intronic
994188114 5:96838056-96838078 GGGGTGGGGTGGGCCATGGGTGG + Intronic
994239766 5:97406932-97406954 GTGTGGGGGGGAGGCCAGGGTGG - Intergenic
995134909 5:108670776-108670798 GTGTGGGTGTGTGCCGTGGGTGG + Intergenic
996397838 5:123031428-123031450 GGATGGGGGTGAGCCTTGCCTGG + Intronic
997261352 5:132467676-132467698 GGGTTGGGGTGAGCATTGTGTGG + Intronic
997603676 5:135157323-135157345 GGGAGTGGCTGGGCCCTGGGTGG + Intronic
997642787 5:135460428-135460450 TGGTGGGGGTGAGCCATGTGAGG - Intergenic
998038110 5:138933549-138933571 GGGTGGGGGTGAGCAAGGCGAGG + Intronic
998179057 5:139923699-139923721 GGGTTTGGGTGAGACCTTGGAGG - Intronic
998405081 5:141869681-141869703 GGGTGAGGGTGTTCCATGGGCGG - Intronic
999428371 5:151505983-151506005 GAGTGGCGGTGAGCCGAGGGCGG + Exonic
999748936 5:154611735-154611757 GGGTGGGGATGAGCAGAGGGTGG - Intergenic
999750389 5:154624161-154624183 GGGTGGGAATGTGCACTGGGTGG + Intergenic
1000889035 5:166782360-166782382 TGGTGGGGGGGAGTCCTGGGGGG - Intergenic
1001309886 5:170603094-170603116 GGGTGGGTGGGATCCCTGGGTGG - Intronic
1001545715 5:172569450-172569472 AGGTGTGGGTGAACCATGGGGGG + Intergenic
1001716724 5:173822520-173822542 GGGTGTGGGTGAGCCATTGAGGG + Intergenic
1002050624 5:176568637-176568659 GGGTGGCTGTGGACCCTGGGTGG + Intronic
1002103757 5:176869862-176869884 GGGTGGGATGGAGCCATGGGGGG - Intronic
1002421661 5:179152302-179152324 GGGTGGGTGGCATCCCTGGGAGG - Intronic
1002428185 5:179187960-179187982 AGGGGATGGTGAGCCCTGGGAGG + Intronic
1002434109 5:179220829-179220851 GGGTGGGCGTGGGCCCTGCAGGG + Intronic
1002568582 5:180127726-180127748 GGGAGGGGGTGTCCACTGGGGGG + Intronic
1002725414 5:181291239-181291261 GGGTGGGGGTGGGGCTAGGGAGG + Intergenic
1003194824 6:3905321-3905343 GGGAGGAGGTGACCCCGGGGTGG - Intergenic
1004321402 6:14634227-14634249 GGGTGGGGGCGATCCAGGGGCGG + Intergenic
1004651947 6:17618466-17618488 GGGTGGGGGGGAACCCAGAGGGG + Intronic
1005016488 6:21379711-21379733 GGGTGAGGGTGAGGGCTGAGAGG + Intergenic
1005327768 6:24719812-24719834 GGGTGGGGGTGGGACCTGCGGGG - Exonic
1005498415 6:26409166-26409188 GGGTGGGAGGGAGGACTGGGTGG + Intronic
1005559101 6:27019904-27019926 GGGTGGTGGGAATCCCTGGGAGG - Intergenic
1005911212 6:30311279-30311301 GGGTGGGGGTGTGTGCGGGGTGG - Intergenic
1006084536 6:31586834-31586856 GGGTGGGTGTGGGCACTGGGGGG - Intronic
1006337053 6:33426289-33426311 GGGTGGGGAAGAGGTCTGGGGGG - Intronic
1006374106 6:33662450-33662472 AGGTGGGGCTGGGCCCTGGGTGG + Intronic
1006385899 6:33730757-33730779 GTGTGGGGTGGAGCTCTGGGAGG + Intronic
1006459787 6:34151698-34151720 GGGTGGGGGTGGGGGCGGGGTGG - Intronic
1006632521 6:35439562-35439584 TGGAAGGGGTGAGCCCTGAGAGG - Intergenic
1006865793 6:37208121-37208143 GTGTGGTGGGGAGCCCTGGCAGG + Intergenic
