ID: 1143880027

View in Genome Browser
Species Human (GRCh38)
Location 17:10022938-10022960
Sequence TACAGGAGCTGGAGAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143880019_1143880027 23 Left 1143880019 17:10022892-10022914 CCAGTGCGTTCTGGTGAGAGGGC 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1143880027 17:10022938-10022960 TACAGGAGCTGGAGAGCCAGTGG 0: 1
1: 0
2: 0
3: 36
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143880027 Original CRISPR TACAGGAGCTGGAGAGCCAG TGG Intronic
900545691 1:3227841-3227863 GACAGGTGCTGGGCAGCCAGGGG + Intronic
901413797 1:9103594-9103616 GAAAGGAGCTGGAGAGACAGTGG + Exonic
901695891 1:11007960-11007982 TACAGGTACTGGAGAGGCTGTGG - Intergenic
903034799 1:20486474-20486496 TCCGGGAGCTGGAGAGGGAGCGG + Intergenic
903186022 1:21629500-21629522 GCCAGGAACTGGAGAGCCAAGGG - Intronic
903192413 1:21664142-21664164 TATGAGAGCTGGAGAGCCGGGGG - Intronic
904151691 1:28446808-28446830 AACAGGAGCAAGAGAGCAAGGGG - Intronic
905757873 1:40526999-40527021 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
905788202 1:40774666-40774688 TACAGGAGGTGGTGAGGGAGAGG - Intergenic
905852986 1:41287810-41287832 TGCTTGAGCTGGAGAGGCAGAGG + Intergenic
905864441 1:41369046-41369068 TTCTGGAGCAGGAGAGCCTGGGG - Intronic
905955709 1:41993499-41993521 AACAGGTGCTGGAGAGGAAGTGG + Intronic
906101721 1:43268070-43268092 CAGAGGAGCAGGGGAGCCAGGGG - Intronic
906529539 1:46515604-46515626 GAAAGCAGCTGGAGAGCAAGAGG + Intergenic
907014735 1:51001464-51001486 TGCAGGTGCTGGAGTGCAAGTGG + Intergenic
907876584 1:58494768-58494790 TACAGGTGCTGGAGAGGATGTGG + Intronic
909863000 1:80632654-80632676 CTCAGGAGATGGGGAGCCAGAGG - Intergenic
910075224 1:83268967-83268989 TACAGGTGCTGGAGAGGATGTGG + Intergenic
910396672 1:86800595-86800617 ACCAGGAACTGGAGAGCCACTGG - Intergenic
910884119 1:91948038-91948060 TACAGTACCTGGAGAGGCTGAGG + Intergenic
911346540 1:96703304-96703326 TACAGGAACTGGAGGCACAGTGG + Intergenic
911677650 1:100677566-100677588 AACAGGTGCTGGAGAGCATGTGG - Intergenic
912436460 1:109665372-109665394 TAGAGAAGCAGGAAAGCCAGTGG - Intronic
912973776 1:114309456-114309478 TACAGGTGCTGGAGAGGATGTGG + Intergenic
914375421 1:147069405-147069427 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
915631317 1:157155565-157155587 TACAGGGGCTGGAAAGGCGGGGG + Intergenic
915930832 1:160059949-160059971 TAATGGAGCTGGAGACACAGAGG + Intronic
916282642 1:163069247-163069269 TTCAGGGGCTGGAGAGGCAGAGG + Exonic
916648313 1:166811152-166811174 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
916936097 1:169629750-169629772 AACAGCAGCTGCGGAGCCAGAGG + Intronic
917170487 1:172167561-172167583 AACAGGTGCTGGAGAGCATGTGG - Intronic
917172324 1:172190657-172190679 AACAGGTGCTGGAGAGCATGTGG - Intronic
917976744 1:180244818-180244840 TCCAGGAGCTGGACTCCCAGGGG - Intronic
920295931 1:204956345-204956367 GACAAGGGCTGGAGAGGCAGAGG - Intronic
920391002 1:205601385-205601407 TACAGATCCCGGAGAGCCAGTGG + Exonic
922571748 1:226638441-226638463 CACAGCAGCTGCAGAGCAAGTGG - Intronic
922987205 1:229874978-229875000 GGCAGGAGCTGGAGAGGAAGTGG + Intergenic
923788791 1:237093476-237093498 GACAGGAGCAGGAGCCCCAGGGG + Intronic
924047217 1:240044069-240044091 CCCAGGAGGTGGAGAGGCAGAGG - Intronic
924411689 1:243812522-243812544 AACAGGTGCTGGAGAGGAAGTGG + Intronic
924557564 1:245130798-245130820 AGCAGTAGCTGGAGAGGCAGGGG - Intergenic
924847942 1:247791614-247791636 CCCAGGGGCTGGTGAGCCAGGGG - Intergenic
1063256596 10:4334696-4334718 TAAAGGAGCTGGTCAGCCATGGG - Intergenic
1063914029 10:10862962-10862984 GACAAGATCTGCAGAGCCAGAGG + Intergenic
1065830649 10:29610830-29610852 TACAGGAAATGAGGAGCCAGGGG - Intronic
1066112346 10:32208501-32208523 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1066487756 10:35864031-35864053 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1066549092 10:36535387-36535409 CACAGGAGTTGTATAGCCAGGGG + Intergenic
1068219701 10:54028287-54028309 TACAGGTGCTGGAGAGGATGTGG + Intronic
1068260497 10:54574649-54574671 TACAGGTGCTGGAGAGGATGTGG + Intronic
1068989668 10:63137633-63137655 TACAGAAGCTGGAAAGTAAGAGG - Intronic
1069255816 10:66330712-66330734 TACAGGTGCTGGAGAGGATGTGG - Intronic
1069263596 10:66431245-66431267 AACAGGAGCTGGAGAGGATGTGG + Intronic
1069380706 10:67840992-67841014 AACAGGAGTAAGAGAGCCAGGGG - Intergenic
1069589336 10:69632114-69632136 GACAGAAGCTGGAGAGGAAGTGG + Intronic
1070474324 10:76816902-76816924 TACAGGTGCTGGAGAGGATGTGG + Intergenic
1070619599 10:77998650-77998672 AACAGGAGCTGGAGAGGATGTGG + Intronic
1071210648 10:83338011-83338033 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1071350147 10:84732569-84732591 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1071630797 10:87216707-87216729 TACAGGAGCTGCAGAGGGGGAGG - Intergenic
1071983647 10:91029273-91029295 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1072053757 10:91732442-91732464 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1072906434 10:99458307-99458329 GACAGCAGCTGGAGAACTAGGGG + Intergenic
1073911482 10:108350034-108350056 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1073966609 10:108997710-108997732 AACAGGAGCTGGAGAGGATGCGG + Intergenic
1074000998 10:109372747-109372769 AACAGGAGCTGGAGAGGATGTGG + Intergenic
1074958896 10:118420786-118420808 TCCAGGAGCTGGAGACACAGGGG + Intergenic
1075688646 10:124380588-124380610 CAGAGGAGCTGGGGAGTCAGGGG - Intergenic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1076613536 10:131742072-131742094 TGCATGAGCTGGTGAGGCAGAGG + Intergenic
1076853521 10:133104472-133104494 TCCAGGTGCTGGGGGGCCAGCGG + Intronic
1078713855 11:13820651-13820673 AACAGGTGCTGGAGAGCTTGTGG - Intergenic
1078980376 11:16525983-16526005 TACAGGTGCTGGAGAGGATGTGG + Intronic
1079337359 11:19582006-19582028 AACAGGAGCTGGAGAGGATGTGG - Intronic
1079565702 11:21879542-21879564 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1080306570 11:30843520-30843542 AACAGGAGCAAGAGAGTCAGGGG + Intronic
