ID: 1143891335

View in Genome Browser
Species Human (GRCh38)
Location 17:10104780-10104802
Sequence GTGGAGAAGGAAAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 1, 2: 15, 3: 88, 4: 750}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143891335 Original CRISPR GTGGAGAAGGAAAATGTGGA TGG (reversed) Intronic
900478469 1:2887161-2887183 GTGGACACGGACAATGGGGAGGG - Intergenic
901183012 1:7354447-7354469 TTGGATAAAGAAAATGTGGTAGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901735024 1:11306761-11306783 TTGGAGCAGGAAAATGTGTGTGG - Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902546526 1:17193867-17193889 GTGGGCATGGAGAATGTGGAGGG + Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903493219 1:23744795-23744817 GTGGAAAAGGAAGTCGTGGAGGG + Intronic
903629974 1:24760903-24760925 GTGGAGAATGACAATTAGGAAGG + Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904885975 1:33738736-33738758 GTGGAGAAGGAAAGAGTGACAGG + Intronic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
904920148 1:34001013-34001035 GGGGAGGAGGAAAAAGAGGAGGG + Intronic
905710726 1:40100088-40100110 CTGGATAAAGAAAATGTGGTAGG - Intergenic
905866294 1:41378579-41378601 GTGTATAAAGAAAATGTGGGTGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906530593 1:46521559-46521581 GTGGAGAAGGAAACCGTGGCTGG - Intergenic
906636843 1:47415917-47415939 GGGGAGGAGCAAAATGGGGAGGG + Intergenic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
906769111 1:48468178-48468200 ATGGATAAAGAAAATGTGGTAGG + Intronic
906862720 1:49379027-49379049 CTGGATAAGGAAAATGTGGTAGG + Intronic
906903503 1:49864029-49864051 ATGGATAAAGAAAATGTGGTAGG + Intronic
907790121 1:57655305-57655327 GTGGAGAATGAATAGATGGATGG - Intronic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
909540318 1:76784135-76784157 GTGGAGAAGTGACACGTGGAAGG + Intergenic
909853983 1:80505094-80505116 GTGGATAAGGGAAATATGAAAGG + Intergenic
910089418 1:83444880-83444902 TTAGAGAAGGAAAATATGGGTGG + Intergenic
911012376 1:93294627-93294649 GTGCAGTGGGAAAGTGTGGATGG + Intergenic
912025961 1:105172742-105172764 ATGTACAAGGAAATTGTGGAGGG - Intergenic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913581786 1:120233736-120233758 GCTGAGAAGGAAAACGTGGCAGG - Intergenic
913583605 1:120251128-120251150 GTTGTGAAGGAAAATGCAGAGGG - Intergenic
913624571 1:120647192-120647214 GTTGTGAAGGAAAATGCAGAGGG + Intergenic
913626390 1:120664652-120664674 GCTGAGAAGGAAAACGTGGCAGG + Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914422370 1:147541314-147541336 GGGGAGGAGGAAAAGGTGGAGGG + Intergenic
914563717 1:148845183-148845205 GCTGAGAAGGAAAACGTGGCAGG - Intronic
914565593 1:148862964-148862986 GTTGTGAAGGAAAATGCAGAGGG - Intronic
914607232 1:149267288-149267310 GTTGTGAAGGAAAATGCAGAGGG + Intergenic
914609110 1:149285043-149285065 GCTGAGAAGGAAAACGTGGCAGG + Intergenic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915545348 1:156593890-156593912 GTGGAGAAGGGAAATGCTGGAGG + Exonic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916389940 1:164320657-164320679 GGGGAAAAGGAAAATATGGGAGG + Intergenic
916533931 1:165685478-165685500 GTCCAGAAGGAAAAAATGGAGGG + Intronic
916602098 1:166303269-166303291 GTGGAGAAGGGCCATGTGGTTGG - Intergenic
916656478 1:166880659-166880681 ATGGATAAAGAAAATGTGGGAGG - Intergenic
917091189 1:171355172-171355194 GTTAAGACAGAAAATGTGGAAGG - Intergenic
918236955 1:182590198-182590220 GTGGAGATGGAATAAGTGGGAGG - Intergenic
919138108 1:193535903-193535925 ATGGATAAAGAAAATGTGGCTGG - Intergenic
919287418 1:195581755-195581777 CTGGAGATGGACAATGTTGATGG - Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
920311550 1:205051760-205051782 GTGGAGTGGTCAAATGTGGAGGG + Intronic
920768406 1:208855876-208855898 GTTGAGAAAGATAATGTTGATGG - Intergenic
920954129 1:210602067-210602089 GAGGAGGAGGAAAATCTAGAGGG + Intronic
921127802 1:212193451-212193473 CTGGAAAAGGAAAATGTGTGTGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921560267 1:216649349-216649371 TTGGTGAATGAAAATGAGGATGG - Intronic
921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG + Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922887216 1:229029286-229029308 GTGGGGAAGGCAAGTGAGGACGG - Intergenic
923282257 1:232455379-232455401 CTGGATAAAGAAAATGTGGTTGG + Intronic
923986122 1:239384631-239384653 ATGGACAAGGTAAATGTAGATGG - Intergenic
1064378351 10:14817279-14817301 GTGGATAAAGAAAATGTGTTTGG - Intergenic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1065991435 10:31013719-31013741 GGAGAGATAGAAAATGTGGAGGG - Intronic
1066137369 10:32463185-32463207 GTAGACAAGGAATAAGTGGATGG + Intronic
1066203993 10:33169670-33169692 GTGCAGAAGGAAAAAGGGGAAGG + Intergenic
1066211270 10:33241171-33241193 GTAGAAAATGAAAATGAGGAAGG + Intronic
1067019123 10:42780041-42780063 CTGGAGCAGGAAAAGGTGGTGGG + Intergenic
1067429302 10:46232577-46232599 GTTGAGAAGTGAAGTGTGGAGGG + Intergenic
1067444437 10:46331828-46331850 GTTGAGAAGTGAAGTGTGGAGGG - Intergenic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1068222033 10:54057259-54057281 GTGCAGAAGGGAAATGTGGGTGG - Intronic
1069304069 10:66946743-66946765 GTGGGGAGAGAAAATGGGGAGGG - Intronic
1069413266 10:68174478-68174500 CTGGGGATGGAAAATGTGAATGG - Exonic
1069553632 10:69382406-69382428 GTGGAGAAAGAAAGGGTGGCCGG + Intronic
1070530734 10:77335142-77335164 GAGGAGGAGGAAGATGGGGAAGG - Intronic
1071119700 10:82263196-82263218 GTGGGAAAGAAAGATGTGGATGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071484069 10:86086190-86086212 GTGGAGCAGACAATTGTGGAGGG - Intronic
1071499694 10:86194690-86194712 GGGGAGTGGGAAGATGTGGAAGG - Intronic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071964507 10:90838489-90838511 GTGGAGAATGAAATGGAGGAGGG - Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073298035 10:102452918-102452940 CTGGAGAAGGAAGAGGTGCAGGG - Intergenic
1073378501 10:103058093-103058115 GAGGAGTAGGAAAATGCCGAGGG + Intronic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073610275 10:104936331-104936353 GTGTAGAAGGAAGGTATGGAGGG + Intronic
1073823445 10:107291782-107291804 GTGGAGAGGGAAAAGTGGGAAGG - Intergenic
1074373582 10:112920623-112920645 GTGGAGAAAGACTAAGTGGATGG + Intergenic
