ID: 1143874122

View in Genome Browser
Species Human (GRCh38)
Location 17:9979062-9979084
Sequence TAGGCAAAACCACCCAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143874113_1143874122 28 Left 1143874113 17:9979011-9979033 CCCGGTGCTGGCAGTCAAAAATA 0: 1
1: 0
2: 0
3: 5
4: 172
Right 1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1143874112_1143874122 29 Left 1143874112 17:9979010-9979032 CCCCGGTGCTGGCAGTCAAAAAT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1143874118_1143874122 -8 Left 1143874118 17:9979047-9979069 CCGAATGTCCCCTGGTAGGCAAA 0: 4
1: 24
2: 125
3: 379
4: 762
Right 1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1143874111_1143874122 30 Left 1143874111 17:9979009-9979031 CCCCCGGTGCTGGCAGTCAAAAA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1143874115_1143874122 2 Left 1143874115 17:9979037-9979059 CCAGACATTGCCGAATGTCCCCT 0: 2
1: 161
2: 551
3: 1094
4: 1406
Right 1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1143874114_1143874122 27 Left 1143874114 17:9979012-9979034 CCGGTGCTGGCAGTCAAAAATAT 0: 1
1: 0
2: 2
3: 21
4: 197
Right 1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143874122 Original CRISPR TAGGCAAAACCACCCAAAAG AGG Intronic
905940853 1:41862114-41862136 AAGGCCAGACCACCCAAAGGTGG + Intronic
907054144 1:51349458-51349480 TATGCAAAGTCACCCCAAAGAGG + Intergenic
907603363 1:55792113-55792135 AAGGCAAATCTGCCCAAAAGGGG - Intergenic
907841058 1:58158012-58158034 TAGGGAAAACAGCCCACAAGGGG + Intronic
912078373 1:105907187-105907209 TCTACAAAACCAGCCAAAAGTGG + Intergenic
912285318 1:108363431-108363453 TAGATAAAACCACCAAGAAGGGG - Intergenic
914762928 1:150613463-150613485 TAGGCAAAACTGCCCCACAGAGG + Intronic
916330762 1:163613927-163613949 TAGACAAAGACACCCAATAGTGG - Intergenic
921462513 1:215445301-215445323 TGGGCAAGACCACCCTACAGAGG + Intergenic
921642673 1:217574346-217574368 AACTCAAAACTACCCAAAAGAGG + Intronic
924095344 1:240545255-240545277 TCCGCAAAACCCCCCAAAAGGGG + Intronic
1064757928 10:18588481-18588503 TAGGAGAGACCACCCAACAGGGG + Intronic
1066093898 10:32055311-32055333 AAGGAAAAAGCACCAAAAAGAGG - Intronic
1066690674 10:38024686-38024708 AAAGCAAAACCACAGAAAAGGGG - Intronic
1067002065 10:42624915-42624937 AAAGCAAAACCACAGAAAAGGGG + Intronic
1067973855 10:51001719-51001741 TAGGAAAAACAACAAAAAAGAGG + Intronic
1069497550 10:68919467-68919489 TAGGCAAAACCAATCAATTGTGG - Intronic
1072344629 10:94491516-94491538 TAAGCAAAACCGCCAATAAGGGG - Intronic
1072394229 10:95022594-95022616 TAGGTAAAACCACAAAGAAGGGG - Intergenic
1073354044 10:102839749-102839771 AAGGCAATTCCACCCAAATGTGG - Intergenic
1073608384 10:104918852-104918874 TAGGAAAATCCTCACAAAAGTGG - Intronic
1076468466 10:130702187-130702209 TAACCAAATTCACCCAAAAGAGG + Intergenic
1077428232 11:2498109-2498131 CAGGCAAGACCTCCCAACAGGGG - Intronic
1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG + Intergenic
1080107042 11:28521650-28521672 TAAGCAAACCCAACCAGAAGTGG - Intergenic
1083353402 11:62047291-62047313 AGGGCAAAGCCAACCAAAAGGGG + Intergenic
1086800551 11:91169661-91169683 TAGGTGAGACCTCCCAAAAGGGG + Intergenic
1090442457 11:126735727-126735749 TAGGCAGAACCAAACCAAAGAGG + Intronic
1090583575 11:128185860-128185882 TAGGCAACATCACATAAAAGTGG - Intergenic
1094170672 12:27488403-27488425 TAAGAAAAATCACCCAAGAGAGG - Intronic
1096622960 12:52875839-52875861 CAGTCAGAACCACCAAAAAGAGG + Intergenic