1080468636 11:32523723-32523745 AACAGGAGCTGGAGAGGATGTGG - Intergenic
1080482116 11:32662326-32662348 AACAGGAGCTGGAGAGTATGTGG - Intronic
1081601324 11:44496852-44496874 TACAGAGGCTGGCGAGACAGTGG + Intergenic
1081697241 11:45122984-45123006 AACAGGTGCTGGAGAGGAAGTGG - Intronic
1082269478 11:50154335-50154357 AACAGGAGCTGGAGAGGATGTGG + Intergenic
1082625277 11:55477068-55477090 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1082643808 11:55697177-55697199 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1082713690 11:56587306-56587328 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1082743730 11:56939701-56939723 AACAGGTGCTGGAGAGACTGTGG - Intergenic
1083021043 11:59507665-59507687 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1083484913 11:62977180-62977202 TGCAGGACCTGGAGAGCAGGTGG - Exonic
1083918295 11:65764670-65764692 TACAGAATCTGGAGAGCTATTGG + Intergenic
1084234466 11:67777818-67777840 TAAAGGAGATGGAGAGGAAGGGG + Intergenic
1084960262 11:72712744-72712766 CACAGGGACAGGAGAGCCAGTGG + Intronic
1085478974 11:76806214-76806236 CCAAGGAGCTGGAGAGGCAGAGG - Intergenic
1085697245 11:78715437-78715459 GACAGGAGCTGGAAACTCAGGGG - Intronic
1086065122 11:82735646-82735668 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1086860369 11:91918342-91918364 AACAGGAGCTGGAGAGGATGTGG + Intergenic
1087103693 11:94389669-94389691 AACAGGTGCTGGAGAGGCTGTGG + Intronic
1088975242 11:114810687-114810709 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1089051369 11:115548890-115548912 AAGAGGAGATGGTGAGCCAGAGG + Intergenic
1089367396 11:117929393-117929415 TAAAGGAGTTGGAGGGCCAAGGG + Intronic
1090331558 11:125936362-125936384 ACCAGGAGCTGGAGAGGGAGGGG - Intergenic
1091063234 11:132484417-132484439 AACAGGTGCTGGAGAGCTTGTGG + Intronic
1091695218 12:2623798-2623820 TGCCGGAGCTTGTGAGCCAGGGG - Intronic
1091998542 12:5014923-5014945 TAGAGGACCTGTAGAGGCAGAGG + Intergenic
1092797657 12:12129231-12129253 TACAGAAGTTGTAAAGCCAGTGG - Intronic
1093364333 12:18274152-18274174 AACAGGAGCTGGAGAGGATGTGG + Intronic
1093372211 12:18378863-18378885 AACAGGTGCTGGAGAGGAAGTGG + Intronic
1093498084 12:19780056-19780078 TACTGTAGCTGCAGAGGCAGAGG + Intergenic
1093498173 12:19780558-19780580 TTCAGGCTCTGGAGAGCAAGTGG - Intergenic
1093504227 12:19845960-19845982 TACAGATGCTGGAGAGACTGTGG - Intergenic
1094127754 12:27041157-27041179 AACAGGTGCTGGAGAGGAAGTGG - Intronic
1094347040 12:29482111-29482133 TAAAGGAGCTAGAGAGCCATTGG - Intronic
1094858029 12:34426121-34426143 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1095279767 12:40336331-40336353 TATAGGGGCTGGAGAGACAAAGG - Intronic
1095591800 12:43911846-43911868 AACAGGTGCTGGAGAGGCTGTGG + Intronic
1096370423 12:51064532-51064554 AGCTGGAGCTGGAGAGCAAGCGG - Exonic
1097345195 12:58483698-58483720 CACAGAAACTGGAAAGCCAGAGG + Intergenic
1097568381 12:61299254-61299276 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1098211240 12:68168045-68168067 TACTGGAGCCCGAGAGGCAGAGG + Intergenic
1098307836 12:69119117-69119139 AAAAGGAGCTTGAGAGCGAGTGG - Intergenic
1099540485 12:83902233-83902255 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1100550374 12:95641457-95641479 TGCAGCTGCTGGAGGGCCAGTGG + Intergenic
1100746242 12:97649511-97649533 GACAGGAGGTGGAGCTCCAGTGG + Intergenic
1102221085 12:111194896-111194918 TACAGGAGCTGGACAGCTGGGGG - Intronic
1102697442 12:114811023-114811045 AACAGGAGCTGGAGAGGATGTGG + Intergenic
1102895026 12:116592091-116592113 TCCAGGTGCTGGAGATACAGGGG - Intergenic
1103748576 12:123143209-123143231 TGCATGAGGTGGTGAGCCAGTGG - Intronic
1103893968 12:124261142-124261164 ACCAGGAGCTGGAAAGGCAGAGG - Intronic
1103923445 12:124411307-124411329 TGCAGGAGATTCAGAGCCAGGGG + Intronic
1105708347 13:22982537-22982559 TACAGGGGGTGGAGAGCCACTGG - Intergenic
1106009882 13:25809789-25809811 TCCAGGAGCTGGAGATTGAGGGG - Intronic
1106914528 13:34498444-34498466 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1107550972 13:41474996-41475018 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1107577770 13:41745707-41745729 AACAGGTGCTGGAGAGCATGTGG + Intronic
1107685348 13:42892142-42892164 GAGAGCAGCAGGAGAGCCAGAGG + Intronic
1107747862 13:43531423-43531445 AACAGGTGCTGGAGAGCATGTGG + Intronic
1109822836 13:67680889-67680911 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1109949116 13:69478502-69478524 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1110464172 13:75781769-75781791 TACAGGTGCTGGAGAGGATGTGG - Intronic
1110664082 13:78095577-78095599 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1110886434 13:80642890-80642912 TACAGGAAATGGTGAGCCTGGGG + Intergenic
1111580737 13:90220158-90220180 TACAGGTGCTGGAGAGGATGTGG + Intergenic
1112343535 13:98572032-98572054 TCCTGGAGCTGAAGAGGCAGTGG - Intronic
1113173728 13:107536578-107536600 AACAGGAGCTGGAGAGGATGTGG + Intronic
1113533221 13:111044834-111044856 TGCAGGTCCTGGAGAGGCAGGGG + Intergenic
1114038259 14:18649945-18649967 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1114120363 14:19665097-19665119 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1114156478 14:20109148-20109170 TACAGGTGCTGGAGAGGATGTGG + Intergenic
1115184433 14:30668900-30668922 AACAGGTGCTGGAGAGGCTGTGG + Intronic
1115764489 14:36608826-36608848 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1115794892 14:36924025-36924047 TACAGGTGCTGGAGAGGATGTGG + Intronic
1116760258 14:49004360-49004382 TAGAGGACCAGGAGAGCCAATGG - Intergenic
1117097208 14:52311228-52311250 TCTGGGAGCTGAAGAGCCAGTGG + Intergenic
1117227769 14:53680709-53680731 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1117266451 14:54092905-54092927 GATAGGAGCTGGAGATACAGTGG - Intergenic
1117705042 14:58457027-58457049 AACAGAAGCTGGGAAGCCAGAGG - Intronic
1118347505 14:64950702-64950724 TACAGGAACTGGGGACCCAGAGG + Intronic