1006867655 6:37222321-37222343 GGTTGGGGTCGAGCCCTGGGGGG - Intronic
1006882760 6:37354229-37354251 GGGTGGGGATGAGCGCCGGGTGG + Exonic
1007095870 6:39212661-39212683 TGGTGGGGGTGTGGTCTGGGAGG - Intronic
1007397809 6:41587434-41587456 GAGGGGGGGTGAGACCTTGGGGG - Exonic
1007427978 6:41759496-41759518 GGGTGGGGTTGAGAATTGGGTGG + Intergenic
1007595741 6:43050245-43050267 GGGTAGAGGTGAGCTCAGGGAGG - Exonic
1008960163 6:57258567-57258589 GGGTTGGGGTGGGGGCTGGGGGG - Intergenic
1010194074 6:73223133-73223155 GGGTGGGGGTGAGCGTGGAGGGG - Intronic
1011191771 6:84737224-84737246 GGTTGAGGGTGAGGCCTGAGCGG + Exonic
1013371273 6:109472977-109472999 AGGTGGGGGCGAGGCCAGGGTGG - Intronic
1013658544 6:112270861-112270883 GCCTGGTGGTGAGTCCTGGGAGG - Intergenic
1013677974 6:112488251-112488273 GGGAAGGGTTGAGCCCTGCGAGG + Intergenic
1014433137 6:121392539-121392561 GGGTGGGGGGGTGCACTGGCTGG - Intergenic
1015467884 6:133567984-133568006 GGGTCGTGTTGAGCCCTCGGTGG - Intergenic
1016183150 6:141171409-141171431 GGGGTGGGGTGGGCCATGGGTGG + Intergenic
1016831306 6:148436157-148436179 AGGTGGCCGTGAACCCTGGGAGG + Intronic
1017666537 6:156724604-156724626 GGGGGGGGGTGAGATTTGGGTGG + Intergenic
1017987449 6:159456127-159456149 GGGTGGTGGTGCTCCCCGGGTGG - Intergenic
1018420155 6:163634156-163634178 GGGAGCGGGTGAGCCCTTTGAGG + Intergenic
1018724756 6:166603378-166603400 GGGTGGGGCAGAGCTCTGGGAGG + Intronic
1018868833 6:167766070-167766092 GGTTGGGGGTGGGACCTGGTGGG - Intergenic
1019324824 7:432902-432924 GGGTCTGGGCCAGCCCTGGGTGG - Intergenic
1019573783 7:1726494-1726516 TGGTGGGCGTGAGGCCTCGGGGG - Intronic
1019711507 7:2520132-2520154 GGGCGGGGGGCAGCCCCGGGCGG - Exonic
1019779243 7:2929873-2929895 TGGTGGGGATGAGCTCTGGAGGG + Intronic
1020101997 7:5399121-5399143 GTGTGGGTGTGAGCAGTGGGTGG - Intronic
1020265552 7:6557673-6557695 GGTTGGGGGTGAGCCACGGCTGG + Intergenic
1020411068 7:7892159-7892181 GGGTAGGGATGAGCCTTGGAGGG - Intronic
1022164410 7:27743140-27743162 TGGTGCGGGTGATACCTGGGCGG + Intronic
1022230773 7:28410149-28410171 GGGTGGGCGCGCGCCCGGGGAGG + Intronic
1022480984 7:30742863-30742885 GGGTGGTGGTGAGGGCTGAGGGG - Intronic
1023033756 7:36112574-36112596 GGCTGTGTGTGAGCCCTGGTGGG - Intergenic
1023528549 7:41130189-41130211 GGGTGAGGGTGGGCAGTGGGTGG - Intergenic
1023842583 7:44105385-44105407 AGGTGGTGGTGAGCAATGGGTGG + Intronic
1023849202 7:44140842-44140864 AGGTGGGGGAGAGACCTGGGTGG + Intronic
1024070316 7:45778841-45778863 GGGTGGGGGTGGGGCTAGGGAGG + Intergenic
1024317600 7:48035756-48035778 GGGTTGGGATGAGCACAGGGCGG + Intronic
1024997158 7:55280509-55280531 GGGTGGGGGTGAGGCAGGGGAGG - Intergenic
1025333614 7:58355993-58356015 GGGTGGGGGTGGGGGATGGGGGG + Intergenic
1026461621 7:70619874-70619896 GTGTGGGGGTGAGCCATGGGCGG - Intronic
