ID: 1143882826

View in Genome Browser
Species Human (GRCh38)
Location 17:10042912-10042934
Sequence GCTATGGTGACAGCCAGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143882824_1143882826 -2 Left 1143882824 17:10042891-10042913 CCAGTAACTCGAAGAGATGTGGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1143882826 17:10042912-10042934 GCTATGGTGACAGCCAGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143882826 Original CRISPR GCTATGGTGACAGCCAGTTT AGG Intronic
907297410 1:53464209-53464231 GCTATGGAGTCAGCCAACTTGGG + Intronic
907747090 1:57224102-57224124 GATATGGTGCCTGCCAGTTAAGG - Intronic
912594494 1:110860371-110860393 GCTATGGTGTCATCCAGTCTTGG + Intergenic
913129827 1:115829168-115829190 GCTGTGTTGACAGCGAGGTTAGG + Intergenic
917080590 1:171253406-171253428 GCTATGGTCCCAGCTACTTTGGG + Intronic
918559275 1:185845087-185845109 GTTATGGTCAAAGCCAGCTTAGG + Intronic
918785858 1:188761974-188761996 TCTATGGTGAGAGCCAGGTCTGG + Intergenic
922316598 1:224447990-224448012 GCTCTAGTGACTGCCAGCTTAGG - Intronic
924757477 1:246954454-246954476 GGAACGGTGACTGCCAGTTTTGG - Intronic
1064377511 10:14810273-14810295 GTTGTGGTGACACCCAGTCTGGG - Intergenic
1065141291 10:22720733-22720755 GGTTTGGTGCCAGCCAGTTGGGG + Intergenic
1065650004 10:27877637-27877659 GCATTGGTGAAAGACAGTTTTGG - Intronic
1065979543 10:30878572-30878594 GCTAGTGTGACAGCCTTTTTTGG - Intronic
1071985881 10:91049787-91049809 GCCAAGGTGCCACCCAGTTTAGG - Intergenic
1072966342 10:99976050-99976072 GCTTTGGAGACAGACAGATTTGG - Intronic
1078753517 11:14187357-14187379 GCTATGGGGTCAGACAGGTTGGG - Intronic
1081452247 11:43182528-43182550 ACAATGGTGGCAGCCAGTATTGG - Intergenic
1083379217 11:62251229-62251251 GTTATGGTAACAGTCACTTTTGG + Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1088495906 11:110430669-110430691 GCGAAGGTCACTGCCAGTTTCGG - Intronic
1091369338 11:135045666-135045688 GCTAAGGTGAGGGCCAGTGTTGG - Intergenic
1091494279 12:958619-958641 GCTGTTGTTACAGCCATTTTTGG + Intronic
1092727138 12:11497654-11497676 GCCAGGCTGACAGCCAGTCTTGG - Intronic
1093899838 12:24619187-24619209 GGTATGGAGGCATCCAGTTTGGG + Intergenic
1095924238 12:47562620-47562642 GCTATGGAGACAGCAGGTATAGG - Intergenic
1098616154 12:72525702-72525724 GCTATGGTAGGAACCAGTTTGGG + Intronic
1099306651 12:80965159-80965181 CTTATGGTGAAAGACAGTTTGGG - Intronic
1100235682 12:92658451-92658473 GTTATGGTTAAAGCCAGGTTAGG - Intergenic
1100399497 12:94216508-94216530 GCTATGCTAACACCCAGTGTTGG + Intronic
1102544055 12:113641889-113641911 GACATGGTGACAACCAGTTCAGG + Intergenic
1103945517 12:124524135-124524157 AAAATGGTGACAGCCAGTTGTGG + Intronic
1106686863 13:32069435-32069457 GCTCTGGTGTAAGCTAGTTTTGG - Intronic
1108945267 13:56015027-56015049 GCTAGTATGACAGCCTGTTTGGG - Intergenic
1114381055 14:22204095-22204117 GAGATGGAGACAGTCAGTTTGGG - Intergenic
1115463389 14:33686707-33686729 GCTCTGGTGCCAGCCTGCTTGGG - Intronic
1120640883 14:87011038-87011060 GCAATGGTAACAGCCAGTCTAGG - Intergenic
1120983209 14:90309502-90309524 GTTATGGAGACAGACAGTGTAGG - Intronic
1121738234 14:96233742-96233764 GCCTTGGAGACAGCCTGTTTTGG - Intronic
1125583371 15:40803241-40803263 GCTATTTGGACAACCAGTTTAGG + Intronic
1128105184 15:65039063-65039085 GCTAGGCTGACAGCCAGTAAAGG - Intergenic
1131376315 15:91926926-91926948 ACTTTGGTGACAGGCATTTTGGG + Intronic
1135868767 16:26129384-26129406 GCTATGGTGTCAGACAGACTTGG + Intronic
1136238604 16:28930691-28930713 GCTCTAGTGAAAGCCAGTCTGGG + Intronic
1138396536 16:56708992-56709014 GGGATGGTGACAGCCGGTGTGGG + Intronic
1138565540 16:57830124-57830146 GCTTTGGTGACAGGCAGATCTGG + Intronic
1138994291 16:62430037-62430059 ACTAAGGTGCCAACCAGTTTTGG - Intergenic
1139798236 16:69500045-69500067 GCGATGGTGATACTCAGTTTTGG + Intergenic
