ID: 1143880673

View in Genome Browser
Species Human (GRCh38)
Location 17:10027324-10027346
Sequence CCAAATAAGCAGACAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143880673 Original CRISPR CCAAATAAGCAGACAGGGAA TGG Intronic
901669235 1:10845477-10845499 TCAAAGAAGAGGACAGGGAAAGG - Intergenic
902150419 1:14438423-14438445 CAGAATAAGGGGACAGGGAACGG + Intergenic
904688981 1:32279744-32279766 CCAAGTAAGGAGACTGGGGAGGG + Exonic
904782784 1:32963794-32963816 CCAAGTTAGGAGACAGGGAGAGG - Intronic
905565576 1:38961736-38961758 CCAAATGAGGAGACAGGGTAAGG - Intergenic
907654831 1:56332037-56332059 CCAAACCAGGAGAGAGGGAAAGG - Intergenic
909074818 1:71040276-71040298 CCAAATCAGAAGACAGGGTCTGG - Intronic
910633813 1:89384799-89384821 CCAAATTAGCACACAGTGTAGGG + Intronic
910828112 1:91430796-91430818 ACAAATAAGAAGAGAAGGAAGGG - Intergenic
912115290 1:106399270-106399292 CTAAAAAAGCTTACAGGGAAGGG + Intergenic
912667244 1:111593341-111593363 CCATATAACCAGAAAGGGAATGG - Intronic
914696060 1:150080952-150080974 CCATAGAAGCATACAGGAAATGG + Intronic
914921314 1:151849461-151849483 CTAAAGAAGCAGGGAGGGAAGGG - Intronic
915305907 1:154978187-154978209 CCAAATAGGGAGATAGGAAATGG + Intronic
915736776 1:158090241-158090263 CCAGAGGAGGAGACAGGGAAGGG - Intronic
915739147 1:158104948-158104970 CAAAAAAAGCTGACAGGGAGTGG + Intergenic
916305331 1:163323866-163323888 CCAAAAAAAAAGAGAGGGAAAGG + Intronic
916704380 1:167333362-167333384 CCAAATAAGAAGACAGTTATGGG + Intronic
917189263 1:172396470-172396492 CCAAAGAAGCAGGGAAGGAATGG - Intronic
920164925 1:204029085-204029107 GCAAGGAAGCAGACTGGGAACGG + Intergenic
920794494 1:209125453-209125475 CAAAATAAGGAGATAGGGAAAGG - Intergenic
921830970 1:219727172-219727194 ACAAATAGGCAGAAAGTGAAGGG + Intronic
923661629 1:235962171-235962193 CCAAATAAGAAAACAGAGTAGGG + Intergenic
923790094 1:237104441-237104463 CTAGACAAGGAGACAGGGAAAGG - Intronic
1063997748 10:11637146-11637168 CCAAATCAGGGGACAGTGAATGG + Intergenic
1066258338 10:33703859-33703881 GCAGATTAGGAGACAGGGAAGGG + Intergenic
1066798909 10:39161273-39161295 CCAAATATCCATTCAGGGAAGGG - Intergenic
1068157036 10:53213706-53213728 CCAATCAAGCAGACAAGTAAAGG - Intergenic
1068442923 10:57082708-57082730 CAAAAAAAGCAAACATGGAATGG + Intergenic
1068681021 10:59820133-59820155 CCAAAGAAGCAGAAAGGGAGTGG + Intronic
1068888136 10:62118607-62118629 ACAAATAATCAGACTGGCAAAGG - Intergenic
1071497339 10:86178319-86178341 GCAAATAGGCAGGCAGGGGAAGG - Intronic
1071660576 10:87498215-87498237 CCTAATAAGCAAACAAGTAATGG - Intergenic
1073007182 10:100333446-100333468 CAAAATAAGAAGAAAAGGAAGGG + Intergenic
1074801999 10:117009145-117009167 CCAAATATGCACAAAAGGAAAGG + Intronic
1074994569 10:118745254-118745276 ACAAAAAAGAAGACAGGAAAAGG + Intronic
1076234515 10:128853189-128853211 CCAACTTAGAACACAGGGAAGGG + Intergenic
1077117166 11:890372-890394 CCAACTCAGCAGTCAGAGAAAGG - Intronic
1078562024 11:12380435-12380457 CGAAATATGCAGACAGAGCAAGG + Intronic
1078991081 11:16647288-16647310 TCAAATTAGCAGAGAGGGAAAGG - Intronic