1074400711 10:113139278-113139300 GTGGAGAAGGAAAAGGGAAAAGG - Intronic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1075075532 10:119347945-119347967 GTGGAGAAGGAAAGGTTGGGGGG - Intronic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075536712 10:123277629-123277651 GTACAGAAGGAAGATGTGGTTGG - Intergenic
1075746242 10:124729865-124729887 GGGGTGAAGGCAAATATGGAGGG - Intronic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1076493320 10:130878905-130878927 GTGCAGAGGGAAAATTTGGTTGG + Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078130925 11:8613525-8613547 GTTAACAAGGAAAATGTGTAAGG + Exonic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078151219 11:8761083-8761105 GTGGAGAAGGACCATCTGGCAGG - Intronic
1078235387 11:9479968-9479990 GTTGAAAAGGAAAATATGGAGGG - Intronic
1078297204 11:10084703-10084725 CTGGATAAAGAAAATGTGGTAGG + Intronic
1078473569 11:11611379-11611401 GTGGGCAAGGAAAATGGGGAAGG + Intronic
1079310084 11:19357586-19357608 TTGGAGGAGTAAAATGGGGATGG + Intronic
1079341027 11:19611901-19611923 GTACAGAAGGAAAATATGGGTGG - Intronic
1079361850 11:19776770-19776792 GTGCAGAAAGAAAATGCGGATGG + Intronic
1079398469 11:20086237-20086259 GTGTATAAGGAATATGGGGAAGG + Intronic
1079657047 11:22997334-22997356 CTGGAGAAGGCATATGTGCAAGG + Intergenic
1080232789 11:30036366-30036388 GTGTAAATGGAATATGTGGAAGG + Intergenic
1080304364 11:30820541-30820563 GTGGAGTAGGAAGATGGGGCTGG + Intergenic
1081249986 11:40817589-40817611 GAGAAGAAGCAAAATTTGGATGG - Intronic
1081489696 11:43557882-43557904 GTGGAGAAGCTAAATGGGGCAGG + Intronic
1082778904 11:57270994-57271016 ATGGACAAGGAACATGGGGAGGG - Intergenic
1082806983 11:57457966-57457988 GTGGGGACAGCAAATGTGGATGG + Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1083060259 11:59862486-59862508 GAAGAGAAGGAAAGAGTGGAGGG + Intronic
1084278505 11:68069937-68069959 ATTGAGAAGGAAAATGTCAAAGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084891043 11:72237391-72237413 GTGGAGGTGGAAAGTCTGGAGGG - Exonic
1085282314 11:75339319-75339341 CTGGAGAAAGAAAATGGGGTGGG - Intronic
1085789531 11:79485266-79485288 GTGGTCTAGGAAAATTTGGAGGG + Intergenic
1085857166 11:80188334-80188356 CTGGAGAAGGAAAAGGGGCAGGG - Intergenic
1085957590 11:81418660-81418682 GAGGATAAAGAAAATGTGAATGG + Intergenic
1087213099 11:95463031-95463053 GTGTAGAAGGAAGAGGTGGAGGG + Intergenic
1087584556 11:100101947-100101969 GTGGACAAAGAAAATATGGTAGG - Intronic
1087633966 11:100682530-100682552 GGGGAGAAGGAAAAAGGAGAGGG - Intergenic
1087922383 11:103881303-103881325 ATGGTAGAGGAAAATGTGGAAGG - Intergenic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088144405 11:106657969-106657991 GTGGAGGCTGAAAATATGGAGGG + Intergenic
1088462048 11:110092862-110092884 GAGGAGAAGGAAAAGAGGGAAGG + Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088592124 11:111412902-111412924 GGGGAGAAGGAAAATGGGTTGGG + Intronic
1088920554 11:114257494-114257516 GTGGAGAGGGAAAATAAGGTGGG - Intergenic
1089217548 11:116843928-116843950 GTGGAGAAGGACAAGGTGCATGG + Intronic
1089269192 11:117289810-117289832 GGGGAGAGGGCAAATGTGAATGG + Intronic
1089419993 11:118324649-118324671 GTGGATAAAGAAAATGTGGGAGG + Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089712179 11:120323519-120323541 CTGGAGAAGTAAAACATGGAAGG - Intergenic
1089775158 11:120830871-120830893 GTGGGGGAGGGAAATGTGGGGGG - Intronic
1089894423 11:121914835-121914857 GTGGAGAATGAAGATGTAGTAGG - Intergenic
1090083906 11:123634079-123634101 GAGGGGAAGGCAGATGTGGATGG - Intronic
1091348878 11:134876870-134876892 GTGGAGAGGGGGCATGTGGAGGG - Intergenic
1091840517 12:3617151-3617173 GTGGGGAAGGATTATGAGGAAGG - Intronic
1093868349 12:24256203-24256225 GTGCAGAAGGAAAATGTGAACGG + Intergenic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094234671 12:28150115-28150137 ATGGATAAAGAAAATGTGGCAGG - Intronic
1095391708 12:41714940-41714962 CTGGAGAGGGAAACTTTGGATGG + Intergenic
1095518889 12:43038332-43038354 GTGAAGAAAGAACATGAGGAAGG - Intergenic
1095856158 12:46863044-46863066 TTGGGGAAGAAATATGTGGATGG - Intergenic
1096211147 12:49766865-49766887 GTGGAAAGGGAAATTGTGAAGGG + Intergenic
1096227148 12:49873405-49873427 CTGCAGAAGGAAAATGTGCTTGG - Intronic
1096323334 12:50635303-50635325 GTCAAGAAAGAAAATGTGAAAGG - Intronic
1096409759 12:51368701-51368723 TTGAAGAAGGAAAAAGTGGGCGG - Intronic
1096656769 12:53097219-53097241 GAGGAGTGGGCAAATGTGGAGGG - Intergenic
1096813005 12:54183566-54183588 GTGGAGAAGGAGCATGTGCATGG - Intronic
1096836389 12:54353818-54353840 GTGGAGGAGGTGAATGGGGAAGG + Intergenic
1097147379 12:56951089-56951111 GGGAAAAAGGAAAATGGGGATGG - Intergenic
1097176565 12:57146865-57146887 GTGGACAAGGAACAGGGGGAGGG - Intronic
1097225932 12:57476802-57476824 GTGGAGCAGGAAAAGGGGGGAGG + Intronic
1098030010 12:66243706-66243728 ATGGCGAAGGAAACTGTGGGTGG + Intronic
1098224062 12:68302695-68302717 GTGGAGAAGGCAACTGTCCAGGG + Exonic
1098373945 12:69791928-69791950 ATGGATAAAGAAAATGTGGGGGG + Intronic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1100239106 12:92692694-92692716 GTGGGGAAGGGAAAAATGGAAGG + Intergenic
1100421801 12:94442101-94442123 GTAGATAAAGAAAATGTGGTAGG + Intronic
1100574331 12:95875662-95875684 GTGAAGCAGGAAAATTGGGAGGG - Intronic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101987682 12:109460561-109460583 GCAGAGAGGGAAAATGAGGAAGG + Intronic
1102055939 12:109896602-109896624 GTTGAGAATGAAAAAGTGAATGG - Intergenic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1102250152 12:111381243-111381265 GTGCAGAGGGAAGATGTGGAGGG + Intergenic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102753880 12:115320991-115321013 GTGGGGAAGGCAAAGGTGGGAGG + Intergenic
1103250517 12:119496055-119496077 GTGGAGTGGGAGAATGTGGCAGG + Intronic
1103317280 12:120066338-120066360 GAGGAGAAGGAAAATAAGTATGG + Intronic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104390325 12:128386426-128386448 ACGGAAAGGGAAAATGTGGAGGG - Intronic
1104420221 12:128628707-128628729 GTGGAGCAGGCAGATGTGGCGGG - Intronic
1104524282 12:129503850-129503872 GAGGAGGAGGAAAATCTGGAAGG - Intronic
1105003763 12:132708372-132708394 GGGGAGAAACGAAATGTGGAAGG + Intergenic
1105004609 12:132713584-132713606 GCGGAAAAGGAAGCTGTGGAAGG - Intronic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1105792987 13:23821032-23821054 GTGGAAAAAGAAAATGTTGCAGG - Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106810129 13:33350659-33350681 GAGGAGAAGGAAAGTGGGAAAGG - Intergenic