1097270206 12:57769410-57769432 TAGGCAAAATCACCCTAGACAGG + Intronic
1097737445 12:63197268-63197290 AAGGAAAAACCACCTAAAAAAGG + Intergenic
1099334458 12:81335857-81335879 TAGGGAAACCCACCTAACAGAGG - Intronic
1100664434 12:96736086-96736108 TAAGCCAAATCAGCCAAAAGGGG + Intronic
1102286729 12:111663708-111663730 TAGACCAAACCACCCCAAAGAGG + Intronic
1107088965 13:36455359-36455381 TAGACAAAACCCCCCGAAAAAGG - Intergenic
1110473678 13:75888652-75888674 TAGTCAAAACCAAACAGAAGAGG + Intergenic
1110698333 13:78518333-78518355 TAGACAAAACCACAAAACAGAGG - Intergenic
1112463481 13:99623043-99623065 TAGTCACAATCACCAAAAAGTGG - Intronic
1114152166 14:20054559-20054581 GAGGCAGAACCACCCCCAAGAGG - Intergenic
1118452071 14:65912207-65912229 TAGGGAAAGCAGCCCAAAAGAGG + Intergenic
1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG + Intronic
1120059147 14:79961301-79961323 TAGGTAAACACACCAAAAAGTGG - Intergenic
1123721551 15:23065759-23065781 GAGGGAAAACCACCCAAAATTGG - Intergenic
1126421331 15:48476284-48476306 TAGGCAAAACTCCACAAAAATGG - Intronic
1128848133 15:70919869-70919891 GGGGCAAAACTACACAAAAGGGG + Intronic
1129554455 15:76491346-76491368 TATGCATAATCACCCAAAACTGG - Intronic
1131773874 15:95772652-95772674 TAGGAATAAAAACCCAAAAGGGG + Intergenic
1133337772 16:5017280-5017302 TAGGGAAAACCAGCCCAAACTGG + Exonic
1133896723 16:9936529-9936551 CAGGCAAAACCATGCAAAATTGG + Intronic
1133933583 16:10251618-10251640 TAGACAGAAGCACCAAAAAGGGG + Intergenic
1134359965 16:13522192-13522214 AAGTCAAAACCAAACAAAAGGGG - Intergenic
1139244245 16:65425858-65425880 TATGCAAAACCAGGTAAAAGGGG + Intergenic
1140357660 16:74319959-74319981 TAGGGAAAGCAACTCAAAAGAGG - Intergenic
1143047307 17:4092219-4092241 TAGGTAAAACTACCAAAAAGAGG + Intronic
1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG + Intronic
1144716596 17:17440498-17440520 TGGGGAAAACCAACCAAAAAGGG + Intergenic
1146611461 17:34309055-34309077 TAGGCAAAACTAACCTATAGTGG - Intergenic
1151729000 17:75899988-75900010 GAGGGAAAAGCAGCCAAAAGTGG - Intronic
1152954762 18:28788-28810 TGGGCAAGACCTCCCAACAGGGG + Intergenic
1156573945 18:38291278-38291300 TGGGGAAAACCACCCCACAGTGG - Intergenic
1159136041 18:64337937-64337959 AAGACAAAACAACCCACAAGTGG + Intergenic
1160414823 18:78701322-78701344 TAGACAAAACCCCCCAAATATGG - Intergenic
1161510256 19:4666610-4666632 GTGGGAAAACCACCCAGAAGTGG - Intronic
1164062854 19:21690525-21690547 TAGGCAGAAACAAACAAAAGAGG + Intergenic
1164088763 19:21929099-21929121 TATGCAAACCCAGCCAACAGGGG + Intergenic
1164391053 19:27821852-27821874 TAGGTGAGACCTCCCAAAAGGGG - Intergenic
925106794 2:1298798-1298820 TAGGCAAACCCACCCTTAATTGG + Intronic
929725144 2:44417478-44417500 TATGCAAAACAGCCCAAAACCGG - Intronic
930856548 2:56025116-56025138 TAACCAAAACCACCTTAAAGGGG - Intergenic
931103186 2:59025390-59025412 GAGGGAAGTCCACCCAAAAGAGG - Intergenic
933430130 2:82165836-82165858 TTTTCAAAACCTCCCAAAAGGGG - Intergenic
937513664 2:122628338-122628360 TAGGCAAACAGACCAAAAAGAGG - Intergenic
937705484 2:124915648-124915670 TAGGCTTAAACTCCCAAAAGAGG + Intergenic
937913351 2:127087025-127087047 AAGGGAAAATCACCAAAAAGAGG - Intronic
938568033 2:132538487-132538509 TGGGAAAGACCTCCCAAAAGGGG - Intronic
938822484 2:134973748-134973770 TAGAGGAAACCACACAAAAGAGG - Intronic
939810794 2:146829840-146829862 GAGGCAACCCCAGCCAAAAGAGG - Intergenic