1118686022 14:68292030-68292052 AACAGGAGGTGGAGAGGCAGTGG - Intronic
1118920524 14:70145769-70145791 TGCAGCAGCTGGAGGGCCAAAGG - Intronic
1119146883 14:72324997-72325019 AACAGGTGCTGGAGAGCATGTGG - Intronic
1119147178 14:72328004-72328026 TAGAGAAGCAGGAAAGCCAGTGG + Intronic
1120294476 14:82622758-82622780 CACAGCAGCTGGACAACCAGAGG - Intergenic
1120520086 14:85516977-85516999 TACATAAGCTGCAGAGACAGGGG - Intergenic
1120569181 14:86096576-86096598 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1120822524 14:88926144-88926166 CATAGGAGCTGGAGCTCCAGGGG + Intergenic
1120963855 14:90150204-90150226 TACAGAAGCTGGAGAGGATGTGG + Intronic
1121027830 14:90629581-90629603 GCCAGGTGCTGGGGAGCCAGAGG + Intronic
1122027688 14:98889447-98889469 GGCAGGAGCAGGAAAGCCAGTGG + Intergenic
1122273158 14:100577469-100577491 TACAAGAGCTGCAGCCCCAGGGG - Intronic
1122281393 14:100624494-100624516 CACAAAAGCAGGAGAGCCAGTGG - Intergenic
1122287024 14:100658334-100658356 TCCTGGAGCTGGACAGCCTGAGG + Intergenic
1122590888 14:102850008-102850030 TCCAAGAGCTGGAAAGCCCGGGG - Intronic
1122594254 14:102878552-102878574 TCCAGGAGCTGGGGACTCAGTGG + Intronic
1122827323 14:104376576-104376598 CACAGCGGCTGGAGAGGCAGCGG - Intergenic
1123227065 15:17049967-17049989 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1123578774 15:21697595-21697617 TACAGAAGTTGGAGATCCATTGG + Intergenic
1123615401 15:22140077-22140099 TACAGAAGTTGGAGATCCATTGG + Intergenic
1124511275 15:30328202-30328224 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1124714445 15:32046310-32046332 AACAGGTGCTGGAGAGCATGTGG - Intronic
1124813239 15:32962842-32962864 AACAGGTGCTGGAGAGCATGTGG + Intronic
1125893949 15:43286491-43286513 TACAGGTGCTGCAGACACAGAGG - Intronic
1126242190 15:46458070-46458092 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1127138467 15:55949300-55949322 AACAGGAGCTGGAGAGGATGTGG + Intronic
1127150222 15:56066777-56066799 AACAGGAGCTGGAGAGGATGTGG - Intergenic
1128700786 15:69802691-69802713 TACAGAAGATGGAAAGGCAGGGG - Intergenic
1128927446 15:71671126-71671148 TACAGGTGCTGGAGAGGATGTGG - Intronic
1129831169 15:78671838-78671860 TAGTGGAGCAGGAGAGCCTGAGG + Intronic
1130183598 15:81655678-81655700 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1130259560 15:82344669-82344691 TGCGGGAGCTGGAGAGGCTGCGG - Exonic
1130259564 15:82344687-82344709 TGCGGGAGCTGGAGAGGCTGCGG - Exonic
1130269118 15:82434499-82434521 TGCGGGAGCTGGAGAGGCTGCGG + Exonic
1130281702 15:82524499-82524521 TGCGGGAGCTGGAGAGGCTGCGG + Intergenic
1130432847 15:83866108-83866130 AACAGGTGCTGGAGAGCATGTGG + Intronic
1130473070 15:84240661-84240683 TGCAGGAGCTGGAGAGGCTGCGG + Exonic
1130473074 15:84240679-84240701 TGCGGGAGCTGGAGAGGCTGCGG + Exonic
1130480484 15:84354726-84354748 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1130480488 15:84354744-84354766 TGCGGGAGCTGGAGAGGCTGCGG + Intergenic
1130491224 15:84433015-84433037 TGCGGGAGCTGGAGAGGCTGCGG - Intergenic
1130491228 15:84433033-84433055 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130502807 15:84511815-84511837 TGCGGGAGCTGGAGAGGCTGCGG - Intergenic
1130502811 15:84511833-84511855 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130595359 15:85245269-85245291 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1130799763 15:87250407-87250429 TACAGGTGCTGGAGAGGATGGGG - Intergenic
1131065207 15:89430226-89430248 AAGATGAGCTGGAGAGACAGAGG - Intergenic
1131551357 15:93359850-93359872 TCCAGGCCCTGGAGAGCCTGGGG + Intergenic
1202987644 15_KI270727v1_random:431840-431862 TACAGAAGTTGGAGATCCATTGG + Intergenic
1132617880 16:851399-851421 AGCAGGCCCTGGAGAGCCAGGGG + Intergenic
1132702381 16:1227348-1227370 TTCAGGGGCTGCAGAGGCAGAGG + Intronic
1132705943 16:1243520-1243542 TTCAGGGGCTGCAGAGGCAGAGG - Intergenic
1133138873 16:3730290-3730312 TACAGGAGTTGGACAGGCTGTGG - Intronic
1133161705 16:3916138-3916160 CACAGGGTCTGAAGAGCCAGAGG - Intergenic
1133328608 16:4957738-4957760 TCCAGGCGCTGGAGAGCCGCCGG - Intronic
1133879694 16:9769061-9769083 TGGAGGAGCTGGAGACCCTGTGG - Exonic
1134355905 16:13482119-13482141 TCTAGAAGCTGGAGAGCAAGAGG - Intergenic
1134820913 16:17246749-17246771 GGCAGGGGCTGGAGATCCAGTGG + Intronic
1135516645 16:23141189-23141211 TGGAGGAGGTGGAGAGGCAGGGG - Intronic
1135565859 16:23510443-23510465 TACAGCGGCTGAAGAGGCAGTGG - Exonic
1135685419 16:24494771-24494793 TGCTTGAGCTGGAGAGGCAGAGG + Intergenic
1136927615 16:34389032-34389054 AAGAGCAGCTGGAGAGCCGGGGG + Intergenic
1136976959 16:35022774-35022796 AAGAGCAGCTGGAGAGCCGGGGG - Exonic
1137233400 16:46590666-46590688 AACAGGAGCTGGAGAGGATGTGG + Intronic
1137809042 16:51335292-51335314 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1138018501 16:53454873-53454895 TACAGGAGCAGGTAAGCCAGGGG + Intronic
1138606546 16:58093779-58093801 TACGAGTGCTGGAGAGCCTGGGG - Intergenic
1139265882 16:65637752-65637774 TCCAGTATCTGGAGGGCCAGAGG - Intergenic
1139478606 16:67215908-67215930 GCCAGGAGCTGGAGAGGGAGGGG - Intronic
1140693293 16:77506359-77506381 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1140758874 16:78093102-78093124 GACAGAAGCTAGGGAGCCAGAGG - Intergenic
1141029059 16:80572024-80572046 AGCAGGAGCAAGAGAGCCAGAGG + Intergenic
1141696750 16:85623866-85623888 TACAGGAGCTGGACACCAACAGG - Intronic
1141948206 16:87324546-87324568 GAAAGGTGCTGGAGGGCCAGGGG - Intronic
1142253165 16:89002110-89002132 CAGAGGAGCTGGGGAGACAGAGG + Intergenic
1142510195 17:388033-388055 TGCAGGAGCTGGGGATACAGAGG + Intergenic
1143009264 17:3857005-3857027 TAAAGGAGCGGGAGCGCCTGAGG + Intergenic
1143096971 17:4483363-4483385 CACAGAAGCTGGAGAGCCCAGGG - Intronic
1143880027 17:10022938-10022960 TACAGGAGCTGGAGAGCCAGTGG + Intronic
1147455696 17:40536790-40536812 CAGAGGAGCTGGAGAGCCTCAGG - Intergenic
1148096448 17:45055752-45055774 GGCAGGAACTGGAGAGTCAGGGG - Intronic
1148268355 17:46244080-46244102 TGCTGGAGCTGGTGAGCCTGCGG + Intergenic
1148681992 17:49479474-49479496 TAAAGTGGCAGGAGAGCCAGGGG + Intergenic