1080016197 11:27509281-27509303 ATAAATTACCAGACAGGGAAAGG - Intergenic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1082246990 11:49935369-49935391 CCCAACAAGCAATCAGGGAAAGG + Intergenic
1082294948 11:50429229-50429251 CCAAATATCCATTCAGGGAATGG - Intergenic
1082580052 11:54855345-54855367 ACTACTTAGCAGACAGGGAAAGG + Intergenic
1083490804 11:63014116-63014138 CCAAACAGGCAGTGAGGGAAAGG - Intronic
1083735324 11:64676893-64676915 CCAAAAAACCAAACAGGGAGAGG + Intronic
1085086047 11:73667893-73667915 CCAAAAAAGCAGAGAGGACAGGG + Intergenic
1085352011 11:75803906-75803928 ACAAATAAGTTGAAAGGGAAAGG - Intergenic
1085484093 11:76847326-76847348 CCAAAGTGGCAGAAAGGGAAGGG + Intergenic
1086160027 11:83711723-83711745 CCTAATAAAAAGACAGGCAATGG - Intronic
1087651445 11:100873141-100873163 GCAAAAGAGAAGACAGGGAAAGG + Intronic
1087947532 11:104181731-104181753 CCAAATAAAAAGACTGGTAAAGG - Intergenic
1088938510 11:114429099-114429121 TCAAATTAGAAGACAGGAAATGG + Intronic
1089646350 11:119882376-119882398 CTAAATGAAAAGACAGGGAAGGG - Intergenic
1090423910 11:126594025-126594047 CCAATAAAGCAGAAAGTGAAAGG - Intronic
1090709252 11:129371522-129371544 ACACATAGGCAGACATGGAAAGG - Intergenic
1091205775 11:133820012-133820034 CCAACTAGGCAGCCTGGGAAAGG - Intergenic
1093253405 12:16836399-16836421 TCCAATAAGGATACAGGGAAAGG - Intergenic
1093833783 12:23800826-23800848 ACAGATAAGCAAACAGGTAAAGG - Intronic
1094000448 12:25688656-25688678 CCACATAATCAGCCTGGGAAAGG - Intergenic
1094483123 12:30900869-30900891 CCAAAAAACAAGACAGAGAAGGG + Intergenic
1095190461 12:39251802-39251824 CCAAATCAACAGACAAAGAAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1096765258 12:53882676-53882698 CCCAGTAAGGAGACATGGAAAGG - Intergenic
1097181539 12:57174763-57174785 CCAAACAAACAAACAGGCAAGGG + Intronic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1099232219 12:80040057-80040079 AAAAAAAAGCAGACAGAGAAGGG - Intergenic
1100000729 12:89832044-89832066 CCAAAAATGTAGACAAGGAAAGG - Intergenic
1103259604 12:119575215-119575237 CCAAATGAGAAGCCAGGGGACGG + Intergenic
1103577889 12:121892208-121892230 GCCAATTAGAAGACAGGGAAAGG + Intronic
1104163628 12:126205036-126205058 CAAAAGAGTCAGACAGGGAAAGG - Intergenic
1104773893 12:131381370-131381392 CGAAACAGGCAGACGGGGAACGG - Intergenic
1104830240 12:131745856-131745878 CCGAATAAGCCTGCAGGGAATGG + Intronic
1104846212 12:131848374-131848396 CCAAAAAACCAGACCGGGAGTGG - Intronic
1106439032 13:29749275-29749297 CCAAATAAGGAAACCAGGAATGG - Intergenic
1107577644 13:41744504-41744526 ACAAATGAGCAGAAAGGGATGGG - Intronic
1108616405 13:52137859-52137881 CCAAAAAGTCAGTCAGGGAATGG - Intronic
1108690285 13:52853340-52853362 GCAAAGAAGCAGACAGGAAATGG - Intergenic
1108996301 13:56738122-56738144 CCAAATTAACAGACAGAAAATGG + Intergenic
1109355602 13:61228173-61228195 CCTAATATCCAGACAGGGAGAGG - Intergenic
1111570303 13:90075578-90075600 CCAAGAAAGGACACAGGGAATGG - Intergenic
1112054994 13:95682572-95682594 CAAAATAAGCAGCAAGGGCAGGG - Intronic
1112392713 13:98999941-98999963 CCAAATAACAAGGCAGGGAGTGG - Intronic
