ID: 1143879641

View in Genome Browser
Species Human (GRCh38)
Location 17:10020054-10020076
Sequence TCATGCTCACGCAACCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143879641_1143879644 19 Left 1143879641 17:10020054-10020076 CCTCCGGGGTTGCGTGAGCATGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1143879644 17:10020096-10020118 CATTCAGAGCCCCTGCACAGAGG 0: 1
1: 0
2: 0
3: 14
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143879641 Original CRISPR TCATGCTCACGCAACCCCGG AGG (reversed) Intronic
911238390 1:95437196-95437218 TCATGCCCACCCATCCCCTGTGG - Intergenic
915826180 1:159079667-159079689 TCATGCTCAGTCCACCCTGGTGG - Intronic
1069579103 10:69553085-69553107 TCATGCTCACGCAATAGCTGTGG - Intergenic
1072286766 10:93923576-93923598 GCATGCTCTCACAGCCCCGGGGG + Intronic
1073884189 10:108019482-108019504 TCAAGCTCAAGCATCCCAGGTGG - Intergenic
1089302060 11:117504741-117504763 TCATCCTCAGCCACCCCCGGGGG - Intronic
1089467336 11:118693768-118693790 TCAGGTACACGCAACCCCGAGGG - Intergenic
1094845855 12:34361115-34361137 TCATGCTCATGGAGCCCCGTGGG - Intergenic
1095094509 12:38138541-38138563 TAATGTTCACGCATGCCCGGTGG + Intergenic
1096413603 12:51394066-51394088 TCAGGATCACACAACCCCTGAGG - Intronic
1109600445 13:64619948-64619970 TCATTCTCAGGCAACCCCTCAGG - Intergenic
1130389215 15:83440274-83440296 TCATGCACAAGTAACCCAGGAGG + Intergenic
1132148159 15:99440771-99440793 TCAGGCTCAGGCAGCCGCGGCGG + Intergenic
1132789986 16:1680386-1680408 TCATACTCACACTACCCTGGGGG + Intronic
1138649217 16:58449060-58449082 TCATGCTCACACAAGCCCGATGG - Intergenic
1143879641 17:10020054-10020076 TCATGCTCACGCAACCCCGGAGG - Intronic
1149571567 17:57675910-57675932 TCATGCTCACACACACCGGGAGG - Intronic
1151405391 17:73882810-73882832 CCGTGCTCACGCACCCTCGGGGG + Intergenic
1157756968 18:50227367-50227389 TGATGCTCACGGAACTACGGTGG + Exonic
1160619737 18:80162431-80162453 ACATGCACACCCAGCCCCGGTGG - Intronic
1166465556 19:43027709-43027731 GCCTGCTCACTGAACCCCGGAGG - Intronic
1166546695 19:43638607-43638629 TCAGGGTCACCCAACCTCGGGGG + Intronic
1168581486 19:57559247-57559269 TCAAGCTTCCTCAACCCCGGGGG + Intronic
934746250 2:96761413-96761435 TCATGCTCTCGCTCCTCCGGAGG - Exonic
947544029 2:230998185-230998207 TTATGCCCACACAATCCCGGGGG - Intronic
1173192078 20:40884425-40884447 TGATGTTCACCCAACCCTGGGGG - Intergenic
1179568783 21:42265638-42265660 TCATCCTCTCACAGCCCCGGAGG - Intronic
1181360407 22:22329932-22329954 TCAGGCTGAAGCAACCCCTGGGG - Intergenic
951552602 3:23889626-23889648 ACATGCTCACTGAACCCCAGAGG - Intronic
957639102 3:82827169-82827191 TCATTCTCACTCAACCTAGGCGG - Intergenic
971329803 4:25673163-25673185 TCATGATCAGGCAACCACAGAGG - Exonic
981801776 4:148666263-148666285 TCATGCTCCCGGAACCCTGTAGG + Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
1001057959 5:168464903-168464925 TCGTCCTCACGCAACCACTGTGG - Exonic
1025231011 7:57203347-57203369 TCAGGCGCACGGAAGCCCGGCGG - Intergenic
1039389708 8:37168272-37168294 TCATGCTCAGGCCTCCCAGGTGG - Intergenic
1044805758 8:96006419-96006441 CCATGGTGACGCAACCGCGGTGG - Intergenic
1054762075 9:69012888-69012910 TCCTGCTCCCCCAACCCTGGAGG + Exonic
1059424371 9:114211445-114211467 TCATGCACACGCAAAGCCAGAGG + Intronic
1193398572 X:81014458-81014480 TCAAGCTCAAGCATCCCAGGTGG - Intergenic