ID: 1143877980

View in Genome Browser
Species Human (GRCh38)
Location 17:10007314-10007336
Sequence TAACCAAGACGTCTAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143877973_1143877980 30 Left 1143877973 17:10007261-10007283 CCGAGGTATTTCTGACACCCACC 0: 1
1: 0
2: 2
3: 20
4: 146
Right 1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 80
1143877977_1143877980 9 Left 1143877977 17:10007282-10007304 CCAAAGTTTGGCAATCAGACAGA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 80
1143877975_1143877980 13 Left 1143877975 17:10007278-10007300 CCCACCAAAGTTTGGCAATCAGA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 80
1143877976_1143877980 12 Left 1143877976 17:10007279-10007301 CCACCAAAGTTTGGCAATCAGAC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143877980 Original CRISPR TAACCAAGACGTCTAAAGAA TGG Intronic
911562644 1:99425279-99425301 TAACCAAGACTTCTTGAAAATGG + Intergenic
916971970 1:170030208-170030230 TATCCAAAACATATAAAGAATGG + Intronic
923009390 1:230076038-230076060 TGACCAAGATGTCTACAGCATGG - Intronic
1063598378 10:7458128-7458150 TAACAAATACGTCTAAAGGCTGG - Intergenic
1066562592 10:36686455-36686477 TAACCAAGAAGTCAAAGGTATGG - Intergenic
1072525167 10:96264818-96264840 TAACCAAGAAGATTAAAGGATGG + Intronic
1074440884 10:113476622-113476644 CAACCAGGACTTCTAAAGATTGG - Intergenic
1075247361 10:120835013-120835035 TCCCCAGGAGGTCTAAAGAAGGG + Intergenic
1078382894 11:10859925-10859947 TAAACAAGATGTGTAAAGATTGG - Intergenic
1079542002 11:21587797-21587819 GAACCAAGACATCTACAGAGCGG + Intergenic
1079965343 11:26973118-26973140 TAACAAAGACTTTCAAAGAAAGG + Intergenic
1080212551 11:29803728-29803750 AAACCAAGAACTCTATAGAATGG + Intergenic
1081001991 11:37685846-37685868 TAACCAAAATGTATAAAGAACGG + Intergenic
1082052185 11:47780310-47780332 TACACAAGACGTCTCATGAAAGG + Intronic
1082803785 11:57433552-57433574 TAACAGAGATGTCCAAAGAATGG - Intergenic
1093301301 12:17460509-17460531 TAACCCAGAATACTAAAGAAAGG + Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1098075754 12:66728917-66728939 TAACCAATACCAATAAAGAAAGG - Intronic
1100782550 12:98044752-98044774 TAACAAAAATATCTAAAGAATGG - Intergenic
1100788079 12:98100192-98100214 TCACCAAGAAGACTAATGAAAGG + Intergenic
1101685106 12:107011421-107011443 TAGCCAAGATGTCTAAACAAAGG + Intronic
1129305461 15:74657833-74657855 TAACCGAAAGGTCTAAAGAAAGG - Intronic
1131776924 15:95812711-95812733 GATCCAAGACTTCTAAACAAAGG - Intergenic
1135997420 16:27261742-27261764 TAACAAGGATGTCAAAAGAAAGG + Intronic
1141690543 16:85594030-85594052 TAACCAAGCCGGGTAATGAATGG - Intergenic
1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG + Intronic
1144621571 17:16821834-16821856 CATCCAAGACCTCGAAAGAAGGG + Intergenic
1144884846 17:18450880-18450902 CATCCAAGACCTCGAAAGAAGGG - Intergenic
1145147378 17:20493497-20493519 CATCCAAGACCTCGAAAGAAGGG + Intergenic
1147573550 17:41586173-41586195 CATCCAAGACCTCGAAAGAAGGG + Intronic
1149395095 17:56232180-56232202 AAACCAAGTCGTGTGAAGAATGG - Intronic
1149444715 17:56704795-56704817 AAACCACGACGTCATAAGAATGG + Intergenic
1149856999 17:60091484-60091506 TAATTAAGACTTCTAAAGAATGG + Intergenic
1150171097 17:62995681-62995703 TAACAAAGAAGTCTTGAGAAAGG - Intergenic
1158797787 18:60868989-60869011 TGACCAAGAGATTTAAAGAAGGG + Intergenic
1159443582 18:68511990-68512012 TAACTATGACATGTAAAGAAAGG - Intergenic
928489895 2:31771149-31771171 CAACAAAGACATTTAAAGAAAGG + Intergenic
928948486 2:36792842-36792864 TAAATAAGAAGTCTAGAGAAGGG - Intronic