1107012583 13:35683063-35683085 GTGGTGGAGGCAAATCTGGAAGG + Intergenic
1107045079 13:35985183-35985205 GTGGAGAAGGATGATGTGGAAGG - Intronic
1107269926 13:38603157-38603179 GTGGAGAAGGAATATAAGCAGGG - Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1108238094 13:48430085-48430107 GTGGAGAATGCAAATTAGGAGGG - Intronic
1108479220 13:50850842-50850864 ATGGATAAAGAAAATGTGGTGGG + Intergenic
1108623760 13:52208320-52208342 GTAGAGAGGAGAAATGTGGAAGG + Intergenic
1108662956 13:52602711-52602733 GTAGAGAGGAGAAATGTGGAAGG - Intergenic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1109208953 13:59512690-59512712 GTGGAAAAGGAAAATGTAAATGG + Intergenic
1109475527 13:62876332-62876354 GTGGCGAGAGAAAATGAGGAAGG + Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110533439 13:76623503-76623525 GTAGAGGAAGAAAATGTGGAGGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111106178 13:83648512-83648534 GAGGAGAAGGAAAAAGGAGAAGG + Intergenic
1111268426 13:85850135-85850157 GTGTGGAAGGGAAATGTGGGTGG - Intergenic
1112569092 13:100577800-100577822 GGGGAGAAGGAAAGTAGGGAGGG + Intronic
1112862588 13:103850909-103850931 GTGGAGAAGGAAGAAATGCAGGG - Intergenic
1113398242 13:109968627-109968649 GTGGAGAAGGGAGACGTGGCTGG + Intergenic
1113442544 13:110340526-110340548 GTGTAGAAAGAAAATGTTTAAGG + Intronic
1114301025 14:21378055-21378077 ATGGAGCAGGATAATGTGGGGGG + Intronic
1114407524 14:22470681-22470703 GTGGAGATGGAAGAAGTAGATGG - Intergenic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1114523829 14:23355682-23355704 GGGGAGGAGGCAAATGTGCAGGG + Intergenic
1114551230 14:23533991-23534013 GTGGAGCAGGGACATGTGGCTGG + Exonic
1114707303 14:24740189-24740211 TTGGAGAAAGAAAAAATGGAGGG - Intergenic
1114715644 14:24821084-24821106 GTGGAACAGGAAGATGGGGAAGG + Intronic
1114848598 14:26354866-26354888 GTGGTGAAGAAAAATGTAAAAGG - Intergenic
1114967660 14:27983226-27983248 GTGGAGAAAGAACAAGAGGAGGG - Intergenic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115314310 14:32010079-32010101 GTGGAGGAGGAAAATGTGGGTGG + Intronic
1115440014 14:33423907-33423929 TTGAAGAAGGAAAAAATGGAGGG - Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116043483 14:39714677-39714699 GTGGAGAAGGGCAATGTGAAAGG - Intergenic
1116906111 14:50405201-50405223 ATGAAGAAAGAAAATGTGGCTGG - Intronic
1117202992 14:53411547-53411569 CTAGAGAAGAAAAATGTTGAAGG - Intergenic
1117335745 14:54755756-54755778 GTGGAAAAGGAAAATTAGAATGG + Intronic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118701197 14:68434889-68434911 ATGGATAAAGAAAATGTGGTGGG - Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119523149 14:75301272-75301294 GTGGAGATGGTAAATGAGGCTGG + Intergenic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121184758 14:91956841-91956863 CTTGAGAAGAAAAATGTGCAGGG + Intergenic
1121583981 14:95050332-95050354 GGGAAGAAAGAAAATGTAGATGG + Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1124844946 15:33281172-33281194 CTGGAGCAGGAATATGGGGAAGG - Intergenic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125140263 15:36398025-36398047 TTGGAAAAGGAAGATGTGTATGG + Intergenic
1125247505 15:37658256-37658278 ATGGATAAAGAAAATGTGAAGGG + Intergenic
1125616473 15:41018502-41018524 GTGGGGAAGGGAGAAGTGGATGG + Intronic
1125910379 15:43432618-43432640 GAGGAGAAAGAAAAATTGGAGGG - Exonic
1126163927 15:45637868-45637890 GTGGAGCAGGGAAACGTGAAAGG - Intronic
1126710436 15:51449378-51449400 GATGTGAAGGAAAATATGGAAGG - Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1126859102 15:52866862-52866884 GTGGAGAAGGCAAAGGTCGATGG - Intergenic
1127328439 15:57916986-57917008 GGGGAGAAGGAAAGCGTGGAGGG + Intergenic
1127891575 15:63256586-63256608 GGGGAGAAGGTAAATGTGAATGG + Exonic
1128513352 15:68327018-68327040 GAGCAGAAGGAAGAAGTGGAGGG + Intronic
1128855126 15:71004391-71004413 CTGGATAAAGAAAATGTGGGAGG + Intronic
1129518890 15:76173278-76173300 TTGGAGAGAGGAAATGTGGAGGG + Intronic
1129679658 15:77651039-77651061 GTAGAGAAGGAAAATCCTGACGG + Intronic
1130048302 15:80463015-80463037 GTTGATAAGGAAAATATGCAAGG + Intronic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131977270 15:97959756-97959778 GTTGAAAAGGAAAATGTAGCAGG + Intergenic
1132075851 15:98819054-98819076 GTGGAGAAGGCAGATGGGGCAGG + Intronic
1132158337 15:99513267-99513289 GGGGAGAAGGATACTGTGGATGG + Intergenic
1133733182 16:8593483-8593505 TTGGATAAAGAAAATGTGGTAGG + Intergenic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1134555266 16:15158773-15158795 GTTGGGCAGGAAAATGGGGATGG - Intergenic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134887590 16:17807510-17807532 GTAAACAAGGAAAATATGGAAGG + Intergenic
1135244603 16:20844872-20844894 TTGGGGAAGGAAACTGGGGATGG + Intronic
1135301832 16:21335184-21335206 CTGGATAAAGAAAATGTGGCAGG - Intergenic
1135582574 16:23641102-23641124 GAGGAGAAGGAAAAGGTGCCGGG - Exonic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1137348251 16:47685037-47685059 CAGAAGAAAGAAAATGTGGAAGG - Intronic
1137439689 16:48487494-48487516 GTTGAGAAGGAAAATCCGGCTGG - Intergenic
1137543679 16:49382810-49382832 GTGGAGAAGGAAGACGAGGGAGG - Intronic
1137998901 16:53253169-53253191 GTGGATAAAGAAACTGTGGTGGG + Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138869264 16:60861717-60861739 GGGGAGTAGGAAAAAGTGGAAGG - Intergenic
1139304426 16:65971448-65971470 GTGGATAAAGAAATTGTGGGGGG + Intergenic
1139388154 16:66587741-66587763 GTGGAGAAGGCAAAGGCTGAGGG + Intronic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1141231893 16:82175497-82175519 ATAGAGATGGAAGATGTGGAAGG + Intergenic
1141263445 16:82474512-82474534 CTGGAGAAACAAAATCTGGAAGG + Intergenic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141562711 16:84880084-84880106 GTGGAGGAGGAAAGGGTGGAGGG - Intronic
1141576926 16:84970050-84970072 GTGCAGAAGGGACATGTTGAGGG + Intergenic
1141856222 16:86683103-86683125 GGGGAGAAGGAAAAGAAGGAAGG + Intergenic
1142745120 17:1952646-1952668 GTGCAGAATGAAAATGGGGGAGG - Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144285300 17:13768827-13768849 GTGGAGAGGGAAATTCTGTAGGG - Intergenic