1148825214 17:50388079-50388101 ATCAGGAGCGGGAGAGGCAGCGG - Exonic
1150872391 17:68927172-68927194 TGCCTGAGCTGGAGAGGCAGAGG + Intronic
1151212117 17:72552376-72552398 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1152442329 17:80316542-80316564 GACAGGAGCTGGAGCACGAGAGG + Intronic
1153124134 18:1769470-1769492 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1153125187 18:1782961-1782983 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1154020071 18:10656239-10656261 TACAGGGGCTGGAGAGGCTGTGG + Intergenic
1154087666 18:11322995-11323017 TAGAGAAGCTGGAGGTCCAGGGG - Intergenic
1154134287 18:11762110-11762132 CACAGGAGGTGGAGAGGGAGAGG + Intronic
1154338487 18:13484207-13484229 GAGAGGAGCAGGAGATCCAGTGG + Intronic
1154482346 18:14844725-14844747 AACAGGTGCTGGAGAGGCTGTGG - Intronic
1157029627 18:43890030-43890052 TAGAGGAGCTGGAGAGAGAGGGG + Intergenic
1157324052 18:46656610-46656632 TTCAGGAGCTGGAGAACATGGGG + Intronic
1160073157 18:75645791-75645813 TGCAGGTGCTGGAGGGCGAGTGG + Intergenic
1160334987 18:78031048-78031070 TAGGGGGGCTTGAGAGCCAGGGG + Intergenic
1160443507 18:78911350-78911372 GATAGGAGCTGGAGGGCCTGGGG - Intergenic
1160443553 18:78911473-78911495 GATAGGAGCTGGAGGGCCTGGGG - Intergenic
1160443584 18:78911556-78911578 GATAGGAGCTGGAGGGCCTGGGG - Intergenic
1160557187 18:79733568-79733590 TAACGCAGCTGGAGAGGCAGCGG - Intronic
1160557197 18:79733631-79733653 TAACGCAGCTGGAGAGGCAGCGG - Intronic
1160839267 19:1138277-1138299 AACAGGTGCCGGAGAGCCTGGGG + Intronic
1161106514 19:2446269-2446291 GGGAGGGGCTGGAGAGCCAGGGG + Intronic
1161791827 19:6364585-6364607 TACGGGAGTTGGGGAGCGAGTGG - Exonic
1162739944 19:12768100-12768122 TGCAGGAACTGCAGGGCCAGCGG - Exonic
1163101669 19:15101110-15101132 TTCAGGAGCTGGAGGGAGAGGGG - Intergenic
1163235072 19:16025209-16025231 TGCTGGAGCTGGACAGCCTGGGG - Intergenic
1164132482 19:22377739-22377761 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1164884792 19:31769510-31769532 TACAGGAGCTGTTGGGCCAGGGG + Intergenic
1164917705 19:32065450-32065472 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1166382816 19:42363502-42363524 GACAAGAGTTGGAGAGGCAGAGG - Intronic
1168002817 19:53463142-53463164 TACAAAAGCTGCAGAGCCACTGG + Intergenic
925744267 2:7031299-7031321 TGTAGGAGCTGGAGATACAGTGG + Intronic
925775193 2:7328380-7328402 AGCAGGAGCAAGAGAGCCAGGGG - Intergenic
926370758 2:12176455-12176477 TACAAGAGATGTAGAGACAGTGG + Intergenic
927120120 2:19951985-19952007 TACAGGTACTAGAGAGACAGTGG - Intronic
927634303 2:24800968-24800990 AACAGGTGCTGGAGAGGCTGTGG - Intronic
928081693 2:28317788-28317810 AACAGGAACTGGAAAGCCACTGG - Intronic
929294644 2:40233240-40233262 AACAGGAGCTGGAGAGGATGTGG - Intronic
929305187 2:40353409-40353431 TACAGGCCTTGGAGAGCCTGCGG - Intronic
929942892 2:46348224-46348246 GACAAGAGCAGGAGAGCCAAGGG + Intronic
930086550 2:47501754-47501776 TCCAGGAGGTGGAGAGAGAGGGG + Intronic
931283025 2:60810143-60810165 TACGGGAGGTGGGGAGTCAGAGG + Intergenic
931940149 2:67243085-67243107 TACAGGAGTAGGAAATCCAGGGG - Intergenic
933127281 2:78624464-78624486 AACAGGTGCTGGAGAGCATGTGG + Intergenic
933268786 2:80210857-80210879 AACAGGAGCTGGAGAGGATGTGG - Intronic
933426917 2:82125699-82125721 TCTACAAGCTGGAGAGCCAGGGG + Intergenic
933704834 2:85281894-85281916 TACAGGAGCAGGAGGGCGATGGG - Intronic
934250597 2:90350990-90351012 GGCAGGTGCTGGAGAGCAAGTGG - Intergenic
935065860 2:99646999-99647021 AACAGATGCTGGAGAGCCTGTGG + Intronic
936720996 2:115253154-115253176 AACAGGAGCAGGAGAGGGAGTGG + Intronic
937186269 2:120046298-120046320 AACAGGTGCTGGAGAGGAAGTGG - Intronic
937202096 2:120210275-120210297 TACCGGGGCTCCAGAGCCAGGGG + Intergenic
937220029 2:120337382-120337404 TGCAGGAGATGGAGGGCCAACGG - Intergenic
937299727 2:120831915-120831937 CTCAGGGGCTGGAGTGCCAGTGG + Intronic
938307568 2:130265769-130265791 TACAGGGGCTGCAGATGCAGAGG + Intergenic
938447764 2:131391073-131391095 TACAGGGGCTGCAGATGCAGAGG - Intergenic
938721049 2:134067160-134067182 AACAGGTGCTGGAGAGCATGTGG + Intergenic
938782297 2:134595757-134595779 AACAGGTGCTGGAGAGCATGTGG - Intronic
938821509 2:134964878-134964900 TTCAGGAGCTGGAGAGCAGAAGG + Exonic
940659457 2:156529079-156529101 AACAGGTGCTGGAGAGCATGTGG - Intronic
941798279 2:169625951-169625973 GACAGGAGGTGGAGCTCCAGTGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942690120 2:178576147-178576169 TGCAGGTGTTGGGGAGCCAGCGG - Exonic
943435962 2:187866509-187866531 TGGAGGAGCTGGAAATCCAGGGG + Intergenic
943435979 2:187866606-187866628 TTGTGGAGCTGGAGACCCAGGGG - Intergenic
943436432 2:187869825-187869847 TCATGGAGCTGGAGATCCAGCGG - Intergenic
944604095 2:201334054-201334076 AACAGGTGCTGGAGAGGCTGTGG - Intronic
944678304 2:202052934-202052956 TCCAGGAAATGGAGAGCCATTGG + Intergenic
945041569 2:205747118-205747140 TCCAGGAGCTTGTAAGCCAGTGG + Intronic
945972018 2:216240255-216240277 TGCAGGGGTTGGAGAGCCAGAGG - Intergenic
946106927 2:217379046-217379068 AACAGGTGCTGGAGAGCATGTGG + Intronic
947172640 2:227326026-227326048 TCCAGGAGCTGGGAAGCCGGAGG + Intronic
947612763 2:231533876-231533898 TCTAGGAGCAGGAGAGGCAGGGG - Intergenic
947787108 2:232832978-232833000 GAAAGGAGCTGGAGGTCCAGCGG + Exonic
948167789 2:235876596-235876618 TACAGGAGCTGGTGACCAGGAGG - Intronic
948920751 2:241064851-241064873 CACAGGGGCTGGAGAAGCAGGGG - Exonic
949070311 2:242020513-242020535 TCGTGGAGCTGGAGATCCAGGGG + Intergenic
949077631 2:242071090-242071112 TACAGGAGCAGGGCAGACAGTGG - Intergenic
1169084919 20:2820748-2820770 TTCAAGAGATGGAGCGCCAGTGG + Intergenic
1169310162 20:4531109-4531131 ACCAGGAGCTGGAGAGTCGGGGG + Intergenic
1170741616 20:19063525-19063547 AACTGGAGCTGGAAAGCCACTGG + Intergenic
1170804086 20:19614736-19614758 CACAGCAGCTGTAGAGTCAGTGG - Intronic
1170869799 20:20195186-20195208 GACAGAAGCTGGAAAGGCAGGGG + Intronic
1171090181 20:22277810-22277832 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1171146985 20:22793337-22793359 AGCAGGAGCAAGAGAGCCAGTGG - Intergenic