1115353667 14:32424436-32424458 TTAAATAAGCAGAGATGGAAGGG - Intronic
1115679713 14:35723026-35723048 CAAAAAAAGCACAAAGGGAAAGG - Exonic
1117062142 14:51973802-51973824 CCAAATGCACACACAGGGAAGGG - Intronic
1117512461 14:56466732-56466754 CAAAATAAGAAGGAAGGGAAAGG + Intergenic
1117898070 14:60508229-60508251 CAAAATAAGCCTACAAGGAAAGG + Intronic
1118854395 14:69610222-69610244 CCAAATGAGCAGGAAGGGAGGGG + Intergenic
1118984091 14:70738724-70738746 GCAAATAAGGAGGCAGGTAAGGG + Intronic
1119536258 14:75404891-75404913 CCCAATACACAAACAGGGAAGGG + Intergenic
1120483488 14:85082229-85082251 GCTAATGTGCAGACAGGGAAAGG + Intergenic
1120562432 14:86012238-86012260 CCAGATAAGAAGTCTGGGAAAGG + Intergenic
1120799394 14:88671584-88671606 CCAAATTAAAAGACAGAGAATGG + Intronic
1121266937 14:92610365-92610387 CCAAATAAACAGAGACAGAAAGG - Intronic
1202893483 14_KI270722v1_random:182068-182090 GCTACTTAGCAGACAGGGAAAGG + Intergenic
1124820018 15:33035574-33035596 CCAAATAAGAAAAGAGGGAGAGG - Intronic
1125448530 15:39783618-39783640 CCAAATAGGCAGTTAGGTAAAGG - Intergenic
1125530186 15:40408050-40408072 CAAAAGAAGCAGGAAGGGAAGGG + Intronic
1129460640 15:75698515-75698537 CCAACCAAGCAGGCAGGGCATGG + Intronic
1129923243 15:79338887-79338909 ACTACTAAGCAGACCGGGAAAGG + Intronic
1129944656 15:79528202-79528224 CCAGATAAGCAGGAAGGGAGAGG + Intergenic
1130241384 15:82196128-82196150 CAGAAGAAGCAGACAGTGAAGGG + Intronic
1130726878 15:86448292-86448314 CCAAAAAAGGAGACAGGAAATGG - Intronic
1131737997 15:95354885-95354907 CTGAATAAGAAGACAGGGCAGGG + Intergenic
1131835807 15:96389680-96389702 CCAAAAAAGGAGAAAGGGAATGG + Intergenic
1131907656 15:97161475-97161497 CCAAAAAAGCAGCCAGGCCAGGG - Intergenic
1135667110 16:24345265-24345287 CCAGCTACACAGACAGGGAAAGG + Intronic
1136048832 16:27636400-27636422 CCAAAGAACCAGACGGGAAATGG - Intronic
1136410224 16:30072201-30072223 CAAAATAAGCAGAAAAGGGAAGG - Intergenic
1137229896 16:46554637-46554659 GCTACTTAGCAGACAGGGAAAGG + Intergenic
1137386617 16:48048232-48048254 CAAAAGAAGCACACAGTGAAAGG - Intergenic
1137839182 16:51624352-51624374 CCAAATGAGCCGGCAGGAAACGG - Intergenic
1139332418 16:66203720-66203742 CCAACTAAGAGGACAGGGTAGGG + Intergenic
1139823409 16:69738571-69738593 CCAAATAACCAGGCCGGGCATGG - Intergenic
1140093058 16:71852827-71852849 CCAACTTTGCAGACAAGGAAAGG - Exonic
1140376740 16:74450900-74450922 CCAAATCTGCAGACAACGAATGG + Intergenic
1140737217 16:77908919-77908941 CAAAATAAAAAGACAGGAAAAGG + Intronic
1141726006 16:85788845-85788867 ACAAATAAGCACAGAGGGAAGGG + Intronic
1143247190 17:5496983-5497005 TATACTAAGCAGACAGGGAAAGG + Intergenic
1143716388 17:8773700-8773722 ACAAAGAAGCAGGGAGGGAACGG - Intergenic
1143880673 17:10027324-10027346 CCAAATAAGCAGACAGGGAATGG + Intronic
1144426063 17:15143535-15143557 CCAAAGAACCAGAGGGGGAAAGG + Intergenic
1146605504 17:34254367-34254389 CCAAATGGGCAGACAGCTAAAGG - Intergenic
1147574031 17:41588414-41588436 CCAAAGAAGAAGCCAGAGAAGGG + Intergenic
1147653983 17:42078082-42078104 CCAAATAATGAGACAGGCACTGG + Intergenic
1148333371 17:46825279-46825301 GGACATAAGCAGGCAGGGAAGGG + Intronic