1144576285 17:16431877-16431899 GTGGACAAGGAACGTGGGGAAGG - Intronic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144795944 17:17891377-17891399 GAGGAGCTGGAAAGTGTGGAGGG + Intronic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146441075 17:32895546-32895568 GTGGAGAAAGAAGAGGAGGAAGG + Intergenic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147209445 17:38863540-38863562 GAGGAGAAAGAAGGTGTGGAAGG - Intergenic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1147519766 17:41159803-41159825 GTAGAGAGGTAAAATGTGGGGGG + Exonic
1147535882 17:41323213-41323235 GTGGAGAGGCAAAAAGTTGAGGG - Intergenic
1147760544 17:42795149-42795171 GAGGGGAAGGAAGAAGTGGAGGG - Exonic
1147912372 17:43863456-43863478 GTGAAGAAGAAAAGAGTGGAAGG - Exonic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1149578304 17:57729247-57729269 GAAGAGAAGGAACAGGTGGAAGG - Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1150592835 17:66578378-66578400 TTGGCGAAGGATAAAGTGGAAGG + Intronic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152269327 17:79314588-79314610 GTGGACAAAGAAAATGGGGCAGG + Intronic
1152403410 17:80082996-80083018 GAGGAGGAGCAAAGTGTGGATGG + Intronic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153709374 18:7782516-7782538 CTGGAGAAGGACAATGGTGATGG - Intronic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156347214 18:36268617-36268639 GTGTTGAAAGAGAATGTGGAAGG + Exonic
1157125993 18:44956528-44956550 GTGATGAAGGAAAAGGTGGAGGG - Intronic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157915718 18:51661837-51661859 GTGGAGAGGGAAAAAATGAATGG + Intergenic
1158012630 18:52746944-52746966 GTGGAGAAGGAGGAAGTGTAAGG + Intronic
1158173057 18:54620727-54620749 TTGCAGAAATAAAATGTGGAAGG - Intergenic
1158343432 18:56490420-56490442 GTGGAGAATGAAAGTTAGGAAGG + Intergenic
1158379725 18:56915940-56915962 CTGACGGAGGAAAATGTGGACGG - Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159022010 18:63151171-63151193 GTGGAGAAGGGAATTTTGGGGGG - Intronic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159511891 18:69405012-69405034 GGGAAGCAGGGAAATGTGGAGGG + Intronic
1160191704 18:76719995-76720017 CTGGAGATGGATAATGTTGATGG + Intergenic
1160521720 18:79511813-79511835 GTGGAGCTGGGAGATGTGGATGG + Intronic
1160589533 18:79935490-79935512 GAGGAAAAGGAAAATGTTGCTGG - Intronic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160752347 19:740375-740397 GTGGAGAAGGACAAGGTGACAGG + Exonic
1161388491 19:4009150-4009172 GTGGGGAGGGAAGATGTGAAAGG - Intronic
1161872536 19:6881492-6881514 GTGGAACAGAAAAATGTAGAAGG + Intergenic
1161994945 19:7706272-7706294 GGGGAGAAGGAAAGGGTGCAGGG + Intergenic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1162996487 19:14339142-14339164 GGGGAGGAGGAAAGTGGGGAGGG - Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1163099501 19:15085908-15085930 ATGGATAAAGAAAATGTGGTAGG - Intergenic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1166988263 19:46675203-46675225 GTGCAGAAGGAAGGTGTTGATGG - Intronic
1167141351 19:47652938-47652960 ATGGAAAAGTAAAATGTAGAAGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167486530 19:49766487-49766509 GTAGAGAAGGAAAGAGGGGAGGG - Intergenic
1167519647 19:49946387-49946409 CTGGATAAAGAAAATGTGGTGGG - Intronic
1167854422 19:52226289-52226311 GTGGAGAAGTAAATGGGGGAGGG - Exonic
1168199649 19:54805405-54805427 GTGGAGAAGGAAGAGGAGAATGG + Intronic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925162132 2:1692932-1692954 GTGGAGCAGGAAAGTGAGGCTGG - Intronic
925218301 2:2116483-2116505 GTAGATAAGCTAAATGTGGAAGG - Intronic
925260814 2:2526847-2526869 GAGGAACAGGAAAATCTGGAAGG - Intergenic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925628009 2:5861590-5861612 GTGTAGAAGAAAAATTTGGGGGG - Intergenic
925638426 2:5964918-5964940 GTGCAGAAGGGAAATGTGGTGGG - Intergenic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
926418354 2:12673161-12673183 GCTGAGATGGAAAATCTGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929570775 2:43021733-43021755 GCTGAGATGGAAAATCTGGAAGG + Intergenic
929844731 2:45511687-45511709 GTGCAGAAGGAATATATGCATGG - Intronic
929977702 2:46651472-46651494 GGGGAGAACGAAAATGCAGAGGG + Intergenic
930336881 2:50059956-50059978 GTGCAGAAAGAAAATGTGAGTGG + Intronic
930422411 2:51169550-51169572 GTGGAGGAGGGAAAGGTAGATGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
931942965 2:67273279-67273301 GTGGAGAAGGAAGTGGGGGAAGG - Intergenic
932029271 2:68166535-68166557 GCAGAGGAGGAAGATGTGGAAGG + Intronic
932121597 2:69105665-69105687 GTGGGGAAGGAAAATGGGAAAGG - Intronic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932865139 2:75333882-75333904 GATGAGAAGGCAAATCTGGATGG - Intergenic
933121057 2:78539004-78539026 CTGGAGAAGGAAATGATGGAAGG + Intergenic
933305569 2:80593850-80593872 GTGGATAAAGAAAATGTGGGTGG - Intronic
933441103 2:82315394-82315416 GAGGAGAAGGAAGAGGGGGAGGG - Intergenic
933564272 2:83930763-83930785 GTGGATAAAGAAAATGTGGTGGG + Intergenic
934511335 2:94946740-94946762 GTGGAGAAAGAAAAGATGGTAGG - Intergenic
934725148 2:96611984-96612006 GGGGAGAAAGAAAATGAGCAGGG + Intronic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935647157 2:105348041-105348063 GTAGAGAAAGAAAATGTATAAGG - Exonic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
935854681 2:107260989-107261011 GGTGAGAAGGAAAATGCTGAGGG + Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937424898 2:121790564-121790586 GTGCAAAATGAAAATGTGGGGGG + Intergenic
937694035 2:124787988-124788010 GGAGAGGAGGAAAAGGTGGAAGG - Intronic
938810502 2:134848149-134848171 CTGGATAAAGAAAATGTGGCTGG - Intronic
938878009 2:135554168-135554190 GGGAAGAGGGAGAATGTGGAAGG - Intronic
939266982 2:139886553-139886575 GGGAATAAGGAAAATGTGAAAGG - Intergenic
939415428 2:141890025-141890047 GTGGAGAATGAAAAACTGCAAGG - Intronic
939519442 2:143211325-143211347 GTGGAGAAGTAAAAAATGGCGGG + Intronic
939687982 2:145223390-145223412 GTGGGTAAGGGAAATGTGAAAGG + Intergenic
939831571 2:147078805-147078827 GTGGAGAGGGAAAATGAAGTTGG + Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940677808 2:156746554-156746576 GTGTGGAGGGAAAATGGGGAAGG - Intergenic
941151892 2:161924930-161924952 GGGGCTGAGGAAAATGTGGATGG + Intronic
941527237 2:166621241-166621263 ATGGATAAAGAAAATGTGGCTGG - Intergenic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942587844 2:177504099-177504121 GAGGAGTAGGAAAAGGTGCAAGG - Intronic
943208484 2:184931277-184931299 GTGCAGAAGGGAAATGTGAGTGG - Intronic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943291307 2:186075515-186075537 GTAGAGAAGGAAGAGGTGAAAGG - Intergenic