1171469321 20:25357182-25357204 GAAAGGCGCTGGAGAGTCAGGGG - Intronic
1171762262 20:29216515-29216537 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1171773185 20:29342736-29342758 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1171823613 20:29876186-29876208 CTCTGGAGCTGGAGAGCCGGGGG + Intergenic
1172511317 20:35503096-35503118 TCAAGGAGCTGGAGGGCCAGAGG + Exonic
1172632484 20:36388394-36388416 TCCAGGAGCTGGGGAGGAAGTGG - Intronic
1172938963 20:38641625-38641647 TTCCAGAGCTGGAAAGCCAGGGG - Intronic
1173946843 20:46958273-46958295 CAAAGGAGCAGGAGAGCCTGTGG - Intronic
1174100239 20:48121648-48121670 TTGTGGAGCTGGAGAACCAGAGG - Intergenic
1174153102 20:48499995-48500017 TGAGGGAGCTGGAGACCCAGGGG - Intergenic
1174648202 20:52103962-52103984 TGCGGAAGCTGGAGAGCCCGCGG + Intronic
1174793606 20:53503312-53503334 TGCAGGAGCTGGTGAAACAGTGG - Intergenic
1174930729 20:54811495-54811517 AACAGGAGCTGGAGAGGATGTGG - Intergenic
1175220299 20:57412732-57412754 TATTTGAGCTGCAGAGCCAGGGG - Intergenic
1175515598 20:59567845-59567867 TGCAGGGGCAGGTGAGCCAGTGG + Intergenic
1175922542 20:62456909-62456931 TGCAGGAGCTCGAGAGTAAGGGG - Intergenic
1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG + Intronic
1176612848 21:9001578-9001600 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1176798258 21:13391885-13391907 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1177265844 21:18782588-18782610 TAATGGATGTGGAGAGCCAGAGG - Intergenic
1177468476 21:21522337-21522359 GAAAGGAGCAAGAGAGCCAGAGG + Intronic
1178419907 21:32435146-32435168 TAAAGGAGATGGAGAGGAAGGGG - Intronic
1178434863 21:32549171-32549193 TACAGGGGCAGGAAAGCCATGGG - Intergenic
1178955468 21:37017994-37018016 TTCCGAAGCTGAAGAGCCAGAGG + Exonic
1180368747 22:11964865-11964887 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1180462380 22:15576986-15577008 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1180625390 22:17190624-17190646 GATTGGAGCAGGAGAGCCAGTGG - Intronic
1180953114 22:19729646-19729668 GGCAGGAGCTGCAGAGGCAGAGG + Intergenic
1181018751 22:20087110-20087132 TGCAGGAGCATGAGCGCCAGGGG + Intronic
1181033733 22:20160184-20160206 TGGAGGAGCTGGAGAGCTAGAGG - Intergenic
1181033746 22:20160235-20160257 TGGAGGAGCTGGAGGGCCGGAGG - Intergenic
1181366244 22:22378982-22379004 TACAGGATGTGGACACCCAGAGG - Intergenic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1181991941 22:26843720-26843742 TACAGGGGCTGGAGAGGAGGTGG + Intergenic
1182104032 22:27676190-27676212 TCTAGTTGCTGGAGAGCCAGTGG - Intergenic
1184314033 22:43668940-43668962 AACAAGAACTGGAGAGACAGTGG + Exonic
949728348 3:7077072-7077094 AACAGGTGCTGGAGAGTCTGTGG + Intronic
950427463 3:12932151-12932173 TACAGGAGCAGGAGACGCTGGGG + Intronic
950889159 3:16387744-16387766 TACAGAAGCTAGAGAGTGAGTGG - Intronic
951232690 3:20198075-20198097 TACAGGGCCTGGAGTGCCATTGG + Intergenic
951606379 3:24439268-24439290 TGCAGCAGCTGGAGGGCAAGGGG + Intronic
952723153 3:36554621-36554643 TAGAGGAGCTGGTGAGGAAGAGG + Intergenic
955418159 3:58711993-58712015 CACAGGAGCTTGAGAGGCTGCGG + Intergenic
955853993 3:63253666-63253688 TACAGGTGCTGGAGAGGATGTGG + Intronic
957583410 3:82105526-82105548 AACAGGTGCTGGAGAGCATGTGG - Intergenic
957598440 3:82300120-82300142 AACAGGTGCTGGAGAGCATGTGG - Intergenic
957648809 3:82971598-82971620 AACAGGAGCTGGAGAGGATGTGG - Intergenic
958125148 3:89346259-89346281 AACAGGAGCTGGAGAGGATGTGG - Intronic
958200390 3:90307719-90307741 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
958838243 3:99171704-99171726 TTCAGGCTCTGGAGAGCAAGTGG + Intergenic
959705975 3:109339105-109339127 TGCTTGAGCTGGAGAGGCAGAGG + Intergenic
961131080 3:124467894-124467916 GAGAGAAGCAGGAGAGCCAGAGG + Intronic
961337913 3:126195461-126195483 AACAGGAGCTGGAGAGGATGTGG + Intronic
961434271 3:126905849-126905871 TCCAGAAGCTGGATAGCTAGTGG + Intronic
962142779 3:132807731-132807753 AACAGGTGCTGGAGAGGCTGCGG - Intergenic
962285629 3:134083904-134083926 GACAGGAGCTGGAGAGAGAAAGG - Intronic
962367519 3:134796058-134796080 TCCAGGAGCCGGATGGCCAGAGG - Intronic
962489334 3:135877088-135877110 AGCAGGAGCAGGAGAGACAGGGG + Intergenic
962922580 3:139964440-139964462 TGCAGGATATGGAGAGTCAGAGG + Intronic
963131562 3:141863101-141863123 TGCTGGAGCTGGGGAGGCAGAGG - Intergenic
963485795 3:145933134-145933156 TACAGGTGCTGGAGAGGATGTGG + Intergenic
964161819 3:153654670-153654692 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
964223999 3:154376019-154376041 TGAAGAAGCTGGAAAGCCAGTGG - Intronic
964535009 3:157711251-157711273 GACAGGAGCTGGGCAGTCAGTGG - Intergenic
964595485 3:158422717-158422739 AACAGGTGCTGGAGAGCATGTGG - Intronic
964680773 3:159335985-159336007 AACAGGTGCTGGAGAGCATGTGG - Intronic
965238203 3:166156366-166156388 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
965765405 3:172125211-172125233 TTCAGAAGCTGGGGAGCCAGAGG - Intronic
966478053 3:180372872-180372894 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
966480915 3:180407560-180407582 AACAGGTGCTGGAGAGCATGTGG + Intergenic
966485286 3:180461888-180461910 AACAGGTGCTGGAGAGCATGTGG - Intergenic
966582131 3:181579798-181579820 AACAGGTGCTGGAGAGCATGTGG + Intergenic
966933143 3:184688652-184688674 GGCAGGAGCTGGCTAGCCAGAGG + Intergenic
967361818 3:188639867-188639889 TACAGGTGCTGGAGAGGATGTGG + Intronic
967736410 3:192957347-192957369 GACAGGAGCTGGGGAATCAGGGG + Intergenic
967849719 3:194072517-194072539 TAAGGGAGCTGGAGGTCCAGAGG - Intergenic
969126470 4:4951916-4951938 TGCAGGGGCTGGGTAGCCAGAGG - Intergenic
969665187 4:8553361-8553383 TTCTGGAGCTGCAGGGCCAGGGG + Intergenic
970937961 4:21596911-21596933 CCGAGGAGATGGAGAGCCAGTGG + Intronic
971096915 4:23416868-23416890 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
972382404 4:38531579-38531601 CACAGGAGTTGGCGAGACAGGGG - Intergenic
972899080 4:43659829-43659851 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