1026941615 7:74290508-74290530 GGGTGGGGCTGGGGCCTGCGTGG - Intronic
1027052696 7:75029838-75029860 GGGAGGGGGTTAGGCCTGGTGGG + Intronic
1027234685 7:76291347-76291369 AGGTGGGAGGGCGCCCTGGGAGG - Intergenic
1027299962 7:76821836-76821858 GGGTGGGGGTGAGGGTGGGGAGG + Intergenic
1027770414 7:82399692-82399714 GGGTGGGGGTGGGGGCTGGGGGG - Intronic
1028158063 7:87454831-87454853 GGATGGGGGAAAGACCTGGGAGG - Intronic
1029425829 7:100493631-100493653 GGGTGGGGCTGTGCCGCGGGCGG - Exonic
1029436157 7:100565171-100565193 GGGTGGGGGTGGGACGAGGGAGG - Exonic
1029598720 7:101551230-101551252 TGGGGGGGTTCAGCCCTGGGTGG + Intronic
1029653002 7:101906500-101906522 GGGTTCTGGGGAGCCCTGGGTGG + Intronic
1031135112 7:117875506-117875528 GGGTGGGGGTTTGCGGTGGGGGG - Intergenic
1031653704 7:124324813-124324835 GTGGGGGGGTGAGCCTAGGGAGG + Intergenic
1031793156 7:126135562-126135584 GTGTTGGGGAGGGCCCTGGGTGG - Intergenic
1032047722 7:128623142-128623164 GGGTGGGGGTGGGGCTAGGGAGG + Intergenic
1032084068 7:128874486-128874508 GGGTGTGGCTGAGGCCAGGGTGG - Intronic
1032455963 7:132073827-132073849 GGGTCCGGGTGTGGCCTGGGGGG - Intergenic
1033041235 7:137920181-137920203 GGGTGGGGATCAGCCCAAGGTGG - Intronic
1033052876 7:138022198-138022220 GGGTGGGGGTGGGGCCGGGGCGG + Intronic
1033600604 7:142885906-142885928 GGCAGGGAGAGAGCCCTGGGTGG - Intergenic
1034234658 7:149557260-149557282 GGGTGTGAGTGAGCCCTGCGTGG - Intergenic
1034239438 7:149598492-149598514 GGGTGTGAGTGAGCCCTGCGTGG - Intergenic
1034244591 7:149634856-149634878 GGGAGGGGCTGAACACTGGGAGG + Intergenic
1034329926 7:150273728-150273750 AGGTTGGGGTGAGACCTGAGGGG - Intronic
1034452177 7:151142962-151142984 GGGTGGGGGCCTGCACTGGGGGG - Intronic
1034668132 7:152836132-152836154 AGGTTGGGGTGAGACCTGAGGGG + Intronic
1034968160 7:155404086-155404108 GGGTGGGGGTTGAGCCTGGGAGG + Intergenic
1034969758 7:155411498-155411520 TGCTGTGGGTGAGCCCTGTGGGG - Intergenic
1035058217 7:156050921-156050943 GCTTGAGGGTGAGCCCAGGGTGG - Intergenic
1035127110 7:156616692-156616714 GGGTCGGGGAGAGCGCGGGGCGG - Intergenic
1035176586 7:157056313-157056335 TGGTGGCGGTGTCCCCTGGGAGG - Intergenic
1035439604 7:158885208-158885230 GGGTGGGGGTCAGCCTTGGTTGG + Intronic
1035564163 8:630195-630217 GGGTGTGAGTCAGCTCTGGGTGG - Intronic
1035658574 8:1330271-1330293 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035658592 8:1330356-1330378 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035658611 8:1330440-1330462 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035658629 8:1330525-1330547 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035658656 8:1330644-1330666 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035658668 8:1330695-1330717 GGGTGGGATTGAGTTCTGGGTGG + Intergenic