943413891 2:187573954-187573976 CTGGATAAAGAAAATGTGGTTGG - Intergenic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943733711 2:191330742-191330764 GTGGAGGAGGAAGATGGTGAGGG + Intronic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945148935 2:206767676-206767698 CTGGGGATGGTAAATGTGGAAGG - Intronic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
946283636 2:218685234-218685256 GGGGAGAAAGACACTGTGGATGG + Intronic
946456751 2:219832722-219832744 GTGAAGAAGGAACCTGTAGAAGG + Intergenic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
946992085 2:225344872-225344894 GTGGATAAAGAAGATGTGGTGGG - Intergenic
947442299 2:230133826-230133848 GTGCAGAAGGGAAATGTGGGTGG - Intergenic
947517049 2:230815136-230815158 GTGCTGATTGAAAATGTGGACGG - Intronic
1169171006 20:3465356-3465378 GAGGAGGAGGAAAATGCAGAAGG - Intergenic
1169636113 20:7693762-7693784 GGAGAGAAGGAAAAGGAGGAGGG - Intergenic
1169803042 20:9530976-9530998 GTGGAGACTGTATATGTGGAGGG - Intergenic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172198138 20:33106141-33106163 GTGGGGTAGGAAAGAGTGGATGG - Intronic
1172891294 20:38267538-38267560 GTGGAGTGAGAAAATGGGGAAGG + Intronic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173718186 20:45229851-45229873 GTGGAGGAGGCAAAGGGGGACGG - Intergenic
1173779461 20:45742560-45742582 TTAGAGAAGGACAATGTGAATGG - Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1173927827 20:46793885-46793907 TGGGACAGGGAAAATGTGGAAGG - Intergenic
1173947283 20:46961637-46961659 ATGGAAAAAGAAAATGTGGTAGG + Intronic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1174777189 20:53354841-53354863 GGTCAGAAGAAAAATGTGGATGG - Intronic
1175739798 20:61412653-61412675 GTGGAGAAGGCAGAGCTGGAAGG - Intronic
1176016167 20:62934251-62934273 GTGGAGAAGGGATGGGTGGAGGG - Intronic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177261308 21:18733300-18733322 GTGTGGAAGGGAAATATGGAGGG + Intergenic
1177275627 21:18909340-18909362 GTGGGGAAGTAAAATGTGTTTGG + Intergenic
1177413613 21:20765840-20765862 CTGGAGAAGGCAAATGTATAAGG + Intergenic
1177517244 21:22170699-22170721 GTAGAGCAGGAAAATAGGGATGG - Intergenic
1177534616 21:22407545-22407567 GTGGAGAAAGAAATTGGTGATGG + Intergenic
1177763513 21:25430277-25430299 CTGGAGAAGGTAATTGTGGTGGG - Intergenic
1177816230 21:25980177-25980199 GTTGAGAAGGAAGAGGTGGTAGG + Intronic
1177965991 21:27726627-27726649 GGGGAGAAGAAAACTGTGTATGG + Intergenic
1179236982 21:39556303-39556325 GTGAAGAGGCAAACTGTGGAGGG + Intergenic
1179388479 21:40965468-40965490 CTGGATAAAGAAAATGTGGCAGG - Intergenic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179876886 21:44273145-44273167 GGGCAGAGGGAAGATGTGGAGGG + Intergenic
1181098756 22:20524587-20524609 TTGCAGAAGGAATATGTGGCAGG + Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181458973 22:23075140-23075162 GTGGAGAAGGAAGGCCTGGAGGG + Intronic
1181787345 22:25236670-25236692 TTGGTGAATGAACATGTGGAAGG - Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182541391 22:31044594-31044616 GTGGAGCTGGTGAATGTGGAGGG + Intergenic
1182812379 22:33128372-33128394 CTGGATAAAGAAAATGTGGTAGG + Intergenic
1182862477 22:33571919-33571941 TTGGAGAATGAAAATGTGTCTGG - Intronic
1182922007 22:34088843-34088865 GAGTGGAAGGAAAATGTGGTGGG - Intergenic
1183733910 22:39632966-39632988 GTGGAGAGGGAAGATGGGGTGGG + Intronic
1183904065 22:41026873-41026895 GGGGAAAAGGTACATGTGGATGG + Intergenic
1184303999 22:43582684-43582706 CTAGAGCAGGAAAATGTGGCAGG + Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184652804 22:45926825-45926847 GCCGAGAAGGAGAGTGTGGAGGG + Intronic
1184880756 22:47302964-47302986 GTGGAGATTGAATGTGTGGATGG - Intergenic
1184908902 22:47512463-47512485 GTGCAGAATGAGAATTTGGAGGG + Intergenic
1185009685 22:48306098-48306120 GTGGACAGGGGAGATGTGGATGG + Intergenic
1185288192 22:50011585-50011607 GTGGAGATGGAAAACAGGGAGGG - Intronic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949577126 3:5349284-5349306 GTGGAGAAATAAGATGGGGATGG - Intergenic
949704038 3:6795011-6795033 GTGGAAAATGAAAATGAGAAAGG - Intronic
949914479 3:8948145-8948167 GTGCAGAAGGTAAATATGCATGG - Intronic
950578609 3:13847875-13847897 CTGGAGATGGAAAGTGGGGATGG + Intronic
950780995 3:15391418-15391440 GTGGAGCACAAAAATGTGCATGG - Intronic
951745739 3:25975229-25975251 GAGGAGGAAGAAGATGTGGAAGG - Intergenic
951946040 3:28137408-28137430 GTGGAGGTGGAAAAAGTAGATGG + Intergenic
952172001 3:30817049-30817071 GGGGAGAAAGAAAATGTCTACGG - Intronic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
952329939 3:32355589-32355611 GTAGAGAATGGACATGTGGAGGG - Intronic
952422092 3:33141731-33141753 GTGGAGAAAGAAATTGGGAAGGG + Intronic
952475740 3:33708581-33708603 ATGGATAAAGAAAATGTGGGGGG - Intronic
953164375 3:40451809-40451831 GTTGAGAAGAAAAATCTGCATGG + Intergenic
953225577 3:41016459-41016481 GATGAGAATGAAAGTGTGGATGG + Intergenic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953540436 3:43813248-43813270 GTGGAGAAGGAAAGCATGGTTGG - Intergenic
954151149 3:48657751-48657773 GGGGAGAAGGGAAAGGTGGCTGG - Intronic
954210570 3:49094602-49094624 GTATACAGGGAAAATGTGGAAGG + Intergenic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956251994 3:67244228-67244250 TTGGAGAAGAAAGATGTGCAAGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957223513 3:77413829-77413851 ATGGACAAGTAAAATGTGGCAGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957592589 3:82219652-82219674 CTGGATAAAGAAAATGTGGATGG - Intergenic
958469807 3:94502949-94502971 GTGCAGAAGGAAAATATGAGGGG - Intergenic
958734550 3:97993693-97993715 GTGGAAGGGGAAAATGTGAATGG - Intronic
959013376 3:101105114-101105136 GTTGAGATTGAAAATGTGAATGG - Intergenic
960573963 3:119211292-119211314 GTGGGGAAGGAGAATTTGAAAGG - Intergenic
960708042 3:120500266-120500288 GTGGAGAAGGAAACTTGGGGTGG + Intergenic
960936415 3:122906703-122906725 GGGGAGGAGGAAAAAGAGGAGGG + Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961212160 3:125133890-125133912 GTGCAGAAGGAAACTTTGGGGGG - Intronic
961226206 3:125249792-125249814 ATGGATAAAGAAAATGTGGGGGG + Intronic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
961345354 3:126260357-126260379 GGGGAGAAGGAAGAGGGGGAGGG - Intergenic
961705812 3:128784368-128784390 GGGGAGAAAGTAAAGGTGGATGG - Intronic
