ID: 1143879656

View in Genome Browser
Species Human (GRCh38)
Location 17:10020182-10020204
Sequence GCCCCCTAGAAAATCACTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143879653_1143879656 10 Left 1143879653 17:10020149-10020171 CCATTCAGCTAATGGAGCTAGAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1143879656 17:10020182-10020204 GCCCCCTAGAAAATCACTCACGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143879656 Original CRISPR GCCCCCTAGAAAATCACTCA CGG Intronic
900778682 1:4602965-4602987 GCCATCTAGAAAATCATTCTCGG - Intergenic
904258820 1:29275298-29275320 GACCCCTAGAACATCAAACAGGG - Intronic
904378019 1:30093980-30094002 ACCCCCTAGAACCTCACTCATGG - Intergenic
907654200 1:56325596-56325618 GTGGCCTAGAAATTCACTCAAGG - Intergenic
913475858 1:119236983-119237005 TCTCCCTAGAGAATCACTCATGG - Intergenic
917516121 1:175710146-175710168 AGCCCCTGGAAGATCACTCAGGG + Intronic
920448108 1:206035431-206035453 GCACCCTAGAAAACCATTCAAGG - Intergenic
1062771895 10:107951-107973 GACCCCTAGGGAATCACTCCAGG - Intergenic
1065443068 10:25771965-25771987 GCCCCCTAGACCATCACGGATGG - Intergenic
1067349890 10:45466129-45466151 GCCCCAGAGACAAGCACTCAAGG + Intronic
1072385699 10:94925247-94925269 GCCCACAAGAAAATCACTTGTGG - Intergenic
1077132143 11:978370-978392 GCCACCCTGAAAAGCACTCAGGG - Intronic
1077883185 11:6366950-6366972 GCCCCCTAGAAAAGCAGAGAAGG - Intergenic
1084441362 11:69175651-69175673 GTCCCCCAGAAGATCACTGATGG - Intergenic
1090950870 11:131472160-131472182 GCCACACAGTAAATCACTCAAGG - Intronic
1092145826 12:6213992-6214014 TCCCCCAAGAAAATTTCTCAGGG + Intronic
1092873387 12:12827059-12827081 GCCCATTAGAAAATCACTCAAGG - Intronic
1094316281 12:29139821-29139843 GCCCCCTAGAAAAGCAGAGAAGG + Intergenic
1094421549 12:30276819-30276841 GCAGCCTAGAAACTCTCTCAAGG + Intergenic
1096553530 12:52389731-52389753 ACCCCCTAAAAAATGACTGAGGG - Intergenic
1106545603 13:30728237-30728259 GCTCCCTGTAAAATCACTAAGGG - Intronic
1108202530 13:48057544-48057566 GCCCCCCAGAAAAGCAGTGAAGG - Intronic
1110192501 13:72747002-72747024 GCCACTTACAAAATCAGTCATGG - Exonic
1113927127 13:113947807-113947829 TCCCCCCAGACACTCACTCAGGG + Intergenic
1118871522 14:69746968-69746990 GCCCCCTAGAGACTCTCACAAGG + Intronic
1119775782 14:77247998-77248020 ACCCCCCAGAAACCCACTCATGG + Intronic
1127564934 15:60177955-60177977 GCACCCTAGAAGCTCCCTCATGG - Intergenic
1129718586 15:77865657-77865679 TGCCCTTAGAAACTCACTCAAGG - Intergenic
1130546870 15:84863174-84863196 GCCCCATACATAATCTCTCATGG + Intronic
1131374531 15:91912776-91912798 GTCCCCTAGAAAGTCACCCCCGG - Intronic
1132355819 15:101170541-101170563 TCCCACTAGGAAATCACTCCTGG + Intergenic
1133877456 16:9748667-9748689 CCCCACTAGAAACTCTCTCAAGG + Intergenic
1137876419 16:52000667-52000689 GCCCCCTATAAAACCTCTAAAGG - Intergenic
1141741710 16:85898198-85898220 GCCCAGTAGAGAATCACACATGG - Intergenic
1143879656 17:10020182-10020204 GCCCCCTAGAAAATCACTCACGG + Intronic
1155223999 18:23712479-23712501 ACCCCCTAGAAACTCAACCAAGG - Intronic
1156261444 18:35447975-35447997 GCCCACTAGGAAATTTCTCACGG + Intronic
1159394869 18:67843581-67843603 TCACCTTAGATAATCACTCATGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
926910778 2:17850830-17850852 GCCCTCTAAGAAATCACTCCTGG - Intergenic
931443480 2:62307648-62307670 GCCCCGTAGATAAGCACTCATGG - Intergenic
933973353 2:87488176-87488198 GCCACCAAAAAAATCACTGAAGG - Intergenic
941456143 2:165713714-165713736 GCCCCCTAGACCATCACGGACGG - Intergenic
946823828 2:223656342-223656364 GCCACCCAGACAATCACTGAAGG - Intergenic
1169517356 20:6332560-6332582 CCCCCCAAAAAAATCACTCTAGG - Intergenic
1173942170 20:46920801-46920823 GCTCCCTGGAAAATCAGTAAGGG - Intronic
1181647762 22:24243053-24243075 GACCCCCAGACAGTCACTCAGGG + Intronic
1182410975 22:30185990-30186012 CCCCCCAAGAAAAACACACAAGG - Intergenic
1182682948 22:32096725-32096747 GCCCCATAGAAAAACAAGCAAGG - Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
