ID: 1143891427

View in Genome Browser
Species Human (GRCh38)
Location 17:10105441-10105463
Sequence GCTACCATGTTAGATGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143891420_1143891427 30 Left 1143891420 17:10105388-10105410 CCTTGGTCTCACTAGCCATTTTG 0: 1
1: 0
2: 0
3: 22
4: 174
Right 1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG 0: 1
1: 0
2: 4
3: 12
4: 125
1143891424_1143891427 -8 Left 1143891424 17:10105426-10105448 CCCATGTGACTAGTGGCTACCAT 0: 2
1: 12
2: 44
3: 81
4: 190
Right 1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG 0: 1
1: 0
2: 4
3: 12
4: 125
1143891425_1143891427 -9 Left 1143891425 17:10105427-10105449 CCATGTGACTAGTGGCTACCATG 0: 1
1: 4
2: 19
3: 77
4: 179
Right 1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG 0: 1
1: 0
2: 4
3: 12
4: 125
1143891422_1143891427 15 Left 1143891422 17:10105403-10105425 CCATTTTGCAAGTGCTCAGCGGT 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG 0: 1
1: 0
2: 4
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143891427 Original CRISPR GCTACCATGTTAGATGGTAC AGG Intronic
904129429 1:28264617-28264639 GTTACCATATTGGATGGTACAGG - Intronic
905644807 1:39617603-39617625 TGTACCATGTTTGATGGTAAAGG - Intergenic
905949554 1:41937462-41937484 GCTACCATTTTGGATAGTGCAGG - Intronic
907004883 1:50902246-50902268 GCTACCATATTAGATAGCACAGG - Intronic
912072727 1:105832725-105832747 GCTACCATTTTAAAGGGTAAAGG + Intergenic
919255687 1:195120745-195120767 GCTATTATGTTAAATGATACTGG + Intergenic
919504283 1:198378293-198378315 GGTACCATGTTAAGTGGTTCTGG - Intergenic
919754052 1:201055506-201055528 GCTACCATATTGGATAGCACAGG - Intronic
921556530 1:216604775-216604797 GCAAATATTTTAGATGGTACAGG - Intronic
922312874 1:224412702-224412724 GCTACCATATTAGATAACACAGG - Intronic
924933533 1:248748856-248748878 GCTACCATATTAGATAGCTCTGG - Intronic
1065047924 10:21760721-21760743 GCTACCATATTAGACAGCACAGG + Intronic
1065197245 10:23278497-23278519 GCCACCATGTTAGGTTTTACGGG + Intronic
1066277701 10:33885169-33885191 GCTACCATATTGGACAGTACAGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1071585465 10:86816123-86816145 GCTGCCATGTTAGACAGCACAGG - Intronic
1076193215 10:128497676-128497698 GCTACCATGACAGATGCCACCGG - Intergenic
1078385843 11:10891892-10891914 GATACCATGTCAGGTGGTATAGG - Intergenic
1083364077 11:62130861-62130883 GCTTCCACGTTGGATGGTGCAGG + Intronic
1089072140 11:115709038-115709060 GCTACTATGTCAGACGGTGCAGG + Intergenic
1089427305 11:118389298-118389320 GCTACTATGTTGGATAGCACAGG + Intronic
1093821527 12:23624938-23624960 GCTACCATTTTAGATTATAAAGG + Intronic
1098888811 12:75987346-75987368 GCTACCATATTGGATAGTAGGGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099895068 12:88634836-88634858 CCTACCCTGTCAGATGGTAATGG - Intergenic
1102133962 12:110557121-110557143 GCTCCCATGTTAGACAGCACAGG - Intronic
1102533271 12:113562435-113562457 GCTACCATATTGGATAGCACAGG + Intergenic
1103454517 12:121054361-121054383 GATACCATGTTGGGTGATACAGG - Intergenic
1106261461 13:28070846-28070868 GCTACCATATTAGACAGCACAGG - Intronic
1106678058 13:31982677-31982699 GCTACCATACTGGATAGTACAGG + Intergenic
1111916260 13:94363784-94363806 GCTGCCATGTTAGATGGCACAGG - Intronic
1114656787 14:24320879-24320901 GCTACCATATTGGATAGTGCAGG + Intronic
1117384660 14:55199193-55199215 GCAACCATGTTGGATGGCTCAGG - Intergenic
1117580135 14:57143614-57143636 GCTGCCATGGTAGGTGGTAGAGG - Intergenic
1127501411 15:59557249-59557271 GCTGCCATGTTAGAGGCCACTGG - Intergenic
1128296452 15:66524710-66524732 GGTACTATGCTAGATGGTAAGGG - Intronic
1129383032 15:75179487-75179509 GCTACCTTATCAGATGGTGCAGG - Intergenic
1129879540 15:78997782-78997804 CCTACCATATTGGATGGCACAGG + Intronic
1132089209 15:98934212-98934234 GCTGCCATGTTAGATAGCCCAGG + Intronic