961858384 3:129894305-129894327 GTGGAGAAGGAAAACATTCATGG + Intergenic
962050681 3:131811571-131811593 GGACAGAAGGAAAATGTGGAAGG - Intronic
963237619 3:142971196-142971218 GTAGGGAAGGAAAATGGGAATGG + Intronic
963525493 3:146410008-146410030 GTCTAGAAGGAAAATGAGAAGGG - Intronic
964037317 3:152215164-152215186 GAGGAGAAGGAAATTTTGGGTGG + Intergenic
965397831 3:168181833-168181855 GTGAAGAAGGGAAGTTTGGAAGG + Intergenic
965433178 3:168614111-168614133 GTAGAAAAGTAAAATGTTGATGG + Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966530206 3:180969473-180969495 GTGGAAAAGGAAAAACTGTAAGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967739447 3:192988996-192989018 CTGGAGAAGGAAAAAGGGCATGG - Intergenic
968090086 3:195894009-195894031 GTGGAGATGGCAGGTGTGGATGG + Intronic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969680902 4:8642853-8642875 GACAAGAAGGAAAATGTGGGTGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970560769 4:17280194-17280216 CTGGAGCAGGAAAATGTTAAGGG - Intergenic
971072461 4:23110534-23110556 GTGGAGAAGAAATATGGGTAGGG - Intergenic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971669560 4:29539800-29539822 GAAGAGGAGGAAAAAGTGGAGGG + Intergenic
972227483 4:37030149-37030171 CTGGATAAAGAAAATGTGGCAGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973678643 4:53292821-53292843 CTGGATAAAGAAAATGTGGTGGG + Intronic
973797098 4:54438677-54438699 ATGGATAAAGAAAATGTGGTGGG - Intergenic
974434426 4:61839040-61839062 GTGGAGCAAGGAAATGGGGAAGG + Intronic
975165237 4:71171005-71171027 GTGGAGAATCAAACTGTGTATGG + Intergenic
975433914 4:74328656-74328678 GTGGAGAAAGGAATTGTGGTTGG + Intergenic
975696711 4:77021234-77021256 GTGGAGACGCAAAATGTGAAGGG + Intronic
976114529 4:81712758-81712780 TTGGACAAGGAAAGAGTGGAAGG + Intronic
976735569 4:88305283-88305305 GTGGACAGGTAAAATGTGGTGGG + Intergenic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
977639395 4:99339481-99339503 GCAGAGAATGAAAAGGTGGAAGG - Intronic
977666982 4:99653641-99653663 GGGGAGGAGGAAAAGGAGGAGGG - Exonic
977692355 4:99928334-99928356 GTGGAGACATAAAAGGTGGAAGG - Intronic
978135206 4:105249319-105249341 ATGGAAAAAGAAAATGTGGCTGG - Intronic
978453814 4:108866011-108866033 GTGGACAAGGAAGAGATGGAAGG - Intronic
978564939 4:110071639-110071661 GCGGTGGAGGAAACTGTGGAGGG - Intronic
978611965 4:110551813-110551835 GTGCAGAAGGACCATGAGGAAGG - Intronic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979159577 4:117442694-117442716 GTGGATAAAGAAAATGTGGGGGG - Intergenic
979907933 4:126320527-126320549 GGAGAGAAGAAAAATGTGAAGGG + Intergenic
980012101 4:127607942-127607964 GTGGCGAAGGAGGATGTGGGGGG - Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980999246 4:139812414-139812436 GTGGAGAGGGAAAAGTAGGATGG - Intronic
981318315 4:143363526-143363548 TTGAAGAAGGAAAGTGTGGTTGG + Intronic
981552846 4:145959347-145959369 GAGGCTAAGGAAAATCTGGAAGG - Intergenic
981773145 4:148333553-148333575 TTGGAGAATGAAAAGTTGGAAGG + Intronic
981918100 4:150056896-150056918 AAAGAGGAGGAAAATGTGGAGGG - Intergenic
981945366 4:150336565-150336587 GGGGAGAAGGAAAATTAGGGAGG + Intronic
982217244 4:153093017-153093039 GTGGAGAGGGAGAATGGAGATGG - Intergenic
982298413 4:153853818-153853840 GTGAATAAAGAAAATGTGGTAGG - Intergenic
983006771 4:162493525-162493547 GTATAGAAGGGAAATGTGGATGG + Intergenic
983161413 4:164420036-164420058 TTGGAGAAAGAAAATGTGTGTGG + Intergenic
985006575 4:185540470-185540492 GTAGGGAAGGAAAACGAGGAAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986371807 5:7087748-7087770 GTGGAGAGGGAAATTGGAGAGGG - Intergenic
986502943 5:8419095-8419117 GTGGATAAAGAAACTGTGGGGGG + Intergenic
987116638 5:14731132-14731154 GTGGTGAAGGACTATCTGGAAGG + Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987345080 5:16971965-16971987 GTGGGGAAAAAAACTGTGGAAGG - Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987773851 5:22338863-22338885 GCTGAGTAGGACAATGTGGAAGG + Intronic
988630497 5:32925834-32925856 GTGGAGAATGCAAAGATGGAGGG + Intergenic
988942435 5:36159741-36159763 GTGGAGAAGACAGAGGTGGAAGG - Intronic
989428343 5:41322678-41322700 CTGGATAAAGAAAATGTGGCTGG + Intronic
989543006 5:42639940-42639962 TTGAAGAAGGGAAGTGTGGAGGG + Intronic
989548438 5:42702418-42702440 GTGGATAAAGAAAATGTGGTAGG - Intronic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
989806505 5:45613735-45613757 CTGGATTAAGAAAATGTGGAAGG + Intronic
990182299 5:53174522-53174544 GAGGAGAAGGAAGAAGGGGAAGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990655797 5:57953772-57953794 GTGGAGAAGGTAAAACTAGAAGG - Intergenic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
993175237 5:84475645-84475667 GAAGAGAAGGAAGAAGTGGAAGG + Intergenic
993595614 5:89851325-89851347 GTGGAGATAGTAGATGTGGAAGG + Intergenic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
994672064 5:102774085-102774107 CTGGATAAAGAAAATGTGGTGGG - Intronic
995424317 5:112003358-112003380 GCAGAGATGGAATATGTGGAGGG + Intergenic
995424324 5:112003408-112003430 GGAGAGATGGAATATGTGGAGGG + Intergenic
995481325 5:112595927-112595949 GTGGAGAAGGATGATGGGGCAGG - Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997691906 5:135832942-135832964 GTGTAGAATGCAAATGTGAATGG + Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
998493948 5:142570698-142570720 GTGGATAAAGAAAATGTGTTAGG - Intergenic
998816200 5:146016796-146016818 GTGGAGAAGAAAATGCTGGAAGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998889457 5:146730448-146730470 GTGGAGACGTGAAATTTGGAGGG + Intronic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999869432 5:155733689-155733711 GTGGAGAAGTAAAAGTTGAAAGG + Intergenic
1000209492 5:159096966-159096988 GTGGAGAAGGAAAAAGTAAGTGG - Exonic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000904880 5:166953027-166953049 GCTGAGAAGCAAAATGTGTAAGG - Intergenic
1001219459 5:169887187-169887209 TTTCAGAATGAAAATGTGGAGGG - Intronic
1001237615 5:170043384-170043406 GTGGAGTAGGATAATGATGACGG - Intronic
1001427939 5:171636621-171636643 ATGGAGAAGGAATATGTAGTAGG + Intergenic
1002076671 5:176712539-176712561 GTGGAGAAGGAAGAGGACGATGG + Intergenic
1002327686 5:178420523-178420545 GGGGAGGAGGAAAGTGAGGAGGG - Intronic
1002817104 6:691416-691438 GTGGAGGAGGAAGAAGAGGAGGG - Intronic
1002895110 6:1374442-1374464 GTGGAGAAGGGCAATGGGGGAGG + Intergenic
