ID: 1143881247

View in Genome Browser
Species Human (GRCh38)
Location 17:10031662-10031684
Sequence CTGTACGAATGTAAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143881243_1143881247 23 Left 1143881243 17:10031616-10031638 CCTCCTCTGACTCTGGAGAATGA 0: 1
1: 0
2: 2
3: 17
4: 246
Right 1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1143881244_1143881247 20 Left 1143881244 17:10031619-10031641 CCTCTGACTCTGGAGAATGAGAT 0: 1
1: 0
2: 2
3: 19
4: 337
Right 1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1143881242_1143881247 27 Left 1143881242 17:10031612-10031634 CCTTCCTCCTCTGACTCTGGAGA 0: 1
1: 0
2: 3
3: 50
4: 492
Right 1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1143881241_1143881247 28 Left 1143881241 17:10031611-10031633 CCCTTCCTCCTCTGACTCTGGAG 0: 1
1: 0
2: 5
3: 43
4: 483
Right 1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143881247 Original CRISPR CTGTACGAATGTAAGACAGA AGG Intronic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
909761892 1:79299055-79299077 CTGTGGGAATGTAAGATAGATGG - Intergenic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
917489311 1:175484120-175484142 TTGTATGAATGGAAGTCAGATGG + Intronic
924329155 1:242925058-242925080 CTGGACTCATGTAAGAAAGAAGG + Intergenic
1065475417 10:26131991-26132013 GTGTACGAATGTAATAGCGAAGG - Intronic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1070165251 10:73892730-73892752 CTGTGCGAATGTACAGCAGAGGG - Intergenic
1075909116 10:126108166-126108188 CTGTACCAATGTAACCCTGAGGG - Intronic
1076976751 11:178161-178183 CTGTAGCAAAGTCAGACAGAAGG - Intronic
1078344256 11:10530630-10530652 CTGTACCAAGGTGAGACTGATGG - Exonic
1087733934 11:101810459-101810481 CTGAACGAGGGTAAGAAAGATGG + Intronic
1088174715 11:107039313-107039335 CTGTAAAAATGGAAGTCAGAGGG - Intergenic
1089905043 11:122029995-122030017 ATGTAAAAATGTAAGACACATGG + Intergenic
1090366487 11:126211205-126211227 CGGTACGCAGGTTAGACAGATGG - Intronic
1098925157 12:76341422-76341444 CTGGTGGAATGTAAGATAGAGGG + Intergenic
1100366559 12:93926437-93926459 CTGTAAGAATTAAAGAAAGAGGG - Intergenic
1103045959 12:117734798-117734820 CTGTACCACTGTATGCCAGATGG - Intronic
1108960249 13:56217826-56217848 CTCTACCAACGTAAGAAAGAAGG - Intergenic
1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG + Intergenic
1111129157 13:83952176-83952198 CAGTAAGGTTGTAAGACAGAAGG + Intergenic
1117364698 14:55014407-55014429 TTGTAAGAATGTAAGAAAGATGG + Intronic
1125580830 15:40784235-40784257 CAGTAAGAAAGCAAGACAGAAGG + Intronic
1129336890 15:74857643-74857665 CTTTATGAATGGCAGACAGAAGG + Intronic
1138770852 16:59661825-59661847 ATGTATGAATGTAGGACAGAAGG + Intergenic
1142443665 16:90120013-90120035 CTGTAGGAAAGTCAGACAGAAGG + Intergenic
1142463763 17:115202-115224 CTGTAGCAAAGTCAGACAGAAGG - Intergenic
1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG + Intronic
1149399104 17:56275763-56275785 CTGTTGAAATGAAAGACAGAAGG + Intronic
1152947120 17:83203923-83203945 CTATGAGAAAGTAAGACAGAGGG - Intergenic
1153394007 18:4596919-4596941 CTATAAGAATGGAAAACAGATGG - Intergenic
1159131488 18:64285161-64285183 TTGTACAAATGTAACACAGAAGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1167905163 19:52654073-52654095 CTGCACGAATTTCAGACTGAAGG - Intronic
927162910 2:20286008-20286030 CAGTACGACTGAAAGAGAGACGG + Intronic
930327004 2:49932631-49932653 ATGGAAGAATGTAAGAAAGAAGG - Intronic
933294524 2:80473964-80473986 GGGCAGGAATGTAAGACAGATGG - Intronic
939914179 2:148020330-148020352 CGGTCCGAGTGTAAGAGAGAAGG - Intronic
942223273 2:173791928-173791950 CTATAAGAATGTAAGAGAAAGGG - Intergenic
944025599 2:195162612-195162634 CTCTAGGTATTTAAGACAGAGGG - Intergenic
947003376 2:225484249-225484271 CTGTAGGACTGTAAGAAGGATGG + Intronic
1169882548 20:10363102-10363124 CTCTATGGATATAAGACAGAGGG + Intergenic