941048324 2:160701969-160701991 TAGCCAAAGCCACACAAAATTGG + Intergenic
942673964 2:178407023-178407045 TAGAGAAGACCACCCAAATGAGG + Intergenic
945705827 2:213230182-213230204 AAAGCAAAACCACCAAGAAGGGG + Intergenic
945990709 2:216393221-216393243 TGGGCAAAACCAATCAACAGGGG - Intergenic
947259892 2:228209172-228209194 TAGACATAACCACCCAAGATAGG + Intergenic
948132906 2:235614022-235614044 TTGGCCAAAACACACAAAAGGGG - Intronic
1171805994 20:29680722-29680744 TAGGCAAAACCCTACAATAGTGG - Intergenic
1171838068 20:30175712-30175734 TAGGCAAAACCCTGCAATAGTGG + Intergenic
1175720165 20:61280931-61280953 AAAGCAAAGCCACCCTAAAGAGG - Intronic
1176843166 21:13856538-13856560 CAGGCAAAAGCACCCCAAAAAGG - Intergenic
1176957586 21:15124085-15124107 TTAGCCAAACCACCCCAAAGTGG + Intergenic
1177137752 21:17324385-17324407 TAGCCAAAGCCACCCTAAGGGGG + Intergenic
1177331861 21:19675045-19675067 TAGGAAAAAACTCACAAAAGTGG - Intergenic
1179770056 21:43608454-43608476 TTGGCAAAACCACTGAAAAAAGG + Intronic
1180855050 22:19040375-19040397 TAGGCAGTGCCACCCCAAAGTGG - Intronic
949603185 3:5623709-5623731 TATTCATAACCACCCAAAACTGG - Intergenic
950226449 3:11238940-11238962 TATTCATAACCACCAAAAAGTGG - Intronic
950520179 3:13493385-13493407 TAGGAGAAACCACCCATCAGTGG - Intronic
950554985 3:13689945-13689967 TAGTTACAATCACCCAAAAGTGG + Intergenic
953820463 3:46203680-46203702 AAGGCAATACCAGCCCAAAGAGG + Exonic
954763403 3:52894060-52894082 TAGACAAAACCACCAAAACGAGG + Intronic
956157221 3:66311591-66311613 GAGGAAAAACCACCAAAAAAAGG - Intronic
958098329 3:88975630-88975652 TAACCAAAAACATCCAAAAGAGG + Intergenic
963756064 3:149235907-149235929 TGGGCAAGACCTCCCAACAGGGG + Intergenic
963822013 3:149907859-149907881 TTAGCAAAAGCACCTAAAAGTGG + Intronic
964023236 3:152040659-152040681 AAGACAAAACACCCCAAAAGGGG + Intergenic
965890503 3:173508090-173508112 TAGACAAAAGAACCCTAAAGTGG - Intronic
968358960 3:198133351-198133373 TGGGCAAGACCTCCCAACAGGGG - Intergenic
972481918 4:39504864-39504886 AAAGCAAAACCACACATAAGGGG + Intronic
973723973 4:53753990-53754012 TAGGTAAAACCACCCAAACATGG + Intronic
976495490 4:85725178-85725200 TAGGCAAAACAAGACAAAGGAGG + Intronic
977875773 4:102148463-102148485 TAAACACAACCACCAAAAAGGGG + Intergenic
982289324 4:153764089-153764111 TAGGAATAATCACCCAAGAGGGG + Intergenic
982711964 4:158767280-158767302 TAGACAAGATCATCCAAAAGAGG - Intergenic
984643428 4:182196057-182196079 TAGGGAAAAACAGCCCAAAGAGG - Intronic
985101577 4:186463516-186463538 TAGGCCAAACAAAGCAAAAGAGG + Intronic
987357081 5:17073163-17073185 TATTCAAAATAACCCAAAAGTGG - Intronic
989312775 5:40039713-40039735 TAGGCACATCTACCCAACAGGGG - Intergenic
989616527 5:43341780-43341802 TAGACAAAACCACGAAAATGGGG + Intergenic
990258750 5:53998850-53998872 AGGGCAACACCAACCAAAAGAGG + Intronic
991808784 5:70457290-70457312 TTTGCTAAACCACCAAAAAGAGG + Intergenic
991862600 5:71025706-71025728 TTTGCTAAACCACCAAAAAGAGG - Intergenic
994277375 5:97855230-97855252 TAGGCAAAACCTCCCAACTGTGG + Intergenic
994800743 5:104371463-104371485 TAGGCAAAACAAAGAAAAAGTGG + Intergenic
995478327 5:112570221-112570243 TGGGCAATACCACGCAATAGGGG + Intergenic
995868962 5:116724436-116724458 GAGGCAAAGCCACACAAAGGAGG + Intergenic
998228213 5:140342979-140343001 TGGGCAGAACCACCAGAAAGAGG + Intronic
1003845182 6:10166484-10166506 TAGGCAAAGCCACAAAGAAGGGG - Intronic
1005683715 6:28231820-28231842 AAGGCAAAACCACAGATAAGTGG + Intronic