1003792712 6:9565120-9565142 TTGGAGAAAGAAAATAAGGAAGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004409314 6:15366015-15366037 GTGATGAAGGAAAATGAGAAAGG - Intronic
1004625063 6:17366988-17367010 GTGGAACAGGCAAATATGGAGGG + Intergenic
1005098081 6:22140600-22140622 GTAGAGAAGGAAAATCTGGATGG + Intergenic
1005352202 6:24947708-24947730 GAGGAGAAGGAAAAAGTAGGGGG + Intronic
1005502245 6:26439092-26439114 GTTGGGAAGGAAAAGGGGGAGGG + Intergenic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006215270 6:32436724-32436746 GTGCAGAAGGAAAAGGGGGTAGG + Intergenic
1007434281 6:41797406-41797428 GTGATGAAGGAAAATTTAGAAGG + Intronic
1007473030 6:42103154-42103176 GTGGAGAAGGACCATGTGTGGGG - Exonic
1008055977 6:46946472-46946494 GTGGTGAGGGAAAATGAAGATGG + Intronic
1008245766 6:49171023-49171045 GTGGTGAAGGAAAGAGGGGATGG + Intergenic
1008686507 6:53931310-53931332 GGGAAGACTGAAAATGTGGATGG + Intronic
1008806067 6:55430095-55430117 CTGGAGAAGGAAAGTTTAGATGG + Intergenic
1008952997 6:57181329-57181351 GTGGAGAGGGAAAATCAGGTAGG + Intronic
1008974862 6:57413253-57413275 GGGGAGAAGGAAAAAATGGAGGG + Intronic
1009163747 6:60314759-60314781 GGGGAGAAGGAAAAAATGGAGGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009745975 6:67816391-67816413 GTGGAGAAAGAATATGATGAGGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010249160 6:73690852-73690874 GTGGAGAAAGAAAGAGAGGAAGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011302270 6:85888892-85888914 ATGGATAAAGAAAATGTGGTGGG - Intergenic
1011458861 6:87581976-87581998 CTGGATAAAGAAAATGTGGTTGG - Intronic
1012000501 6:93648324-93648346 GTTGAGAAGAAAGAGGTGGAAGG - Intergenic
1012515540 6:100054744-100054766 ATGGATAAAGAAAATGTGGTAGG - Intergenic
1012772880 6:103461949-103461971 GTGGAAGAGGAAAAGGAGGAAGG - Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014421736 6:121254230-121254252 GTACAGAAGGAAAATTTGGAAGG + Intronic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015603879 6:134936387-134936409 GGGGCAAAGGAAAGTGTGGAAGG + Intronic
1015890735 6:137967600-137967622 TTGGAGAACAAAATTGTGGATGG - Intergenic
1016018409 6:139210481-139210503 GTAGATAAAGAAAATGTGGGTGG + Intergenic
1016607543 6:145949331-145949353 GTGGATAAAGAAAATGTGTGTGG + Intronic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1017830468 6:158123488-158123510 GAGAGGAAGGAATATGTGGAAGG + Intronic
1017978974 6:159382027-159382049 GTGGTGGGGGAAAATGTGGCAGG - Intergenic
1018177076 6:161186481-161186503 GTGGACATGGAAGATGTGGGCGG - Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018488210 6:164264075-164264097 GTGGACAGGGTAAATGTGTAAGG - Intergenic
1018597229 6:165494439-165494461 GTGGATAAAGAAAATGTGGGGGG + Intronic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1021170639 7:17394437-17394459 GTGCAGAAGGGAAATGTTGGGGG - Intergenic
1021585717 7:22205435-22205457 ATAGAGAAGGAAATTGTGGGTGG - Intronic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1021956361 7:25828834-25828856 GGGGAGATGGAAAATGGGGATGG + Intergenic
1022806686 7:33829579-33829601 ATGGAGAAGGAAAAAGGAGAAGG - Intergenic
1022845936 7:34209741-34209763 GTGAAGGAAGAAAATGGGGAGGG + Intergenic
1023281540 7:38575785-38575807 GTGGAGATGAACAAAGTGGAAGG - Intronic
1023579820 7:41669902-41669924 GTGCAGAAGGACTATGTGGCAGG + Intergenic
1024145783 7:46515160-46515182 GAGTAGAAAGAAAATTTGGAGGG + Intergenic
1024186947 7:46958984-46959006 GGAGTGAAGGGAAATGTGGAAGG + Intergenic
1024196436 7:47063928-47063950 GAGGAGGAGGAAGAGGTGGAGGG - Intergenic
1024515940 7:50256138-50256160 GGGCAGAAGGACAAGGTGGAAGG - Intergenic
1025754431 7:64323508-64323530 CTGGATAAAGAAAATGTGGTAGG + Intronic
1025770538 7:64501237-64501259 GAGGAGGAGGAAAATGTGCTGGG - Intergenic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027306280 7:76901318-76901340 TTAGAGAAGGAAAATATGGGTGG + Intergenic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027425406 7:78056883-78056905 ATGGATAAAGAAAATGTGGGAGG - Intronic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027957308 7:84897223-84897245 GAAGAGAAGGAAAAGGTGAATGG + Intergenic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028844175 7:95461079-95461101 GTGCAAAAGGGAAATGTGGGGGG + Intergenic
1028887501 7:95950410-95950432 GAGGACAAAGTAAATGTGGATGG - Intronic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1030227000 7:107164535-107164557 GGAGAGAATGTAAATGTGGAGGG + Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1031236914 7:119188654-119188676 TTGGGGAAGAAATATGTGGATGG + Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031611028 7:123827438-123827460 GTTGGGAAGGAAAAAGAGGAAGG - Intergenic
1032179694 7:129664118-129664140 GTGGAGACGGGAAAGGGGGAGGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032931353 7:136676330-136676352 GTGGATAAAGAAAATGTGGAGGG - Intergenic
1033741024 7:144276055-144276077 GTGCATAAGGAAACTCTGGAAGG - Intergenic
1033752882 7:144373559-144373581 GTGCATAAGGAAACTCTGGAAGG + Intronic
1034244536 7:149634633-149634655 GTGGAGAAGGCACGTGTGGAAGG + Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1036582307 8:10086793-10086815 GTGGAGAAGGAAGGAGGGGAGGG + Intronic
1037137353 8:15478651-15478673 CTGGATAAAGAAAATGTGGTAGG - Intronic
1037185974 8:16064136-16064158 GTGGACAAGGAAAACATGGCTGG + Intergenic
1037598418 8:20373674-20373696 GAGGAGGAGGAAATGGTGGAGGG + Intergenic
1037755981 8:21710309-21710331 GCAGAGAAGGAAGATGAGGATGG - Intronic
1037934595 8:22906926-22906948 GTGGTGAAGGAAAGTGGTGAAGG + Intronic
1038171466 8:25137614-25137636 GTAGAGAAGGAAAATTTTGAAGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038353408 8:26803093-26803115 GTGAAGATGGGAAATGGGGATGG + Intronic
1038483731 8:27919130-27919152 GAGGAGAAGGAAGAAGGGGATGG + Intronic
1038790491 8:30663928-30663950 CTGGATAAAGAAAATGTGGTAGG - Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039641790 8:39230935-39230957 TTGGAGAAGGTAACTGTGGTAGG + Intronic
1040055082 8:43050784-43050806 GTTGAGAAGGGACATGTGTAAGG - Intronic
1040635205 8:49265187-49265209 GTGGATAAAGAAACTGTGGGGGG - Intergenic
1040645029 8:49388106-49388128 GTGCAGAAGGAAAACGTGGGTGG + Intergenic
1040784839 8:51153765-51153787 ATGGCCAAGGAAAATGTGCAAGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041773299 8:61496281-61496303 GTGGAAAAGGAAAATACTGATGG - Intronic
1041932862 8:63306363-63306385 GTGGCAAAGAAAAATGGGGAAGG + Intergenic