1150143486 17:62749713-62749735 CCTAATAAGTAGGCAGGAAAGGG + Intronic
1151726840 17:75890401-75890423 CCAAAGGAGCAGTCAGGGAGGGG - Exonic
1152792351 17:82288184-82288206 CCACATGAGGACACAGGGAAAGG + Intergenic
1153852247 18:9106331-9106353 CCAAACAGGCAGACACAGAAGGG - Intronic
1154471709 18:14709529-14709551 GCAAGTAAGCAGAGAAGGAATGG - Intergenic
1155070761 18:22314013-22314035 TCAGATCAGCAGCCAGGGAAGGG + Intergenic
1155228948 18:23755412-23755434 GCAAACCAGCAGACAAGGAAAGG - Intronic
1156218852 18:35030482-35030504 CCAAATAACCAGACAGGAAGTGG - Intronic
1157431664 18:47633106-47633128 CCTAAAAAGAAGACAGGGAAGGG - Intergenic
1157878920 18:51299932-51299954 GCAAAGTAGCAGACAGAGAAGGG - Intergenic
1158010928 18:52726543-52726565 CCAAATAACTAGAGAAGGAAGGG - Intronic
1158654344 18:59315782-59315804 CAAAATAATCAGACCAGGAACGG - Intronic
1161191564 19:2960075-2960097 TCAAATAAGAAGACAGAGAGCGG + Intergenic
1161912222 19:7202944-7202966 CCAAAAAAGCAGACATTGTACGG - Intronic
1161919389 19:7254886-7254908 CCAAGTTAGCAGACAGCCAAAGG + Intronic
1162876424 19:13624098-13624120 CCACAAAAGCAGACACTGAACGG + Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1166245802 19:41524729-41524751 CCTAATATCCAGAAAGGGAAAGG - Intergenic
1166975830 19:46604499-46604521 CCAAATAGGCAGAATGGGAGGGG - Intronic
1167978621 19:53254304-53254326 CCAAATGAGCAGAAAGGGACAGG - Intronic
1168483583 19:56741482-56741504 CCAAATATACATACAGGCAATGG - Intergenic
925418344 2:3690055-3690077 ACAAATAGGCTGACAGTGAAAGG - Intronic
925792056 2:7499619-7499641 TGTAGTAAGCAGACAGGGAATGG - Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926068998 2:9869511-9869533 ACAAATAAGCAGGCCGGGCACGG - Intronic
928243057 2:29603265-29603287 AAAAATACGTAGACAGGGAAGGG + Intronic
928953381 2:36835179-36835201 CCAAAGACGCAGACAAAGAATGG + Intergenic
929857195 2:45647324-45647346 CAAAATAAGAAGACATGGCAGGG + Intergenic
931705272 2:64941904-64941926 CCCAACAAGCAGAGAGGGCAAGG - Intergenic
932465889 2:71923871-71923893 CCAAATAAATAGTCAGGGGATGG + Intergenic
933828731 2:86188726-86188748 CCAAATAAAAATACAGGCAAAGG - Intronic
935498879 2:103813931-103813953 TCAAAGAAGCAGTCAGGCAAGGG + Intergenic
936020254 2:108989200-108989222 CCAAACTTGCAGACAGGGCAGGG - Exonic
936534824 2:113303989-113304011 GGCAATAAGCAGCCAGGGAAAGG - Intergenic
936585722 2:113756351-113756373 CCAGGTAGGCAGGCAGGGAAGGG - Exonic
936971804 2:118183743-118183765 CCAAGTCAGCATCCAGGGAACGG + Intergenic
937279991 2:120711208-120711230 CCTTAAAAGAAGACAGGGAAGGG + Intergenic
937349333 2:121150490-121150512 CCATGAAAGCACACAGGGAAAGG - Intergenic
938789043 2:134660374-134660396 CCAAAGCAGCAGAGAGGGAGAGG + Intronic
939657114 2:144840244-144840266 TCAAATCAGCAGACAGAAAATGG - Intergenic
939959385 2:148552867-148552889 ACAGCTGAGCAGACAGGGAAGGG + Intergenic
940009787 2:149040571-149040593 CCATCTCAGCAGACAGGGAGAGG + Intronic
940895574 2:159079651-159079673 CCAAATCAATAGAAAGGGAAAGG + Intronic
942983749 2:182114117-182114139 CAAAATGAGCACACAGGAAAAGG - Intronic
944656092 2:201878037-201878059 CCAATTAAGCAGACATAGATGGG - Intronic