1005830893 6:29670415-29670437 CAGGCAAGACCACCAAATAGTGG + Intronic
1007880170 6:45155892-45155914 TAGGCCAATCTACCCAAAAATGG + Intronic
1008625057 6:53307244-53307266 TAACCACTACCACCCAAAAGTGG - Intronic
1008931851 6:56948619-56948641 AAAGCAAAACCACACAGAAGAGG + Intronic
1009687157 6:66976805-66976827 AAGGAAAAACCTGCCAAAAGTGG + Intergenic
1014778525 6:125537523-125537545 AAGGCAAAACCACCCCATAAAGG - Intergenic
1016812571 6:148275403-148275425 TAGGCAAAAGAAACCACAAGTGG - Intronic
1016869949 6:148807110-148807132 AAGGAAAAATCCCCCAAAAGAGG + Intronic
1019859869 7:3647722-3647744 TGGTCAAAACCACCTAAAACTGG - Intronic
1021734439 7:23629001-23629023 TAGAGAAAACCACCTAAAACAGG + Intronic
1022358576 7:29638762-29638784 TAGGCAGAAACAAACAAAAGAGG + Intergenic
1023022835 7:36026277-36026299 TATTCAAAAAAACCCAAAAGTGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1027626524 7:80551616-80551638 TAGGCAAAACCCCACAAATCAGG + Intronic
1030076084 7:105738045-105738067 TAACCACAACCACCTAAAAGGGG + Intronic
1031485614 7:122319912-122319934 TAGGTCAAACTACACAAAAGAGG + Intronic
1033868182 7:145718176-145718198 TGGGTGAGACCACCCAAAAGGGG - Intergenic
1034070088 7:148176138-148176160 TAGTCAAAACCACACAAGAAGGG + Intronic
1037397119 8:18454774-18454796 TAGGCAAAATCATGCAATAGTGG - Intergenic
1038389363 8:27180646-27180668 AAGGAGAAACCACCCAAAAGAGG + Intergenic
1043253588 8:78106032-78106054 TGGGAGAAACCTCCCAAAAGGGG - Intergenic
1043634020 8:82368294-82368316 TTGGGAAAAACATCCAAAAGGGG + Intergenic
1044165891 8:88983455-88983477 TAGGCAAAATAACCAAAAAGAGG + Intergenic
1046696931 8:117351572-117351594 TAGGCCATACAACTCAAAAGTGG + Intergenic
1047587838 8:126293607-126293629 TAAGCAAAACAACTAAAAAGAGG - Intergenic
1048557906 8:135498966-135498988 TAAGCAAAACCACTCTAAAATGG - Intronic
1054727672 9:68668173-68668195 TAGCCAAAACCAAAAAAAAGGGG + Intergenic
1054829884 9:69611989-69612011 TTAGCAAAACCAGACAAAAGTGG - Intronic
1056688466 9:88785848-88785870 GAGGCAAAACCACTCAGATGTGG - Intergenic
1059202861 9:112434218-112434240 AAATCAAATCCACCCAAAAGTGG - Intronic
1059639754 9:116205084-116205106 TAGGGGAACCCACCCAAAGGGGG - Intronic
1060164482 9:121398704-121398726 TAGGCAACACAAACCACAAGTGG - Intergenic
1062743094 9:138192484-138192506 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1062743343 9:138194485-138194507 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1062743592 9:138196486-138196508 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1185927589 X:4164513-4164535 TATGCAAATTCACCTAAAAGAGG + Intergenic
1188760242 X:34018917-34018939 AAGGCAAAACCACTGATAAGGGG + Intergenic
1189943535 X:46153055-46153077 TAGTCAATACCATCCAACAGGGG + Intergenic
1192850336 X:74949202-74949224 AAGGCAAATTCACCCCAAAGAGG + Intergenic
1192988073 X:76421711-76421733 TAACAAAAACCACCCAAATGTGG - Intergenic
1193597774 X:83468812-83468834 TTACCAAAACTACCCAAAAGAGG + Intergenic
1195774033 X:108383505-108383527 AATGCAAAAACACCCAAAACAGG - Intronic
1197058453 X:122148431-122148453 TAGGCATACCCATCCCAAAGTGG - Intergenic
1198445900 X:136714174-136714196 TAGGCAAAACAACCAATATGGGG + Intronic
1199478780 X:148274461-148274483 TGGGCAAGACCTCCCAAAGGGGG + Intergenic
1201670529 Y:16515546-16515568 TAGACAAAACCACAAAGAAGGGG - Intergenic
1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG + Intergenic
1201844803 Y:18411528-18411550 TGGGCAAGACCTCCCAAAAGGGG - Intergenic