972911131 4:43818298-43818320 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
973014797 4:45124956-45124978 AACAGGTGCTGGAGAGCATGTGG - Intergenic
973116306 4:46464363-46464385 AACAGGAGCTGGAGAGGAGGTGG - Intronic
973185903 4:47327952-47327974 AACAGGTGCTGGAGAGGAAGTGG - Intronic
974522057 4:62994707-62994729 TACAGGTGCTGGAGAGGATGTGG - Intergenic
976330797 4:83829028-83829050 TCCAGGAGGTGGAGACCAAGGGG + Intergenic
976451269 4:85194103-85194125 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
976464149 4:85348413-85348435 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
977980116 4:103311189-103311211 TACAGGTGCTGGAGAGGATGTGG - Intergenic
977999392 4:103538467-103538489 TACAGGTGCTGGAGAGGATGTGG - Intergenic
978007782 4:103638939-103638961 TACAGGTGCTGGAGAGGATGTGG + Intronic
978046408 4:104134560-104134582 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
978272047 4:106902842-106902864 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
978555636 4:109977452-109977474 TACAGGAACTGAAGATACAGTGG + Intronic
978571639 4:110144297-110144319 TACAAGAAATGGAGAGCCATAGG + Intronic
979567004 4:122165714-122165736 AACAGGTGCTGGAGAGCATGTGG - Intronic
979777761 4:124612575-124612597 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
979804220 4:124950726-124950748 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
980395399 4:132207490-132207512 TACAGGTGCTGGAGAGGATGTGG - Intergenic
981109619 4:140920536-140920558 TACAGGTGCTGGAGAGGATGTGG + Intronic
981149313 4:141363048-141363070 TACAGGTGCTGGAGAGGATGTGG - Intergenic
982090708 4:151877702-151877724 TTCAGGAGCTGCAGAGACTGTGG - Intergenic
984176508 4:176425386-176425408 AACAGGAGCTGGAGAGGATGTGG - Intergenic
984518851 4:180775880-180775902 AACAGGTGCTGGAGAGCATGTGG - Intergenic
984733610 4:183090395-183090417 TTCAGGAGCTGGGGAGAGAGAGG + Intergenic
984875230 4:184362011-184362033 AACAGGAGCAAGAGAGCAAGGGG + Intergenic
985445455 4:190019000-190019022 CTCCGGAGCTGGAGAGCCAGGGG + Intergenic
985980905 5:3462384-3462406 TCCAGAAGATGGTGAGCCAGAGG + Intergenic
986076985 5:4348056-4348078 TACATAAGCAGGAGAGGCAGGGG - Intergenic
986947664 5:13044468-13044490 TAGAGAACCAGGAGAGCCAGTGG + Intergenic
987273783 5:16340775-16340797 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
987563221 5:19550905-19550927 AACAGGTGCTGGAGAGCATGTGG - Intronic
987626861 5:20413453-20413475 AACAGGTGCTGGAGAGGCTGTGG - Intronic
988517586 5:31918079-31918101 AACAGGAGCCAGAGAGCAAGGGG + Intronic
989941138 5:50151222-50151244 AACAGGTGCTGGAGAGCGTGTGG + Intergenic
991105978 5:62842572-62842594 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
991167318 5:63579244-63579266 AACAGGTGCTGGAGAGGAAGGGG + Intergenic
992473340 5:77078397-77078419 TTCAGGAGTGGAAGAGCCAGTGG + Intronic
992514750 5:77480173-77480195 AACAGGTGCTGGAGAGGCTGTGG + Intronic
993727374 5:91383473-91383495 TACAGTAGGTGTAGAGCTAGGGG + Intergenic
994491922 5:100458743-100458765 TACAGGTGCTGGAGAGGATGTGG - Intergenic
994645753 5:102466664-102466686 TACAGAAGCTGGTGAGGCTGTGG - Intronic
994707349 5:103223076-103223098 TGCAGGAGCCTGAGGGCCAGAGG - Intergenic
995467050 5:112461384-112461406 TACAGGTGCTGGAGAGGATGTGG - Intergenic
995472460 5:112517117-112517139 TACAGGTGCTGGAGAGGATGTGG - Intergenic
995631765 5:114141772-114141794 TACAGGTGCTGGAGAGGATGTGG - Intergenic
995771923 5:115680039-115680061 AACAGGTGCTGGAGAGCATGTGG + Intergenic
995814297 5:116149497-116149519 AACAGGTGCTGGAGAGCATGTGG - Intronic
996020284 5:118583380-118583402 AACAGGTGCTGGAGAGCATGTGG - Intergenic
996629945 5:125618695-125618717 AACAGGTGCTGGAGAGCATGTGG + Intergenic
997528794 5:134569834-134569856 CACAGGGGCAGAAGAGCCAGAGG - Intronic
997586892 5:135048675-135048697 CACAGGGCATGGAGAGCCAGAGG - Intronic
997863302 5:137439142-137439164 GACAGGAGATGAAGAGACAGAGG + Intronic
998395379 5:141814687-141814709 TCCAGGAGCTAGAGTCCCAGGGG + Intergenic
998874016 5:146581294-146581316 AACAGGAGCAAGAGAGACAGAGG + Intronic
999484643 5:151983615-151983637 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
999485801 5:151994379-151994401 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1000091232 5:157931315-157931337 TGCAGGGGCTGCAGAGCCTGGGG + Intergenic
1000705798 5:164510485-164510507 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1002997661 6:2302356-2302378 AACAGGTGCTGGAGAGTAAGTGG + Intergenic
1003958865 6:11190998-11191020 TCCAGGAGCTGCAGAACCGGTGG - Exonic
1004145256 6:13060035-13060057 TAAAGGAGATAGAGAGGCAGTGG + Intronic
1006346554 6:33487109-33487131 TGCTTGAGCTGGAGAGGCAGAGG + Intergenic
1006769950 6:36544786-36544808 TGCTTGAGCTGGAGAGGCAGAGG + Intronic
1007371616 6:41429896-41429918 CGCAGGGGCTGGAGAGCCTGTGG - Intergenic
1007694068 6:43720499-43720521 TACAGAAGCTGGTGAGTCTGAGG + Intergenic
1007755649 6:44097526-44097548 CAAGGGAGATGGAGAGCCAGTGG + Intergenic
1007939039 6:45759505-45759527 TACAGGAGGTGAAGGTCCAGTGG + Intergenic
1008026862 6:46648011-46648033 AACAGGTGCTGGAGAGCATGTGG + Intronic
1008329098 6:50223944-50223966 AACAGGAGCTGGAGAGGATGTGG - Intergenic
1008733029 6:54506507-54506529 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1008898376 6:56583237-56583259 AACAGGTGCTGGAGAGGCTGTGG - Intronic
1009275432 6:61672487-61672509 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1010053066 6:71531153-71531175 TGGAGGAGCTGGAGGGCCTGGGG + Intergenic
1010262837 6:73836024-73836046 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1010264017 6:73847650-73847672 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1010337381 6:74702876-74702898 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1010672246 6:78699807-78699829 AACAGGAGCTGGAGAGGATGTGG + Intergenic
1011085393 6:83535050-83535072 GACAGGTGCTGGAGAGGCTGTGG + Intergenic
1011432872 6:87306524-87306546 AACAGGTGCTGGAGAGGCTGTGG + Intronic
1011432984 6:87307725-87307747 AACAGGTGCTGGAGAGGCTGTGG + Intronic