1035658695 8:1330814-1330836 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035658718 8:1330933-1330955 GGGTGGGACTGAGTTCTGGGTGG + Intergenic
1035766729 8:2112400-2112422 GGGTGGGGGTCAGGGATGGGAGG + Intronic
1035937070 8:3852680-3852702 GGGTGGGGAGGAGCCTTTGGAGG + Intronic
1036425335 8:8640469-8640491 GGGTGGGGGTGAAGGCTGAGGGG + Intergenic
1036648260 8:10625506-10625528 GGGTGGGGGTGGGGTGTGGGAGG + Intronic
1036739491 8:11347809-11347831 AGGTCGGGGCGAGCCCTGCGCGG + Intergenic
1037541495 8:19876217-19876239 GGGTGGGGGTCTGAGCTGGGTGG + Intergenic
1037562711 8:20089019-20089041 GGGTGGGGGCGGGGGCTGGGTGG + Intergenic
1037586632 8:20281210-20281232 GGGTGGAGGTGAGGCCTGGTGGG + Intronic
1037595305 8:20349596-20349618 GGGTGGGGAAGGGTCCTGGGAGG + Intergenic
1037608548 8:20457604-20457626 GGGTAGCGGGGAGCCATGGGAGG - Intergenic
1037780021 8:21861572-21861594 GTGGTGGGGAGAGCCCTGGGAGG - Intergenic
1037989076 8:23307682-23307704 GTGTGGGTGGAAGCCCTGGGCGG - Intronic
1038150875 8:24941882-24941904 GGTTGGGTGGGAGCCCTGGCGGG + Intergenic
1038420430 8:27430816-27430838 GGGAAGGAGTGAGACCTGGGAGG + Intronic
1039467918 8:37797137-37797159 GCGTGGAGGGGGGCCCTGGGCGG - Intronic
1040326359 8:46343620-46343642 GGATGGGGGTCATCCTTGGGAGG - Intergenic
1041588406 8:59547380-59547402 GGGTGGGGGTGGGGCAGGGGAGG - Intergenic
1042004754 8:64168751-64168773 AGGTGGAGCTGAGCCCAGGGTGG + Intergenic
1042968234 8:74378997-74379019 GTGGTGGTGTGAGCCCTGGGAGG + Intronic
1045354640 8:101374732-101374754 GGGTGGGGGTGGGGGGTGGGCGG + Intergenic
1045361408 8:101437123-101437145 GGGTTGGGTTGAGCCCTGGCTGG - Intergenic
1045495036 8:102700868-102700890 GGCAGGGGCTGGGCCCTGGGAGG - Intergenic
1047507259 8:125489612-125489634 GGGTGGGGTTGAGTCATGGAAGG - Intergenic
1048448472 8:134510831-134510853 AGGAGGTTGTGAGCCCTGGGAGG - Intronic
1049009707 8:139879256-139879278 GGCTGGGGGTGAGGAGTGGGTGG + Intronic
1049165290 8:141121973-141121995 GGGTGTGGAGGAGCCCCGGGGGG - Intronic
1049176059 8:141193397-141193419 CGATGTGGGTGAGCCGTGGGCGG + Intronic
1049182079 8:141228046-141228068 GGGTGAGGCAGAGCCCTGAGGGG + Intronic
1049205591 8:141362026-141362048 GGTTGGGGGTTCTCCCTGGGAGG + Intronic
1049284916 8:141769395-141769417 TGGTGGGGGGGAGGCCTGTGTGG - Intergenic
1049289247 8:141792673-141792695 GGCTGGGCGTGAGCCCTGGTGGG + Intergenic
1049333127 8:142065601-142065623 CGGTGGGTGTGAGGCCAGGGCGG + Intergenic
1049395473 8:142398232-142398254 GGCTGGGGGTGCGCTTTGGGAGG - Intronic
1049475947 8:142797045-142797067 GGGATGGGGTGAGAACTGGGTGG + Intergenic
1049510394 8:143024291-143024313 GGGGTGCGGTGGGCCCTGGGCGG - Intergenic
1049660643 8:143818326-143818348 GGGTGGGGGCGAGCCCGAAGTGG + Intronic
1049726313 8:144148086-144148108 GGGTGGGGATGAGCCTTCGGCGG + Intronic