944865781 2:203860115-203860137 AGAAATAAACAGAAAGGGAAGGG - Intergenic
945965528 2:216182433-216182455 CCAAATGAGCAGTAGGGGAAAGG - Intronic
946744889 2:222835847-222835869 CTAAAGCTGCAGACAGGGAATGG - Intergenic
946982367 2:225231255-225231277 CCAAATATGCAAATAGGGAAAGG + Intergenic
947274193 2:228372263-228372285 CCATATAAGCTAACAGGGATGGG + Intergenic
947444630 2:230154651-230154673 TCAGATTGGCAGACAGGGAAGGG + Intergenic
1169961734 20:11167834-11167856 CTTCATAAGCTGACAGGGAAAGG - Intergenic
1170131899 20:13029845-13029867 CCTAATAAACACACAGAGAAGGG + Intronic
1170978514 20:21189194-21189216 CCAAATCAGCAGCCATAGAAGGG - Intronic
1172762760 20:37333649-37333671 GCAAAGAAGCAGGAAGGGAAAGG - Intergenic
1173147847 20:40540589-40540611 CCACAGCTGCAGACAGGGAAGGG + Intergenic
1174123825 20:48288095-48288117 CCAAAAGAGAGGACAGGGAAAGG - Intergenic
1176802779 21:13448383-13448405 GCAAGTAAGCAGAGAAGGAATGG + Intergenic
1178572668 21:33754712-33754734 ACACATAAGCAGAGTGGGAATGG - Intronic
1180136123 21:45863135-45863157 ACAAAGAAGAAAACAGGGAAAGG + Intronic
1181894082 22:26091389-26091411 ACTAAGAATCAGACAGGGAAGGG + Intergenic
1182120763 22:27785107-27785129 TCAAACAAGCAAACAAGGAAAGG + Intronic
1182274654 22:29179303-29179325 CCATATAATCAGACAAGAAAAGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182805228 22:33064100-33064122 CCAAATCAGTTGACAGGGAGCGG + Intergenic
1183098741 22:35570505-35570527 CCAAATAACCACGCAGGTAAAGG + Intergenic
1184953407 22:47862441-47862463 CCTAAGAATCAAACAGGGAAGGG + Intergenic
949216046 3:1568358-1568380 CCTAATAATCTGACAGTGAAGGG + Intergenic
949523554 3:4879841-4879863 CAAAATCAGCAAACAGTGAAAGG + Intronic
949523770 3:4882732-4882754 ATAAATAAGGAGAAAGGGAAAGG + Intronic
950043551 3:9934902-9934924 CCAAATACAAAGACAGGTAAGGG + Exonic
951700307 3:25489715-25489737 CCAAAGAACAAGGCAGGGAAAGG + Intronic
952113789 3:30155702-30155724 CCAAATAAGCACACATGGTATGG - Intergenic
953658248 3:44871176-44871198 ACAAATAAGCAAACAGGACAGGG - Intronic
953729337 3:45431942-45431964 ACAAATAAGCTGAAAGTGAAAGG + Intronic
954447620 3:50555182-50555204 TCAAATCTGCAGACAGGGGAGGG - Intergenic
955367789 3:58326441-58326463 CCAAAAAAGGAGGCAGGGCATGG - Intergenic
955719162 3:61863581-61863603 GCAAATAAGCAGAAAAGGCAAGG - Intronic
956125357 3:66005838-66005860 ACAAATAAACAGAGAGGGAAAGG + Intronic
956335019 3:68154082-68154104 CCAAATAAGCAATCAGACAATGG - Intronic
956504175 3:69920285-69920307 ACTACTTAGCAGACAGGGAAAGG + Intronic
956896193 3:73662735-73662757 CCAAAGAAGAAGAGATGGAATGG + Intergenic
957799773 3:85061409-85061431 TCAAATAAGCAAACATTGAAAGG - Intronic
958151505 3:89699423-89699445 CCTCACAAGCAGACAGGGAGAGG + Intergenic
958537661 3:95425109-95425131 CCATGAAAGCAGCCAGGGAAGGG - Intergenic
958722525 3:97862054-97862076 GCAAAGAAGCAGACAGTTAAGGG + Intronic
958722887 3:97867178-97867200 GCAAAGAAGCAGACAGTTAACGG + Intronic
964289570 3:155162370-155162392 CCAAAGAAGCACACAGAAAAAGG + Intronic
965368686 3:167832723-167832745 CCAGATAAGGGGACAGGGTAAGG - Intergenic
965431969 3:168599962-168599984 AAAAAAAAGCAGACAGGGGATGG + Intergenic