1172298808 20:33833351-33833373 CTGTTTGAATGTACAACAGAAGG - Intronic
1173176384 20:40767861-40767883 TTATACGCATGTAAGACAGCAGG - Intergenic
1177078144 21:16604322-16604344 CTTTAGGATTGTACGACAGAAGG - Intergenic
1183400548 22:37601327-37601349 CTGAATGAGTGTGAGACAGAAGG - Intergenic
951401030 3:22231641-22231663 CAGTAGGTATGGAAGACAGAAGG - Intronic
954929015 3:54264007-54264029 CTGTATGGATGTAACATAGAAGG - Intronic
955562679 3:60209474-60209496 GAGTAGGAATGTAAGAAAGATGG - Intronic
955665407 3:61344617-61344639 ATGTGCGAATGAAGGACAGAAGG - Intergenic
957270446 3:78024014-78024036 CTTTATGAAGGTAAAACAGAGGG + Intergenic
960221781 3:115120543-115120565 CAGGATGAATGTAAGCCAGACGG + Intronic
960499159 3:118414725-118414747 CTGTACGAAGGTAAAAGTGAGGG - Intergenic
963768542 3:149364779-149364801 CTGTACACATGTAACAAAGAGGG + Intergenic
965233529 3:166085243-166085265 CTGTACGAAAGTACAACAGGTGG + Intergenic
966542526 3:181107693-181107715 CTGTACAACTGTAAGACTTAGGG + Intergenic
968363957 3:198171062-198171084 CTGTAGCAAAGTCAGACAGAAGG + Intergenic
970250488 4:14110441-14110463 CATTACAAATTTAAGACAGAAGG - Intergenic
972822270 4:42715273-42715295 CTCTAGGAATGTAACCCAGAAGG - Intergenic
978625933 4:110685143-110685165 ATGCAAGAAAGTAAGACAGAGGG - Intergenic
980137536 4:128873110-128873132 CTGTACTATTGGAAGCCAGATGG - Exonic
983252006 4:165355857-165355879 CTCTAAGACTGTAATACAGAAGG + Intergenic
986117463 5:4791926-4791948 CTTTCCAAATGTAAGATAGATGG - Intergenic
987854804 5:23406984-23407006 CAGTTCAACTGTAAGACAGATGG - Intergenic
989156641 5:38350845-38350867 CTGTAGGAATGTACAACACAGGG + Intronic
990086528 5:51985608-51985630 CTGTTTGAAGGTAAGACAGCAGG - Intergenic
993407875 5:87534546-87534568 CTGTACAGATGAAAGCCAGAAGG - Intergenic
993597799 5:89881377-89881399 CTTTAAGATTGTAAGACTGAAGG + Intergenic
993748889 5:91641199-91641221 TTGTAAGAATGTAAGATTGAGGG - Intergenic
994587462 5:101727846-101727868 CTGTACGAACCTGAGACAAATGG - Intergenic
998323797 5:141260137-141260159 CTTTATGCATGTAAGAAAGATGG + Intergenic
1011726314 6:90213750-90213772 CTGTATGTATGTAAGGCAGCGGG - Intronic
1019251857 7:18602-18624 CTGTAGGAAAGTCAGACAGAAGG - Intergenic
1022744574 7:33157463-33157485 CTGAAGAAATGAAAGACAGAAGG - Intronic
1023983375 7:45082095-45082117 CTGGAGGAAGGTAAGGCAGAGGG - Exonic
1024468018 7:49734411-49734433 CTCTATGCATGTAAGACAGATGG - Intergenic
1027487973 7:78785931-78785953 CACTATGAATGTGAGACAGAGGG + Intronic
1028334275 7:89631533-89631555 CTGTCTGAATGTCAGACAAATGG - Intergenic
1032305242 7:130727471-130727493 CTCTACGTAAGTCAGACAGAAGG - Intergenic
1032875092 7:136029909-136029931 CATTAGGAAGGTAAGACAGATGG + Intergenic
1037104787 8:15094070-15094092 CTGAAAGAAAATAAGACAGAGGG + Intronic
1038909963 8:31952006-31952028 CTGTAGGAAAGTAAGACAGTCGG - Intronic
1039855622 8:41410003-41410025 ATGTATGAATGTAAGAAAAATGG - Intergenic
1042198995 8:66261006-66261028 CTGTAAAAATGAAAGACAAAGGG + Intergenic
1047709716 8:127539440-127539462 CTGTACCAAGGTTAGAGAGAAGG - Intergenic
1051016772 9:12486551-12486573 CTGTATTAATTTCAGACAGAGGG + Intergenic
1052340849 9:27362857-27362879 CTGGACGTCTGTAAGGCAGAAGG - Intronic
1061650637 9:132046458-132046480 CTGGATGCAAGTAAGACAGAGGG + Intronic
1062748655 9:138235007-138235029 CTGTAGGAAAGTCAGACAGAAGG + Intergenic
1189102626 X:38207086-38207108 CTTTGCTAATGAAAGACAGAGGG - Intronic
1192667605 X:73104035-73104057 CTGCACCCATGTAAGACAGCAGG + Intergenic
1194414519 X:93593910-93593932 CTGTACGTATGCACAACAGAAGG + Intergenic
1194589771 X:95785639-95785661 CTGTAAGAATGTATGAAAGCAGG + Intergenic
1195637365 X:107133250-107133272 CAGTAGGAATGGAAGACAGCAGG - Intronic
1201226532 Y:11824169-11824191 CTGGACCCATGTAAGAAAGAAGG + Intergenic
1202034891 Y:20622023-20622045 CTGTAAGAATTAAAGAAAGAGGG - Intergenic