1049785260 8:144447806-144447828 GGGTGGGGATGAGACAAGGGAGG + Intergenic
1049791630 8:144475061-144475083 GTGTGGGGGTCAGACATGGGTGG + Intronic
1051720405 9:20030896-20030918 GGGTGGGGGTGAGCAGCGGGTGG - Intergenic
1053269273 9:36739214-36739236 GGGTGGGGGTGGGAGATGGGGGG + Intergenic
1053619155 9:39798578-39798600 GGGTGGGGCTGAAGCCTAGGGGG - Intergenic
1053877308 9:42557927-42557949 GGGTGGGGATGAAGCCTGGGGGG - Intergenic
1053895357 9:42736761-42736783 GGGTGGGGCTGAAGCCTGGGGGG + Intergenic
1054234385 9:62543795-62543817 GGGTGGGGATGAAGCCTGGGGGG + Intergenic
1054265002 9:62908851-62908873 GGGTGGGGCTGAAGCCTAGGGGG + Intergenic
1056722228 9:89082142-89082164 GGGTTGGGTGGAGCCCTGGAGGG - Intronic
1057266699 9:93622133-93622155 AGGGAGGGGTGAGGCCTGGGTGG + Intronic
1057301938 9:93891532-93891554 TGGTGGGTGTGGGCTCTGGGTGG + Intergenic
1057422889 9:94926622-94926644 GAGTGGGGGAGTGCCCTGTGGGG + Intronic
1057897597 9:98922243-98922265 GGATGAGGGTGAGGCCAGGGAGG - Intergenic
1058940744 9:109810551-109810573 AGGTGGAGGTGAACACTGGGAGG + Intronic
1059434366 9:114267310-114267332 GGCTGGGGGTGGGCCCAGGCTGG - Intronic
1060112481 9:120916674-120916696 GGGTGGGGGTGGGGGCAGGGTGG - Intronic
1060232690 9:121837513-121837535 GGGTGGGGGTGAGGGATGAGGGG + Intronic
1060484908 9:124040890-124040912 GGGTGGGGGTGGGCTTGGGGCGG + Intergenic
1060759116 9:126233777-126233799 GGATGGGGCTGAGCCCTGATTGG + Intergenic
1061204008 9:129152676-129152698 GGGTGTGGCTGAGTGCTGGGTGG - Intergenic
1061263964 9:129495168-129495190 GGTTAGGGGTCAGCCCAGGGAGG - Intergenic
1061286554 9:129626538-129626560 GGGTGGGGGAGTGCCCTGCCTGG - Intronic
1061287871 9:129634428-129634450 GGGTGGGGGTGGGCCTGGGCGGG - Intronic
1061388828 9:130306041-130306063 GGGAGGGGAAGAGCCCGGGGCGG + Intronic
1061411685 9:130425446-130425468 GAGATGGGGTGAGCCTTGGGAGG - Intronic
1061411692 9:130425468-130425490 GAGATGGGGTGAGCCTTGGGAGG - Intronic
1061482426 9:130903566-130903588 GGGTGGGGGTTGGCATTGGGAGG + Exonic
1061543415 9:131290281-131290303 GGCTGGGGGTGTGCGCTGGCCGG + Exonic
1061711504 9:132491009-132491031 GTGTGTGGGTGCGCCCTGCGAGG + Intronic
1061913039 9:133734933-133734955 GGGTGGGGATGGGACCTGGGAGG + Intronic
1062111631 9:134785196-134785218 GGGTGGGGGTGATTCCTGAGCGG + Intronic
1062205747 9:135335896-135335918 GGGTGGAGGGGGGCGCTGGGTGG + Intergenic
1062261958 9:135667295-135667317 TGCTGGGGGTGTGCGCTGGGCGG + Intergenic
1062265706 9:135685655-135685677 GGGGTGGGGTGAGCCGGGGGTGG + Intergenic
1062265714 9:135685671-135685693 GGGGTGGGGTGAGCCGGGGGTGG + Intergenic
1062281465 9:135753805-135753827 ATGTGGGGGTTAGCCCCGGGTGG + Intronic
1062321437 9:135992407-135992429 GGGCAGGGGTGAGCCGTGGCAGG - Intergenic
1062324262 9:136004822-136004844 GGGTGGGGGAGGGGCCTGGGAGG - Intergenic