965673628 3:171172724-171172746 CCATATTGTCAGACAGGGAAAGG - Intronic
967692835 3:192496742-192496764 CACAATACGCAGACTGGGAATGG - Intronic
968027678 3:195456252-195456274 CCAAGGATGCACACAGGGAAGGG - Intergenic
968714065 4:2141504-2141526 CCAACAGAGCAGACAGGGCAAGG - Intronic
969531979 4:7735259-7735281 CCAAATAAGCCGAAAGGAAGGGG - Intronic
970804738 4:20017645-20017667 CCAAATGATGAGACAGAGAAAGG - Intergenic
971042897 4:22774971-22774993 CCAAATAAGCATCCAAGAAATGG + Intergenic
971552501 4:27975191-27975213 CCAAAAAAGGAGTCAGTGAAGGG - Intergenic
971969090 4:33598723-33598745 CCAAAGAAACAGAAAGGGATGGG + Intergenic
972364950 4:38365833-38365855 CCAAAAATGCAGACAGGCAGTGG - Intergenic
972675431 4:41256120-41256142 CCAATGAAGAAGAAAGGGAATGG - Intergenic
972944715 4:44240320-44240342 CAAAGTAAGGGGACAGGGAAAGG - Intronic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
976367662 4:84247812-84247834 CCAAATATGCAGAGGTGGAAAGG - Intergenic
977033649 4:91921171-91921193 GCAAATAAGAATACAGGAAATGG - Intergenic
977866849 4:102039013-102039035 TCAGATAAGCAGAGATGGAAAGG - Intronic
978303482 4:107295562-107295584 CCAAAAAAGGAGTCAGTGAAGGG + Intergenic
978686421 4:111450435-111450457 TCAGATAAGCAGATAAGGAAGGG - Intergenic
979193792 4:117895789-117895811 CGAATGAAGCAAACAGGGAAAGG + Intergenic
981440978 4:144781429-144781451 GCAAGTATGCAGACAAGGAAGGG - Intergenic
982093811 4:151902514-151902536 CCAAAAAAGGAGTCAGCGAAGGG + Intergenic
983406656 4:167339512-167339534 TCAAATAAGGAGGCAGGAAAAGG - Intergenic
984566899 4:181342064-181342086 CCAAGAAAGCAGACAAGCAACGG - Intergenic
984640414 4:182158681-182158703 AGAGATAAGCAGACAGGGATGGG - Intronic
984798499 4:183689494-183689516 CCAAATAATCACACAGACAACGG - Intronic
986931221 5:12824387-12824409 CCAAATAATCATTCAGGGGAAGG + Intergenic
989000014 5:36750188-36750210 GCAAATAAGCAAACTGGGACTGG + Intergenic
989238955 5:39181567-39181589 TCAAATAAGCAGGCAGTGCAAGG - Intronic
990316826 5:54590661-54590683 CCAACTAAGCAGACATTAAATGG + Intergenic
990686569 5:58309560-58309582 CCAAATAAACAAACAGAAAAAGG - Intergenic
991293868 5:65060805-65060827 CTAAATAAGCAGAATGGTAAGGG + Intergenic
991325801 5:65430651-65430673 CAAAATGAACAGACAGGCAAGGG + Intronic
991482392 5:67095382-67095404 CCAAACAAGTAGAAAGGGAATGG - Intronic
994395510 5:99223216-99223238 CCTAATAAGCAGGGAGGGGAAGG - Intergenic
995478226 5:112569322-112569344 CCCTCTAAGCAGACAGAGAATGG + Intergenic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
997843142 5:137260626-137260648 TAAAATAAGCAAACAGGCAAAGG + Intronic
998624101 5:143825907-143825929 CCAAACAAAGAGATAGGGAATGG - Intergenic
999122127 5:149217707-149217729 CTAAATAGGCAGACAGGGAGGGG - Intronic
999275776 5:150329119-150329141 CCAAAGAGGCAGTCAGGGGAAGG - Intronic
1000722657 5:164727699-164727721 CCACAGAACCAGACATGGAAAGG + Intergenic
1002533204 5:179861587-179861609 ACAAACAAGCAGACCGGGCATGG + Intronic
1002977939 6:2104169-2104191 CAAAATAAAGAGACAGTGAAGGG - Intronic
1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG + Intergenic