1143882826 17:10042912-10042934 GCTATGGTGACAGCCAGTTTAGG + Intronic
1146130117 17:30265799-30265821 GCCATGGTGATTGCCACTTTTGG + Intronic
1147716385 17:42511621-42511643 GCTATGGTGACAGACACTGCAGG + Intronic
1148259826 17:46171750-46171772 GTTGGGGAGACAGCCAGTTTTGG - Exonic
1151334796 17:73433645-73433667 GCTCTGGAGCCAGCCAGGTTGGG - Intronic
1151452298 17:74205501-74205523 TCAAAGGTGACAGCCTGTTTTGG - Intronic
1155832549 18:30535893-30535915 GCTTTGGTGCCAGCCATTTGGGG - Intergenic
1160697627 19:492255-492277 ACTATGGTGAGAGCCGGCTTGGG - Intronic
1167792499 19:51690538-51690560 GCCATGGTGCCAGACTGTTTGGG + Intergenic
925536956 2:4928266-4928288 GCTATGGGGACACCGTGTTTAGG - Intergenic
931785434 2:65613768-65613790 GCTATTCTGAGAGCCAGTTTGGG - Intergenic
942506483 2:176646714-176646736 GCTAGTGTGAAAGGCAGTTTGGG + Intergenic
944618373 2:201485395-201485417 GCTAAAGTGACTGCTAGTTTGGG - Intergenic
948749034 2:240118843-240118865 GCTTTGGTTGCTGCCAGTTTGGG - Intergenic
1172364014 20:34335009-34335031 ACAATGGTGCCAGCCAGCTTCGG + Intergenic
1172632946 20:36391263-36391285 GCTGTGCTGGCAGCCTGTTTGGG - Intronic
1172949186 20:38711516-38711538 GCTTTGGTGACAGACAGATATGG + Intergenic
1176236187 20:64054596-64054618 GCATTGGTGACAGCCAGCTGGGG + Intronic
956946742 3:74231840-74231862 GAAGTGGTGACAGCCAGATTAGG + Intergenic
963523119 3:146380875-146380897 GCTAGTGTGACAGCCTTTTTTGG + Intergenic
963877661 3:150494642-150494664 GCTATGGTGACTGAAACTTTTGG + Intergenic
965449961 3:168825510-168825532 GATATGGTTGCAGCCATTTTTGG + Intergenic
971985741 4:33821150-33821172 GTTGTGGTGCCAGCCATTTTAGG + Intergenic
973055136 4:45647688-45647710 GTTATGGTGACAGACATCTTCGG - Intergenic
973244593 4:47997181-47997203 GCTAAATTGAAAGCCAGTTTTGG - Intronic
974401858 4:61418082-61418104 GCTAGAGTGCCTGCCAGTTTCGG + Intronic
974462835 4:62209984-62210006 TCTATAGTGATAGCCTGTTTGGG - Intergenic
975654613 4:76629220-76629242 GCTATGGTGACACCTAGTAAAGG + Intronic
981616271 4:146647880-146647902 GCACTGGTGACAGGCGGTTTGGG + Intergenic
986414000 5:7510363-7510385 GCTATAGTGACAGCCACTGCAGG - Intronic
986797151 5:11223374-11223396 GCTGAGTTGACAGCCAGTTGGGG + Intronic
994809778 5:104500481-104500503 AGTATGGTGACTGACAGTTTTGG - Intergenic
1004149338 6:13100490-13100512 GGTATGGAGACAGAGAGTTTTGG - Intronic
1007365591 6:41389941-41389963 GATATTGTGACAGCCATCTTTGG - Intergenic
1020963940 7:14842655-14842677 TCTCTGGTTACAGGCAGTTTTGG + Intronic
1024581772 7:50806418-50806440 ACTAAGGAGACAGCCAGTTGAGG - Intergenic
1033386540 7:140882282-140882304 GCTAAAGTGACACACAGTTTTGG - Intronic
1034267113 7:149786387-149786409 GCTAAGCTGACAGCCAGGCTAGG + Intergenic
1036396916 8:8377737-8377759 GCCCTGGTGACAGCCAGATGTGG + Exonic
1041293115 8:56326177-56326199 ACTATGATGACAGCCATTTCTGG - Intergenic
1043269806 8:78318189-78318211 GTCATTGTTACAGCCAGTTTGGG - Intergenic
1045476560 8:102557653-102557675 GCTATGGCCACAGCTGGTTTTGG - Intronic
1047799169 8:128291153-128291175 GCTTTGGGGTCAGGCAGTTTTGG - Intergenic
1049534911 8:143174759-143174781 GCAAGGGTTTCAGCCAGTTTGGG - Intergenic
1050692772 9:8246989-8247011 GCTATGGTTACAGCTAGGGTAGG + Intergenic
1056733987 9:89189345-89189367 GCCAAGGTCACAGCCAGTTAAGG + Intergenic
1058979289 9:110154326-110154348 GCTCTGGAGCCAGCCGGTTTGGG - Intronic
1059379536 9:113912406-113912428 GCCAGGGTAAGAGCCAGTTTAGG + Intronic
1061874334 9:133536346-133536368 GCTGTGGAGACAGCCAGCCTCGG - Intronic
1190753082 X:53379273-53379295 GCTCTGGGGACAGACAGTTATGG - Exonic
1192805590 X:74505822-74505844 GCTAAAGAGGCAGCCAGTTTGGG - Intronic
1196208055 X:112963530-112963552 GCTATGGAGGCTGTCAGTTTTGG - Intergenic
1199025797 X:142936230-142936252 GCTCTGCTGTCAGTCAGTTTTGG + Intergenic