1011434703 6:87323915-87323937 AACAGGTGCTGGAGAGGCTGTGG - Intronic
1011626393 6:89286926-89286948 TACAGGAGCTGGAGAGAAGCTGG - Intronic
1012608426 6:101186757-101186779 AACAGGAGCTGGAGAGGATGTGG - Intergenic
1013051939 6:106544632-106544654 TACAGGGACTGGAAAGCCTGGGG + Exonic
1014063106 6:117095908-117095930 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1014113160 6:117643814-117643836 CACTTGAGCTGGTGAGCCAGAGG + Intergenic
1014421575 6:121252565-121252587 CTCAGGGGGTGGAGAGCCAGGGG + Intronic
1014763189 6:125380954-125380976 TCCAGGAGGTGGAGAGTTAGAGG + Intergenic
1015857516 6:137640938-137640960 CACAGGAGCAGGGGAGGCAGTGG - Intergenic
1016609341 6:145970761-145970783 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1016665680 6:146637279-146637301 TTCTTGAGCTGGAGAGACAGAGG + Intronic
1018044166 6:159951600-159951622 TACAGTAGCTTGGGGGCCAGTGG - Intergenic
1018413253 6:163577656-163577678 CACAGGAGCCAGAGAGCCGGGGG - Exonic
1019967094 7:4508398-4508420 TACAGGTGCTGGAGAGGGTGTGG - Intergenic
1021090832 7:16480768-16480790 TACGGGGAATGGAGAGCCAGAGG + Intronic
1021564549 7:22004105-22004127 GGCAGGGCCTGGAGAGCCAGTGG + Intergenic
1022851398 7:34266246-34266268 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1023570368 7:41565539-41565561 TACAGAAGCCTGAGAGTCAGAGG + Intergenic
1023611421 7:41975172-41975194 TAAATGAGCAGGACAGCCAGAGG + Intronic
1023849112 7:44140510-44140532 CACAGGGGCTGGAGGGGCAGAGG + Intronic
1024667775 7:51563547-51563569 GACAGGAGCTGGGGAGACTGGGG - Intergenic
1024790584 7:52960749-52960771 TACAGATGCTGGAGACTCAGAGG - Intergenic
1024817003 7:53283005-53283027 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1024829471 7:53432697-53432719 TACAGACGGTGGAGAGACAGTGG + Intergenic
1024899863 7:54306670-54306692 AACAGGAGCTGGAGAGGATGTGG - Intergenic
1026320025 7:69260103-69260125 AACAGGAGCTGGAAGGACAGAGG - Intergenic
1027555761 7:79663049-79663071 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1027696828 7:81422165-81422187 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1027698833 7:81443451-81443473 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1027896304 7:84050350-84050372 AACAGGTGCTGGAGAGCATGTGG - Intronic
1028013205 7:85675586-85675608 TACAGGTACTGGAGAGTAAGTGG - Intergenic
1028028079 7:85871943-85871965 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1028691574 7:93658680-93658702 AACAGGTGCTGGAGAGGCTGTGG - Intronic
1028919336 7:96293779-96293801 AACAGGAGCTGGAGAGGATGTGG + Intronic
1029448214 7:100626696-100626718 TCCAGGAGGTGGAGCCCCAGGGG + Intronic
1029964983 7:104730386-104730408 AACAGGTGCTGGAGAGGCTGTGG - Intronic
1030101330 7:105948161-105948183 TAGCAGAGCTGAAGAGCCAGAGG + Intronic
1031270632 7:119644739-119644761 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1032106897 7:129039474-129039496 TGCTTGAGCTGGAGAGGCAGAGG + Intronic
1033231005 7:139597271-139597293 TACAAGACCTGTAGAGCCTGGGG - Intronic
1034840233 7:154388665-154388687 AACAGGAGCTGGAGGGCATGAGG + Intronic
1035078613 7:156198158-156198180 TCCAGGGGCTGGAAATCCAGAGG - Intergenic
1035100682 7:156393843-156393865 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1035536169 8:392886-392908 TACAGGAGCAGGGCAGACAGTGG - Intergenic
1035914524 8:3604660-3604682 TACAGGAGGGGAAGAGCTAGAGG + Intronic
1037618899 8:20545777-20545799 AGGAGGAGCTGGGGAGCCAGGGG + Intergenic
1038225722 8:25655579-25655601 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1039536574 8:38320842-38320864 TTCAGGAGATGGGAAGCCAGTGG - Intronic
1039768123 8:40652432-40652454 AACAGGTGCTGGAGAGGAAGTGG + Intronic
1040707653 8:50149040-50149062 TACAGGTGCTGGAGAGGATGTGG - Intronic
1040800000 8:51329929-51329951 TTCAAAGGCTGGAGAGCCAGAGG + Intronic
1041653618 8:60326350-60326372 TACTGGAGCTGGGGAGGTAGAGG + Intergenic
1041665371 8:60439268-60439290 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1042263353 8:66883138-66883160 TTCAGGAGGTGGAGAGTGAGAGG + Intronic
1042456875 8:69015431-69015453 GACAGGAGATGGAGAGCATGGGG + Intergenic
1042482681 8:69322167-69322189 TCGTGGAGCTGGAGATCCAGTGG + Intergenic
1042482932 8:69324088-69324110 TTGTGGAGCTGGAGACCCAGGGG + Intergenic
1042483127 8:69325298-69325320 TTGTGGAGCTGGAGATCCAGGGG + Intergenic
1042766362 8:72326475-72326497 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1043696890 8:83231127-83231149 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1043890829 8:85651044-85651066 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043893659 8:85719459-85719481 AACAGGTGCTGGAGAGGTAGTGG + Intergenic
1043896340 8:85740908-85740930 AACAGGTGCTGGAGAGGTAGTGG + Intergenic
1043898663 8:85759267-85759289 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043900276 8:85771461-85771483 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043902238 8:85786736-85786758 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043903847 8:85798929-85798951 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043905458 8:85811123-85811145 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043907068 8:85823310-85823332 AACAGGTGCTGGAGAGGTAGTGG - Intergenic
1043915467 8:85917930-85917952 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1044178369 8:89158092-89158114 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1044234954 8:89820011-89820033 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1044619245 8:94172858-94172880 CACAGGAGATAGAGTGCCAGGGG + Intronic
1045097397 8:98812387-98812409 AACAGGTGCTGGAGAGGAAGTGG + Intronic
1045749772 8:105469470-105469492 TACACCAGCTGGAGAGCAATGGG - Intronic
1046007189 8:108500939-108500961 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1046541685 8:115591654-115591676 TACAGGTGCTGGAGAGCTGTAGG + Intronic
1047648015 8:126889216-126889238 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1047667549 8:127108403-127108425 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1047728621 8:127706708-127706730 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1047788702 8:128180081-128180103 TACAGAAGCTGTAGAACCATAGG + Intergenic