950740891 3:15051123-15051145 GACCCCTAGAAACTCAGCCAAGG - Exonic
954689263 3:52387139-52387161 GCCCCATAGGAAGTCACCCATGG + Intronic
956571040 3:70695326-70695348 GACCACTAGAAAACCACTTAGGG - Intergenic
962731205 3:138285164-138285186 GCTTCCTAGAGAATCACTGAAGG - Intronic
962852518 3:139318647-139318669 GCCTCCTAATAAATCACTGAGGG + Intronic
965070111 3:163908453-163908475 GCCCCCTAGAAAAGCAGAGAAGG - Intergenic
965649041 3:170914115-170914137 GCCCCCAAGAAAATTCCTCGTGG - Intergenic
966668785 3:182504025-182504047 GCCCTCTGGAAAATCTCTAAAGG + Intergenic
969885823 4:10214449-10214471 GTTCCCAAGAATATCACTCAGGG - Intergenic
971171636 4:24239748-24239770 GCACACTAGAATCTCACTCAGGG + Intergenic
971551781 4:27966437-27966459 GTACACTAGAAAATCAATCAAGG - Intergenic
972082974 4:35176919-35176941 GCCCTCTAGGAATTCAGTCATGG - Intergenic
975246719 4:72128854-72128876 GCCAACTAGTAAATCACTTATGG - Exonic
978031311 4:103942295-103942317 GCCCCCTAGAAAAGCAGAGAAGG - Intergenic
979016609 4:115442073-115442095 GCACTCTTGAAATTCACTCATGG - Intergenic
980003560 4:127516217-127516239 GCCCCCCAGAAAAGCAGACAAGG + Intergenic
984322023 4:178208296-178208318 GCCCCCTAGAAAAGCAGAAAAGG - Intergenic
985610603 5:885949-885971 GCCCCCATGAAAACCACTCTGGG + Intronic
986143939 5:5058905-5058927 GCTGCCTGGAAAATCACTCCAGG - Intergenic
992300187 5:75370084-75370106 GTGCCCTAGAAAATCCCTCTAGG + Intronic
995466442 5:112453898-112453920 GCACCATTGAAAATCACCCATGG + Intergenic
997036010 5:130192554-130192576 GCCCCCTAAAGAATCTCTGAAGG - Intergenic
1004009649 6:11670008-11670030 GCAGCCTAGAAATTCTCTCAAGG - Intergenic
1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG + Intergenic
1009359167 6:62792537-62792559 GCCCCCTAGAAAAGCAGAGAAGG - Intergenic
1009993682 6:70876007-70876029 GCCCACTAAAAAATAATTCATGG - Intronic
1010073952 6:71779277-71779299 GCATCCTAGATATTCACTCAAGG + Intergenic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1013972492 6:116038698-116038720 CCAACCTAGAAAATCACTGAAGG + Intronic
1017423887 6:154300760-154300782 GCCCCTTAGCAAATTACTCTTGG + Intronic
1017796347 6:157848181-157848203 TCCCCCTAGAACAGCATTCATGG + Intronic
1019895142 7:3977000-3977022 GCCCTCCAGAGAATCACTGAGGG + Intronic
1023998748 7:45177672-45177694 TCCCCCTGGCACATCACTCACGG + Intronic
1029500024 7:100923182-100923204 GCCCCCTAGAAAAGCAGAAAAGG - Intergenic
1030428006 7:109405030-109405052 GCCCCCTTAAAATTCATTCAAGG + Intergenic
1033613504 7:142988347-142988369 GGACCATAGAAAATCACCCAGGG + Intergenic
1034428821 7:151029819-151029841 GCCCCCAAGTAATTCACTCTAGG - Intronic
1037287142 8:17313358-17313380 ACCCCACAGGAAATCACTCATGG + Exonic
1038119949 8:24601979-24602001 CCCTCCTAGAAAATCACTAAGGG + Intergenic
1041103460 8:54419110-54419132 GCCCCACAGAAAATCAGTCTTGG + Intergenic
1042316306 8:67429977-67429999 GCCCCCTGGAAAATAATTCTTGG - Intronic
1043057617 8:75459798-75459820 GCCACCTAGAAAAGCCCTCCAGG + Intronic
1047263420 8:123282633-123282655 TCGCCCTAGAGAATCACTGAGGG - Intergenic
1048619040 8:136111185-136111207 GCCCTCAAGGAACTCACTCATGG - Intergenic
1049334675 8:142076987-142077009 GCAGCCTGGAAACTCACTCAAGG - Intergenic
1050340909 9:4637625-4637647 GCCCCCTGAAATATCACTAACGG + Intronic
1050487199 9:6146905-6146927 GACCCCTAGAAATTTCCTCAAGG + Intergenic
1051771728 9:20586473-20586495 AACCCCTAGAAAATCACTGGGGG + Intronic
1190324095 X:49196063-49196085 GTCCCCTAGAAAAACAGTCTTGG - Intronic
1190705914 X:53028086-53028108 GCCCACTAGGAAATCACTCTAGG + Intergenic
1191720763 X:64226656-64226678 TCACCCTACAAAACCACTCATGG + Intronic
1191907577 X:66110022-66110044 GCCCTCTAGAAAATGCCCCACGG - Intergenic
1192979083 X:76319314-76319336 TCCACCTAGAAAAAGACTCAGGG - Intergenic
1195240291 X:102944707-102944729 CCCACCTAGTAAATCACTGAAGG - Intergenic
1199663165 X:150073146-150073168 GCAGCCTAGAAAATTACTCCAGG - Intergenic
1200729563 Y:6719627-6719649 GCCACTTAGAAGATCAGTCATGG + Intergenic