1005047160 6:21653388-21653410 CTAAAAAAGCAGACAGGAAAAGG + Intergenic
1006422219 6:33942148-33942170 CCTAAAAAGGAGGCAGGGAATGG + Intergenic
1008359517 6:50598921-50598943 CTGAAAAAGCAGCCAGGGAAAGG + Intergenic
1009564329 6:65292758-65292780 AAAAATTAGCAGACAAGGAAAGG + Intronic
1011246871 6:85328743-85328765 CCAAATAAGCACACAGCCAAAGG + Intergenic
1012406270 6:98902754-98902776 ACAAACAGGCAGGCAGGGAAAGG + Intronic
1012444247 6:99292048-99292070 CAAAATAAGCAGATGAGGAAGGG + Intronic
1012634134 6:101514412-101514434 CCCCATATGGAGACAGGGAAGGG + Intronic
1012683987 6:102220410-102220432 CCATTTACTCAGACAGGGAAAGG + Intergenic
1012774275 6:103481782-103481804 CCTAATAATCAGAAAGGGAGAGG - Intergenic
1012926842 6:105275873-105275895 CTAAAAAAGCAGGCAGAGAAAGG + Intergenic
1014372823 6:120633899-120633921 TCACAGAAGCAGAGAGGGAATGG + Intergenic
1014585828 6:123196674-123196696 CCATTAAAGCAGACAGTGAAAGG - Intergenic
1014972907 6:127840897-127840919 CAAAATATGGAGACAGGAAAAGG + Intronic
1018108060 6:160507866-160507888 TCAAATAAGAAGACAGTGCAGGG - Intergenic
1018547559 6:164954619-164954641 AGAAATAAGTTGACAGGGAAGGG - Intergenic
1020839708 7:13200303-13200325 CCTACTTAGCAGTCAGGGAAAGG + Intergenic
1021526690 7:21595896-21595918 CCAAAGATGCAGAAAAGGAAAGG + Intronic
1021887188 7:25150974-25150996 CCAAATATGCAGAGAGTAAATGG - Intronic
1022098130 7:27153368-27153390 ACAATTATGCACACAGGGAAGGG + Intergenic
1022835802 7:34113380-34113402 CCATATAAGCATAAATGGAAAGG - Intronic
1024086800 7:45900093-45900115 CCAAAGAAGCAGTAAGAGAAAGG - Intergenic
1024444127 7:49456058-49456080 CCAAATAAGCATTCAGTGAGTGG - Intergenic
1024881179 7:54087238-54087260 CCAAGTAAGGATAAAGGGAAGGG - Intergenic
1024924877 7:54602001-54602023 CCAAACCAGCAAACAGAGAAAGG + Intergenic
1025528463 7:61844941-61844963 CCAAATATGCATACACAGAATGG + Intergenic
1027003980 7:74676033-74676055 CCAAATAAAAAGACAGAGAATGG + Intronic
1029301098 7:99582908-99582930 CCAAATATCCAGATGGGGAAAGG - Intronic
1031302896 7:120085964-120085986 CCAGAGAAACAGAAAGGGAATGG + Intergenic
1031849887 7:126851074-126851096 CCCAATAAGCAGATTGGGAGGGG - Intronic
1031897644 7:127369873-127369895 ACAAGCAAGCAGAGAGGGAAAGG + Intronic
1032143929 7:129361299-129361321 CCATTTAAGCAGAAAGGTAAAGG - Intronic
1032326984 7:130938180-130938202 CAAAATAAAAAGACAGGGCACGG - Intergenic
1032885467 7:136133589-136133611 GCAAATAAGAAGACAGAGGAGGG - Intergenic
1033115559 7:138621566-138621588 AAAAATAAGAACACAGGGAATGG - Intronic
1035161175 7:156950765-156950787 CAAAATAACGGGACAGGGAATGG + Intronic
1035960925 8:4137076-4137098 CAAAATAAGCAGACAACTAAGGG - Intronic
1036535494 8:9646667-9646689 CCAAATAATCATACAGTGCATGG + Intronic
1037718399 8:21419370-21419392 TCAGAAAAGCAGACAGGCAAAGG - Intergenic
1041404523 8:57483417-57483439 ACAAATAAGCAGAACTGGAAAGG + Intergenic
1041632919 8:60108358-60108380 CAAAATGATGAGACAGGGAAAGG + Intergenic
1043635258 8:82376179-82376201 CCTAATATCCAGAAAGGGAAAGG + Intergenic
1044587574 8:93882324-93882346 CCAAATAAGCAGAAAGGCTAAGG + Intronic
1047132369 8:122035843-122035865 ACACAAAATCAGACAGGGAAAGG - Intergenic