1048106368 8:131414839-131414861 TAGAGGTCCTGGAAAGCCAGTGG + Intergenic
1048108409 8:131438758-131438780 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1048387697 8:133927960-133927982 GACAGGAGGTGGAGCTCCAGTGG + Intergenic
1048532656 8:135264466-135264488 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1049091528 8:140518207-140518229 TGTAGGAGCTGCAGAGCCACTGG - Intergenic
1049682291 8:143924835-143924857 AACAAGAGCTGGAGAAGCAGCGG - Exonic
1051645713 9:19266097-19266119 TACAGGTGCTGGAGAGGATGTGG - Intronic
1051708788 9:19908831-19908853 AACAGGTGCTGGAGAGGCTGTGG + Intergenic
1053470863 9:38345470-38345492 GACAGGAGATGGAGAGACAGAGG - Intergenic
1054197713 9:62050467-62050489 CACAGGAGCTGGACATCAAGAGG + Intergenic
1055585454 9:77754638-77754660 CACAGGAGCTGGGGATCAAGAGG + Intronic
1056185624 9:84131753-84131775 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1056631783 9:88300009-88300031 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1056750289 9:89345675-89345697 TGCAGGAGGTGTAGAGCTAGAGG + Intronic
1057444346 9:95103496-95103518 GACAGGAGGTGGAGCCCCAGGGG + Intronic
1058204925 9:102092149-102092171 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1058217428 9:102252657-102252679 GAGAGGAGGTGGGGAGCCAGGGG + Intergenic
1059522992 9:114961495-114961517 AGCAGAAGCTGGAGAGCGAGGGG + Intergenic
1060407062 9:123378038-123378060 GACCGGAGCTGGAGAACCAGAGG - Exonic
1060543638 9:124448132-124448154 TACAGGGGGTGGGGAGCCTGAGG - Intergenic
1060596471 9:124852016-124852038 TGCCTGAGCAGGAGAGCCAGAGG + Intergenic
1060791257 9:126487073-126487095 CCCAGGAGGTGCAGAGCCAGGGG + Intronic
1061632947 9:131885047-131885069 TTCTGGACCTGGAGAGGCAGTGG - Intronic
1061927729 9:133814266-133814288 GACAGCATCTGGAGAGGCAGGGG - Intronic
1062497435 9:136838360-136838382 TCCAGGTGCTGCAGAGACAGGGG + Intronic
1203357729 Un_KI270442v1:175976-175998 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1203358069 Un_KI270442v1:181017-181039 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1203359268 Un_KI270442v1:197804-197826 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1185457533 X:318388-318410 AACAGGAGCTGGAGACCTGGGGG - Intronic
1185825574 X:3245927-3245949 GAGAGGCTCTGGAGAGCCAGAGG - Intergenic
1186145177 X:6617590-6617612 AACAGCAGCAAGAGAGCCAGAGG - Intergenic
1186564048 X:10643514-10643536 AACAGGTGCTGGAGAGCATGTGG + Intronic
1186634545 X:11388195-11388217 AACAGGTGCTGGAGAGGCTGTGG - Intronic
1186634754 X:11390813-11390835 AACAGGTGCTGGAGAGGCTGTGG + Intronic
1187622617 X:21075060-21075082 TCCAGGTTATGGAGAGCCAGAGG + Intergenic
1188096897 X:26034419-26034441 AACAGGTGCTGGAGAGGAAGTGG + Intergenic
1189045116 X:37582424-37582446 AACAGGTGCTGGAGAGCATGTGG - Intronic
1189098109 X:38161129-38161151 TACAGGACATGGAGAGACTGAGG + Intronic
1189584767 X:42447541-42447563 AACAGGTGCTGGAGAGGAAGTGG - Intergenic
1189980518 X:46505875-46505897 TCATGGAGCTGGGGAGCCAGTGG - Intronic
1192620034 X:72670022-72670044 AACAGGAGCTGGAGAGGATGTGG - Intronic
1192795139 X:74420422-74420444 TTCAGGTGCTGGAGACTCAGCGG - Intergenic
1193002484 X:76578469-76578491 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1193034870 X:76938463-76938485 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1193035434 X:76945416-76945438 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1193153912 X:78153084-78153106 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1193200199 X:78680605-78680627 CCCAGGAGCTGGAGAACCAAAGG - Intergenic
1193476420 X:81971949-81971971 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1193846847 X:86482678-86482700 AACAGGTGCTGGAGAGCATGTGG - Intronic
1193856328 X:86608266-86608288 AACAGGTGCTGGAGAGCATGTGG + Intronic
1193969304 X:88031843-88031865 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1194364795 X:93001958-93001980 TACAGGAGTTTGAGAGACATTGG + Intergenic
1194778956 X:97999191-97999213 TAGAGGAGATGGAGAGGTAGAGG + Intergenic
1195021775 X:100835441-100835463 TACAGGACCTAGAGGGCCACAGG - Intronic
1195648354 X:107258480-107258502 GGCAGGAGCAAGAGAGCCAGTGG + Intergenic
1196570999 X:117266157-117266179 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1196600551 X:117597220-117597242 AACAGGTGCTGGAGAGCATGTGG + Intergenic
1196617044 X:117778181-117778203 AACAGGTGCTGGAGAGCATGTGG - Intergenic
1196633011 X:117965229-117965251 AACAGGTGCTGGAGAGCATGTGG - Intronic
1198589397 X:138160079-138160101 AACAGGTGCTGGAGAGAAAGTGG + Intergenic
1198939249 X:141934885-141934907 TACGGGAGATGGGGAGCCATCGG - Intergenic
1199450428 X:147972920-147972942 AACAGGAGCTGGAGAGGATGTGG + Intergenic
1199983335 X:152933179-152933201 TGGAGGAGCTTGAGGGCCAGTGG - Intronic
1200204005 X:154302916-154302938 AGCAGTAGCTGGAGAGGCAGGGG + Intronic
1200673021 Y:6118216-6118238 TACAGGAGTTTGAGAGACATTGG + Intergenic
1200794652 Y:7329747-7329769 TACAGAAGCTGAGGAGTCAGGGG - Intergenic
1200989751 Y:9336703-9336725 CACAGGAGCTCGGGAGCCAGAGG + Intergenic
1200992419 Y:9357036-9357058 CACAGGAGCTCGGGAGCCAGAGG + Intergenic
1200995071 Y:9377314-9377336 CACAGGAGCTCGGGAGCCAGAGG + Intronic
1200997736 Y:9397660-9397682 CACAGGAGCTCGGGAGCCAGAGG + Intergenic
1201000246 Y:9466194-9466216 CACAGGAGCTCGGGAGCCAGAGG + Intergenic
1201002907 Y:9486506-9486528 CACAGGAGCTCGGGAGCCAGAGG + Intronic
1201005565 Y:9506789-9506811 CACAGGAGCTCGGGAGCCAGAGG + Intergenic
1201008226 Y:9527119-9527141 CACAGGAGCTCGGGAGCCAGAGG + Intergenic
1201010828 Y:9547304-9547326 GACAGGAGCTTGGGAGCCAGAGG + Intergenic
1201065047 Y:10089233-10089255 CTCAGGAGCTCAAGAGCCAGGGG - Intergenic
1201072462 Y:10160714-10160736 TACAGGTGCTGGAGAGGATGTGG - Intergenic
1201593890 Y:15645353-15645375 AACAGGTGCTGGAGAGGCTGTGG - Intergenic
1202115649 Y:21467368-21467390 CACAGGAGCTCGGGAGCCAGAGG + Intergenic