930270371 2:49249387-49249409 TAAACAAGACATTGAAAGAATGG - Intergenic
939054116 2:137342205-137342227 TAACCAAGAAGGTGAAAGAACGG - Intronic
939591480 2:144068902-144068924 GAGCCAAGAAGTCTCAAGAATGG + Intronic
941185317 2:162315122-162315144 TAATCAAGACTTCTATAAAATGG - Intronic
941405965 2:165089005-165089027 TAACCAAGACTTGTGAAGAATGG + Exonic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169070060 20:2720436-2720458 AACCCAAGTCATCTAAAGAAAGG - Intronic
1169587635 20:7103946-7103968 TCACCAAGAGGACTACAGAAAGG - Intergenic
1175005694 20:55679792-55679814 TAAGCAAGACAGGTAAAGAAGGG + Intergenic
1175099945 20:56571958-56571980 TAAGCAATACGGCTCAAGAAAGG - Intergenic
1179464136 21:41560542-41560564 TAACCCAGCTGTCTAAACAAGGG + Intergenic
953200654 3:40775853-40775875 AAACCAAGATGTTTATAGAAGGG + Intergenic
956628639 3:71292012-71292034 TACCCAAGACTTTTAAAAAATGG - Intronic
957350050 3:79012932-79012954 TAATCAAGAATTGTAAAGAATGG + Intronic
957710676 3:83855010-83855032 TAACCAAGAGTTTTAAATAAAGG - Intergenic
958575479 3:95945117-95945139 TAAACAAGACCTCAAAAGCATGG - Intergenic
967441470 3:189514009-189514031 AAACCAAGAAGTTTAAAGATAGG + Intergenic
977096624 4:92753703-92753725 AAACCAGGACCTCTAAAGAAGGG + Intronic
977859781 4:101943037-101943059 TAGCCAAGAGGAGTAAAGAATGG + Intronic
979098774 4:116588327-116588349 TAATCAACACTACTAAAGAATGG - Intergenic
980696913 4:136369264-136369286 CAACCATGACTTCTATAGAAAGG + Intergenic
983352105 4:166602889-166602911 TAACCGGGAAGGCTAAAGAAAGG + Intergenic
989120775 5:38002450-38002472 TAAGAAAGACGTCTATAAAAAGG + Intergenic
989729112 5:44626475-44626497 TAAGCAAGAGGTCAAGAGAAGGG + Intergenic
995927816 5:117396195-117396217 TAACCAAGCCGCGTACAGAAAGG - Intergenic
996880147 5:128287829-128287851 CAACCAAGTCTGCTAAAGAAAGG + Intronic
999932111 5:156444693-156444715 TAACCATAATGTCTAAAGAAAGG - Intronic
1000417392 5:160997333-160997355 TAAACAGGAAGTCTACAGAATGG - Intergenic
1002986561 6:2194794-2194816 TAACCAAGAGTTTTAAACAATGG - Intronic
1003654796 6:7996673-7996695 AAACCAGAACGTCCAAAGAAAGG - Intronic
1003766913 6:9248031-9248053 TAATCAAGTCCTCTAAGGAATGG - Intergenic
1009465778 6:63967140-63967162 TAACCAAGATGTCTACTGACTGG + Intronic
1009815388 6:68726597-68726619 TAACCAAGCCCTCCAAATAAAGG - Intronic
1010452332 6:76016945-76016967 TAAGCAAGCAGTCTCAAGAAAGG + Intronic
1012611358 6:101224509-101224531 TAACCAAGACCTCTAATCCATGG - Intergenic
1014323072 6:119956427-119956449 TAATGAAGAAGTCTAAAGATAGG - Intergenic
1020489750 7:8766698-8766720 TAACCAAGAACTCAAAACAATGG + Intergenic
1031263403 7:119551278-119551300 AAACCTAGAAGTTTAAAGAAGGG - Intergenic
1037174229 8:15928460-15928482 AAACCAAGTATTCTAAAGAAAGG + Intergenic
1041967531 8:63697120-63697142 CTACCAAGAAGTCTAAAGACAGG - Intergenic
1046113545 8:109756217-109756239 TAATCAAGAACTTTAAAGAAAGG - Intergenic
1047939300 8:129813462-129813484 CAACCAAGAAGTACAAAGAAGGG - Intergenic
1047990141 8:130277623-130277645 GCACCAAGAAGTCTAAAGAGTGG + Intronic
1048488758 8:134872200-134872222 GAACACAGATGTCTAAAGAAGGG - Intergenic
1050839135 9:10124557-10124579 TAAGAAAGAGGTCTAAGGAAGGG - Intronic
1053093454 9:35301994-35302016 TGACCAAGACTTCTAAAAAATGG - Intronic
1059857418 9:118415273-118415295 TAACCAAGACACGTAAACAAGGG - Intergenic
1186467863 X:9797878-9797900 TAACCAAGGCAGTTAAAGAAAGG - Intronic
1191955089 X:66635523-66635545 TCAAGAAGACATCTAAAGAAAGG + Intronic
1194616815 X:96114570-96114592 TAGCCAAGAGGTATAAAAAAAGG + Intergenic
1200894168 Y:8356975-8356997 TCACCAAGACCACTATAGAAAGG + Intergenic