ID: 1143873821

View in Genome Browser
Species Human (GRCh38)
Location 17:9976685-9976707
Sequence CCTAAGGATGATCCCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143873810_1143873821 12 Left 1143873810 17:9976650-9976672 CCCCTTTAATCTAGGTTCCCTGA 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 54
1143873812_1143873821 10 Left 1143873812 17:9976652-9976674 CCTTTAATCTAGGTTCCCTGAGG 0: 1
1: 0
2: 0
3: 35
4: 966
Right 1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 54
1143873811_1143873821 11 Left 1143873811 17:9976651-9976673 CCCTTTAATCTAGGTTCCCTGAG 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 54
1143873817_1143873821 -6 Left 1143873817 17:9976668-9976690 CCTGAGGCTACTGGAGGCCTAAG 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 54
1143873816_1143873821 -5 Left 1143873816 17:9976667-9976689 CCCTGAGGCTACTGGAGGCCTAA 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143873821 Original CRISPR CCTAAGGATGATCCCTCAGT GGG Intronic
902700898 1:18171264-18171286 CCTAAGGATGAGTCTTCATTTGG - Intronic
908444094 1:64185175-64185197 CCTCAGGCAGATCCCTCAGGAGG - Intergenic
913124913 1:115777750-115777772 ACTAAGGAGGATTCCTCTGTTGG - Intergenic
915802011 1:158803690-158803712 CCCATGCATGATCCCTCAGAAGG + Intergenic
917115609 1:171600410-171600432 CCTAAGAAAAATCACTCAGTTGG + Intergenic
918033608 1:180843052-180843074 CCTAATGAGGATTCCTCAGTAGG + Intronic
1063209288 10:3864273-3864295 CCTAAGGATGAGACCTCATTTGG + Intergenic
1066070028 10:31798666-31798688 GCTAAGGATGCTCCCCCAGTTGG + Intergenic
1083485467 11:62980837-62980859 CCTAAGGATGATCCCTAGTGTGG + Intronic
1084279830 11:68080939-68080961 CCTATGGATGATACCCAAGTTGG - Intronic
1087389387 11:97514644-97514666 CCTCAGGATGATCACTGAGGGGG - Intergenic
1089490693 11:118881934-118881956 CCTAAGAATGATGCATCTGTTGG + Intergenic
1089821536 11:121231783-121231805 CCAAAGGCTGTTCCTTCAGTCGG + Intergenic
1091253371 11:134162931-134162953 CCTCAGGATCATCCATCAGATGG - Intronic
1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG + Intergenic
1091695306 12:2624316-2624338 CCCAAGGATGCTCCTTCACTGGG - Intronic
1103126248 12:118424937-118424959 GCGAAGGATGACCCCACAGTGGG - Intergenic
1104828233 12:131730267-131730289 CAGAGGGATGGTCCCTCAGTGGG - Intronic
1106292272 13:28374971-28374993 CCAATGCATGATCCCTCAGTTGG + Intronic
1108867989 13:54944617-54944639 CCTCAGGCAGATCCTTCAGTAGG - Intergenic
1118698262 14:68407034-68407056 CCTCAGGAAGATCCTTCAGGAGG - Intronic
1122741571 14:103874638-103874660 CCCAAGGTTGAACACTCAGTGGG + Intergenic
1124023050 15:25941276-25941298 CCTCAGCATGTTCCCTCATTTGG - Intergenic
1126645316 15:50869697-50869719 CCTCAGGATGATCACTGAGGGGG - Intergenic
1130742717 15:86618508-86618530 CCTAAGGATTCTCATTCAGTAGG - Intronic
1131983134 15:98015495-98015517 CCTAAAGGTGATCTCTCAGTAGG - Intergenic
1135449999 16:22549528-22549550 CCTAAAGATTCTCACTCAGTCGG - Intergenic
1143873821 17:9976685-9976707 CCTAAGGATGATCCCTCAGTGGG + Intronic
1144020704 17:11238912-11238934 GCTAAGGATGTTCCCTCTGCTGG + Intergenic
1147616378 17:41830988-41831010 CGTAAGGATGAGGCCTCTGTCGG - Intronic
1153015609 18:580230-580252 CCTAAGCAAGATCCCGCAGATGG + Intergenic
1153684204 18:7528995-7529017 CCTCAGGATGAGCCCTGAGAGGG + Intergenic
1154109711 18:11556282-11556304 CCTCAGGCAGATCCCTCAGGAGG - Intergenic
932587837 2:73043307-73043329 CCTCAGGAAGGGCCCTCAGTAGG + Intronic
947029848 2:225781854-225781876 CCTGAAAATCATCCCTCAGTTGG + Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
949892477 3:8743648-8743670 CCTGAGGATGAGGCCTCACTCGG - Intronic
952979506 3:38723469-38723491 CCTGAGGAAGATCCCTGAGCTGG - Exonic
970111938 4:12647383-12647405 CTTAAGGCTGCTCCCTCAGTGGG - Intergenic
975725065 4:77283897-77283919 TCTCAGAATGATCCCTCAGGTGG - Intronic
980434859 4:132757763-132757785 CATAAAGATGATCCCTGAATTGG - Intergenic
980991987 4:139746107-139746129 CCTAAGCATAAGCTCTCAGTTGG + Intronic
992837613 5:80655625-80655647 CCCAAGGGTGACCCCTCACTTGG + Intronic
993369624 5:87076441-87076463 CCTCAGGCTGATCCTTCAGAAGG + Intergenic
1000338561 5:160259963-160259985 CCTAGCCATGATCCCCCAGTGGG - Intronic
1005348653 6:24913331-24913353 CCTAAGGAAGCTCCCTCAAGGGG - Intronic
1006175215 6:32117337-32117359 CCGGAGGAAGATCCCTCAGAGGG - Exonic
1018139178 6:160810403-160810425 CGTGAGGATGATGACTCAGTTGG + Intergenic
1024949714 7:54847246-54847268 CCTCAGGCTGATCCCTCAGGAGG - Intergenic
1029289810 7:99493706-99493728 CCTATGGATGTTCCGTCTGTGGG - Exonic
1030810223 7:113962660-113962682 TCCAAAGATGATCCCTCAGTTGG + Intronic
1032507017 7:132443174-132443196 GCAAAGGAACATCCCTCAGTTGG - Intronic
1041141228 8:54821340-54821362 GCTAAGGATAATCCCACAGGTGG + Intergenic
1044430160 8:92099048-92099070 CCTAAGTATTATCTGTCAGTGGG - Intronic
1048282328 8:133114557-133114579 CCTTAGGATGAGACCACAGTGGG + Intronic
1050119228 9:2291218-2291240 CCCAAGAATGATCCAGCAGTGGG - Intergenic
1053846059 9:42238105-42238127 CCTAAGGATGATATTTCAATTGG + Intergenic
1057051228 9:91925660-91925682 CCTATGGATTATCCATCTGTTGG - Intronic
1058641083 9:107086081-107086103 CCTAAGGCTGAGCCCTCAGCAGG - Intergenic
1186925617 X:14330306-14330328 CCTAAGGGTGATCACATAGTGGG + Intergenic
1189987846 X:46569949-46569971 CCTAAGGAAAATGTCTCAGTGGG + Intergenic
1192150327 X:68708287-68708309 CCCAAAGATGATCACTAAGTTGG - Intronic
1198863542 X:141096281-141096303 CCTCAGGTAGATCCCTCAGGTGG + Intergenic
1198899147 X:141491106-141491128 CCTCAGGTAGATCCCTCAGGTGG - Intergenic