1062464972 9:136676912-136676934 GGGTTGGGGTGGGGCCTGGGCGG - Intronic
1062476887 9:136732740-136732762 GGGTGGGGGGGAGAGCTTGGGGG - Intergenic
1062479037 9:136743038-136743060 GTCTGGGGGTGGTCCCTGGGCGG - Intronic
1062533055 9:137010171-137010193 GGTGGGGCGGGAGCCCTGGGTGG - Exonic
1062546209 9:137064814-137064836 GGGTGGGGGTGAGGCCCCGCAGG - Intronic
1062656024 9:137605068-137605090 GGGTGAGGGAGACCCCTGGGCGG + Intergenic
1062672776 9:137721365-137721387 GGGAGGGGGTGAGGCGTGGGAGG - Intronic
1062750556 9:138248880-138248902 GGGTGGGGGTGGGGCTAGGGAGG + Intergenic
1203530643 Un_GL000213v1:139447-139469 GGGTGTGGGTTTTCCCTGGGTGG - Intergenic
1185462212 X:338608-338630 GACTGCGGGAGAGCCCTGGGAGG - Exonic
1185750948 X:2609312-2609334 GGGTGGGGCGGAGCCCGCGGAGG - Intergenic
1187290950 X:17952643-17952665 GGTTGGGGGAGAACCCTGGAGGG + Intergenic
1188061092 X:25603143-25603165 GGGTCGGGGTGAGGCGGGGGAGG - Intergenic
1188202619 X:27309811-27309833 GGGTGGAGGTGGGAACTGGGGGG - Intergenic
1188308339 X:28586433-28586455 GGGTGGGGGTGGGGAGTGGGAGG - Intergenic
1188587309 X:31793201-31793223 GGGTGGGGTGGGGCCATGGGTGG + Intronic
1190279495 X:48919734-48919756 GGATGGGGGTGAGCCCAGAGTGG + Intergenic
1191030172 X:55961258-55961280 CTGTGGTGGTGAGGCCTGGGTGG - Intergenic
1191902214 X:66053293-66053315 GGGTGGGAGTGATGCCTGGAAGG + Intergenic
1192203785 X:69083006-69083028 TTGTTGGGCTGAGCCCTGGGGGG - Intergenic
1192233826 X:69283968-69283990 AGGTGAGGGTGGGGCCTGGGAGG - Intergenic
1193189151 X:78548868-78548890 GGGTAGGGGTTAGTTCTGGGAGG + Intergenic
1193704228 X:84801553-84801575 TGGTGGAGGTGAGGCCTGGTGGG + Intergenic
1194411763 X:93566120-93566142 GGGTGGGGGTGGGCGTTGGGCGG + Intergenic
1194774441 X:97944821-97944843 GGGTGGTGTGGAGCGCTGGGAGG - Intergenic
1195316578 X:103685597-103685619 GGGTGGGGGGGAGCAGTGGGTGG - Intronic
1195830647 X:109054548-109054570 GCGGGGGGGCGAGCCCTGAGGGG + Intergenic
1197340732 X:125263523-125263545 GGGCTGGGGTGGGCCATGGGAGG + Intergenic
1197952058 X:131908232-131908254 GGTTGGGGCGGAGCCCGGGGGGG + Intergenic
1197968761 X:132093429-132093451 GGGAGGGGGTGATGCCTGGCAGG - Intronic
1198074353 X:133180340-133180362 TGTTGGGGGTGAGACCTGGTGGG + Intergenic
1198169720 X:134093802-134093824 TGGTGGGGGTGGGTCCTGGCAGG - Intergenic
1198806948 X:140502869-140502891 GGGGCGGGGTGGGACCTGGGGGG - Intergenic
1199219928 X:145306134-145306156 GGGGTGGGGTGGGCCATGGGTGG + Intergenic
1199544680 X:148995475-148995497 GGGTGGGGGTGGGGGCGGGGGGG + Exonic
1199834294 X:151573229-151573251 GGTTGGGGGTGGGGCCTGGTAGG - Intronic
1200048999 X:153418571-153418593 GGGGCGGGGGGAGCCCTGGAAGG - Intronic
1200256503 X:154585602-154585624 GGGTGGGGGTGGGGGTTGGGAGG + Intronic
1200261266 X:154618801-154618823 GGGTGGGGGTGGGGGTTGGGAGG - Intronic