1042192494 8:66201629-66201651 GGGGTGAAGGAAAAGTTGGATGG + Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042504179 8:69541978-69542000 GTGGAAGAGGAATATGAGGAAGG + Intronic
1042850193 8:73209217-73209239 CTGGATAAAGAAAATGTGGCAGG + Intergenic
1043140765 8:76587094-76587116 GTGGAGAAGAAACATGTGAAAGG + Intergenic
1043878569 8:85515093-85515115 GTGGTGGATGAAGATGTGGAGGG + Intergenic
1043931460 8:86096018-86096040 GGCGAGAAGGACAATGTGAAGGG + Intronic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1045264989 8:100611428-100611450 GTGGGGTATGAAAATGAGGAGGG - Intronic
1045714668 8:105027151-105027173 CTGGAGAAGGTAAACGTTGAGGG - Intronic
1046241744 8:111505318-111505340 GTAGGGAAGATAAATGTGGAAGG + Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046796017 8:118372941-118372963 GTGGAGAAGGCAAAACTGTAGGG + Intronic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1048607475 8:135984636-135984658 GGGGAAGAGGAAGATGTGGAAGG + Intergenic
1048667030 8:136673861-136673883 GAGAAGAAAGAAAAAGTGGAGGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048985298 8:139731732-139731754 GTGAAGCAGGAAAATGTGCAGGG - Intronic
1049106207 8:140614997-140615019 GTGGATAATGAATATGTGAATGG - Intronic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049291494 8:141805298-141805320 GTGCAGAAGGGAAGTGTGGTTGG + Intergenic
1049455241 8:142683274-142683296 GCGCAGAAGGCAAGTGTGGATGG - Intergenic
1049802637 8:144525277-144525299 GTGGAGAAGGAGAAGGTGACAGG - Intronic
1050904302 9:10984816-10984838 GTGTGGAAGGCAAATGGGGATGG - Intergenic
1051100152 9:13512325-13512347 GGAGAGAAGGATCATGTGGAAGG + Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051743874 9:20276635-20276657 GTGTGGAAGGGAAATGTGAAGGG - Intergenic
1052793360 9:32899200-32899222 GTAGAGAAGGAAAAGGTATAAGG + Intergenic
1053073303 9:35113758-35113780 GGGGAGAAAGAAATTGTGGAGGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1055707386 9:79020490-79020512 GAGGGGAAAGAAAAAGTGGAGGG + Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057739784 9:97701223-97701245 GTGGAGAAGGAAGGTTGGGATGG - Intergenic
1057840964 9:98485286-98485308 ATGGGGTAGGAAAATGGGGAGGG + Intronic
1058292207 9:103256797-103256819 GTGCAGAAGAAAAATGTGGTTGG - Intergenic
1058550900 9:106113795-106113817 GTGGTGTGGGAAAATGGGGAAGG - Intergenic
1058732252 9:107861713-107861735 GTGAGTAAGGAAAATGTTGAAGG + Intergenic
1058853546 9:109037097-109037119 GTGGTAGAGGCAAATGTGGAAGG + Intronic
1059051869 9:110935179-110935201 ATGAAGATGGAAAGTGTGGATGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059710669 9:116865025-116865047 GAGGAGAGGGTAAATGTGGCTGG - Intronic
1060183210 9:121547914-121547936 GTGGAGAAGGGAGATGGGGCAGG - Intergenic
1060248974 9:121970970-121970992 CTGGATAAAGAAAATGTGGCCGG + Intronic
1060328276 9:122640144-122640166 GTAAAGAAGGAAAATGAAGAAGG - Intergenic
1060517290 9:124273920-124273942 GTGGGGAAGGAAAGTGTTGCTGG - Intronic
1060705204 9:125792371-125792393 GAGGTGAAGGAAAATGAGAATGG + Intronic
1060903837 9:127287025-127287047 GTGGAGAAGGAAAAAGTGCATGG + Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1060989795 9:127841892-127841914 TTGGAGAAGGAAACTGAGGCTGG - Intronic
1061382885 9:130268808-130268830 GTGGAGCGGGAAAGTGGGGAAGG + Intergenic
1061590654 9:131595500-131595522 ATGGTGAAGTAAATTGTGGAGGG - Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1062715340 9:138007439-138007461 GTGGCCAAGGAAGATCTGGAGGG + Intronic
1203549748 Un_KI270743v1:157358-157380 GAGGTGAAGGAAATGGTGGAGGG - Intergenic
1185807758 X:3076499-3076521 GGAGAGAAGGAAAAGGTGGGGGG - Intronic
1186101924 X:6166665-6166687 GTGGATAAGGAGCATGTGCATGG + Intronic
1186352375 X:8753437-8753459 GTGTAGAGGGCAAGTGTGGAAGG - Intergenic
1186656288 X:11615178-11615200 GTGCAGAATGAAAAAGTGCATGG - Intronic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187196230 X:17087447-17087469 GTGGAGAAGGAGTTTGTAGACGG + Intronic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1188095193 X:26012620-26012642 GTGGAGAAGGGAAAATTAGAGGG + Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1189172807 X:38925733-38925755 GTGGAGTAGGAGACTGTGGAAGG - Intergenic
1189233975 X:39473736-39473758 TTGGAGATGGAAAAGGGGGAGGG + Intergenic
1189235102 X:39480877-39480899 GTGGAGAGGGGAGATGGGGAAGG + Intergenic
1189752234 X:44234072-44234094 CTGGTGAGGGAAAATGTGGAAGG - Intronic
1190073838 X:47300976-47300998 GAGGAGGAGGAAAAAGGGGAAGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190136560 X:47804384-47804406 GTGGTGGAGGAAGAGGTGGAGGG - Intergenic
1190152647 X:47960674-47960696 GTGGAGAAGGGAATTGGAGAAGG + Intronic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190381071 X:49840239-49840261 GTGGAGACACTAAATGTGGAGGG - Intergenic
1190467168 X:50736616-50736638 CTGGATAAAGAAAATGTGGTAGG - Intronic
1190799076 X:53771822-53771844 CTTAAGAAGGAAAAAGTGGAAGG + Intergenic
1191107644 X:56781617-56781639 GTGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191109098 X:56791147-56791169 GTGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191937702 X:66442898-66442920 GGGGAGGAGGAAAAAGTGGAAGG - Intergenic
1192843533 X:74882142-74882164 CTGGATAAAGAAAATGTGGTGGG + Intronic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193660284 X:84249087-84249109 GTGGTTAAGGAAGATGTGTAGGG + Intergenic
1194828936 X:98596931-98596953 GTGCAGAAGCAAAATGTGTTGGG - Intergenic
1194841040 X:98742454-98742476 GTAGAGAAGGACATGGTGGAAGG - Intergenic
1195414115 X:104602009-104602031 TTGGATAAAGAAAATGTGGTAGG + Intronic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1197387149 X:125815395-125815417 TTGGAATAGGAACATGTGGAAGG - Intergenic
1198587011 X:138133192-138133214 TTGGAGAAAGAAAAGGTTGAGGG + Intergenic
1198958859 X:142162284-142162306 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1198961361 X:142186688-142186710 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199483581 X:148324907-148324929 GTGGAGAATGAAACCATGGATGG - Intergenic
1199656576 X:150001728-150001750 GTGAAGAGTGAAAATGTCGAAGG - Intergenic
1199862742 X:151816441-151816463 TTGGAGAAGGAATAGGTGGAAGG + Intergenic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200036153 X:153332651-153332673 TTGGATAAAGAAAATGTGGTAGG + Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1201271077 Y:12254134-12254156 GAAGAGAAGGAAAAGGTGGGAGG + Intergenic