1047470533 8:125167307-125167329 CAGAATAAGCAGTTAGGGAAGGG + Intronic
1050588534 9:7138864-7138886 ACAAATCAGCAAAAAGGGAAGGG + Intergenic
1051721970 9:20046683-20046705 CCTAAGAAGCAGAGATGGAAAGG + Intergenic
1051830300 9:21268417-21268439 CCAGAAAAGCAGAGAGGAAATGG + Intergenic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1052969662 9:34369697-34369719 ACCAATAAACAGACAGGGGAAGG - Exonic
1053108739 9:35438328-35438350 CCAAATTGGGAGACAGGGACAGG + Intergenic
1055056594 9:72029846-72029868 CCACTTAACCAGACAGGCAAGGG + Intergenic
1055078912 9:72247474-72247496 CCCAAGAAAAAGACAGGGAAAGG - Intronic
1055113449 9:72582923-72582945 ACAAATAAACAGACAGGGCTGGG + Intronic
1055667600 9:78568166-78568188 ACAAATAAGCTGATGGGGAACGG + Intergenic
1057795004 9:98149550-98149572 CCAATCATGCAGACAGTGAAGGG + Intronic
1057839901 9:98477880-98477902 CCCATGAAGCAGACAGGGTACGG + Intronic
1057898494 9:98929178-98929200 CCAAATATGCAAAAAGGGGAAGG - Intergenic
1058352141 9:104038599-104038621 GCAGATAGGGAGACAGGGAAAGG + Intergenic
1058492992 9:105522336-105522358 CAAAAAAAGCACAAAGGGAAAGG + Intronic
1060422535 9:123479698-123479720 CCAAGTGGGCAGACAGGGAAAGG - Intronic
1061100985 9:128492331-128492353 CCAAAGAACCAGAAAAGGAAAGG - Intronic
1062477244 9:136734558-136734580 GCTACTTAGCAGACAGGGAAAGG - Intergenic
1062484248 9:136766705-136766727 GCTACTTAGCAGACAGGGAAAGG + Intergenic
1062557187 9:137118960-137118982 GCTACTTAGCAGACAGGGAAAGG + Intergenic
1062588494 9:137262263-137262285 GCTACTTAGCAGACAGGGAAAGG - Intronic
1062645472 9:137545906-137545928 GCTACTTAGCAGACAGGGAAAGG + Intronic
1185888193 X:3801782-3801804 CCACATAAGAAGGCAGGGACTGG + Intergenic
1186146776 X:6632377-6632399 CCACATGAGGACACAGGGAAAGG - Intergenic
1186886957 X:13923292-13923314 CATCATCAGCAGACAGGGAATGG + Intronic
1187613956 X:20972904-20972926 CCAAAGAAGCAGAAAGTGATTGG - Intergenic
1188201263 X:27294638-27294660 CCAAGAAAGCAGTCAGCGAAGGG + Intergenic
1188366037 X:29316161-29316183 CCAAGAAAGCAGTCCGGGAATGG - Intronic
1188523981 X:31070423-31070445 CCAAATAACCAGCCCTGGAAGGG - Intergenic
1188843355 X:35043316-35043338 CCAAAGACACAGGCAGGGAAAGG + Intergenic
1190106430 X:47564343-47564365 CCAACTCAGCAGACAGAGAATGG - Intronic
1191986020 X:66982246-66982268 CCATGAAAGCAGCCAGGGAAGGG - Intergenic
1192025597 X:67447719-67447741 TGAAATAAGCAGGAAGGGAAAGG + Intergenic
1193070098 X:77297682-77297704 CCAAACTAGAAGACAGGTAAGGG + Intergenic
1193139645 X:78014022-78014044 CCCAATAAACACACAGGCAAAGG - Intronic
1196734596 X:118973420-118973442 ACAAATGAGCAGACAGAAAACGG - Intergenic
1197089089 X:122515519-122515541 CCAAATAAGCACAATCGGAAAGG + Intergenic
1197882231 X:131178851-131178873 CCACAGAAGCAGGCAGGGTAAGG - Intergenic
1198287945 X:135211174-135211196 ACAGATAAGCAGACAGCAAAAGG - Intergenic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1199973287 X:152876255-152876277 CCAAAGTTTCAGACAGGGAAAGG + Intergenic
1200830728 Y:7686847-7686869 CAAAAAATGCAGACAGGAAAAGG - Intergenic
1201933497 Y:19379911-19379933 ACAAATAAACACACAGGGCAAGG - Intergenic