1133647058 16:7774367-7774389 GCTACCATATCAGACAGTACAGG - Intergenic
1133681388 16:8123526-8123548 GCTACCATGTTGGATGGCACAGG - Intergenic
1133832162 16:9333254-9333276 CCTAGAATGTTAGATGGTATGGG - Intergenic
1138103494 16:54273764-54273786 GCTGCCATGTTGGATGGCGCAGG + Intergenic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1144666230 17:17104240-17104262 GGCACCATGTTAGATGGTGCAGG - Intronic
1146248859 17:31318760-31318782 GCTACGATGTGAGATGTTTCAGG + Exonic
1149071247 17:52546064-52546086 GCTACCATATTGGATGGTGCAGG + Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153413462 18:4819694-4819716 ACTACCATATTGGATGGTATGGG - Intergenic
1155912216 18:31517015-31517037 GCTACCATATTAGAAAGTGCTGG + Intronic
1156123374 18:33872773-33872795 GCTATAATGTTAGATGGCACAGG + Intronic
1158491355 18:57912419-57912441 GCTCCCATATTGGATGGTATAGG - Intergenic
1160042419 18:75357897-75357919 GCTACCATGTTGAATAGTGCAGG - Intergenic
1163717816 19:18882238-18882260 GCTCCCATGTTGGACAGTACAGG - Intronic
1166226810 19:41401040-41401062 GCTGCCACATTAGATGGTGCAGG + Intronic
1166740048 19:45109085-45109107 GTTAACATGTTACATGGTTCTGG + Intronic
928092084 2:28381116-28381138 GCTAGCATGGTATCTGGTACAGG - Intergenic
928149639 2:28814131-28814153 GCTACCATATTAGATAGCACAGG - Intronic
928534323 2:32225487-32225509 GTTACCAGTTTAGGTGGTACTGG + Intronic
929029736 2:37639252-37639274 TCAACCAAATTAGATGGTACAGG - Intergenic
929292107 2:40204914-40204936 GCTACCATATTGAATGGTACAGG + Intronic
930708584 2:54528849-54528871 GCTTCCAGGTTAAATGATACTGG + Intronic
930711425 2:54554429-54554451 GCTACCAAGTGTGATGGTTCTGG + Intronic
933255425 2:80075243-80075265 CCTAACATCTTAGATGGTACAGG - Intronic
937092211 2:119213946-119213968 GCTGCCATGTTAGGTGGGCCTGG + Intergenic
938554445 2:132411709-132411731 GCTGCCATGTTAGATAGCTCAGG + Intergenic
938755674 2:134376870-134376892 GTTACCATCTTGGATGGTGCTGG - Intronic
939019233 2:136939382-136939404 GCTAACATGTTTCATGCTACTGG + Intronic
940498928 2:154470141-154470163 GAAAACATGTTAGATGGTAGAGG - Intergenic
944658035 2:201896273-201896295 GCTACCACGTTGGATAGTGCAGG - Intergenic
946092751 2:217245194-217245216 TCTACTATATTAGATGGTATGGG - Intergenic
947915992 2:233831954-233831976 GCTACCATGTTGGACAGCACAGG + Intronic
1170701238 20:18705529-18705551 GGTACCATGGTAGCTGGTAGTGG + Intronic
1170785645 20:19464971-19464993 GCTATCATACTGGATGGTACAGG - Intronic
1171052765 20:21875533-21875555 GCTACCATGTTGGATGGCTCAGG + Intergenic
1172628467 20:36362373-36362395 GTGACCAGGTTAGATGATACTGG + Intronic
1173150694 20:40564517-40564539 GCCACCATATTGGATGGCACAGG + Intergenic
1173555557 20:43963111-43963133 GCCACCATTCTAGATGGTAGAGG + Intronic
1173833357 20:46107891-46107913 GCTACTATGTTAGATAGCTCAGG - Intergenic
1174185020 20:48700289-48700311 GCTACCATATTGGATAGCACAGG - Intronic
1175188724 20:57197365-57197387 CCTAACATGTTAGAGGGTCCTGG + Intronic
1177500032 21:21942683-21942705 GCTACCATATTAGGAGGTATTGG + Intergenic
1178450645 21:32696234-32696256 GCTACCACATTAGATAGTGCAGG + Intronic
1180243952 21:46533814-46533836 GCTACCACATTAGACAGTACAGG - Intronic
1182459489 22:30473691-30473713 GTTACCATATTGGATGGTGCAGG + Intergenic
1183462806 22:37962569-37962591 GCTACCATAGTTGATGGTGCAGG - Intronic
950569220 3:13789707-13789729 GCTACCATGTGAGACAGTGCAGG - Intergenic
950871044 3:16229267-16229289 GCTACCATATTAGACAGCACAGG - Exonic
953756025 3:45646498-45646520 GCTGCTGTGTTAGATGGTGCAGG - Intronic
955487183 3:59447121-59447143 TCTATTATGATAGATGGTACTGG - Intergenic
956585932 3:70864960-70864982 GCTACCATTTTAGACAGGACAGG + Intergenic
957290028 3:78268117-78268139 GCTTCCATGTTAGCAGGTATAGG + Intergenic
957554120 3:81744137-81744159 GCTACCATATTAGACAGTGCAGG - Intronic
958263420 3:91408831-91408853 GTGGCCATGTTACATGGTACTGG - Intergenic
971130930 4:23809792-23809814 GCTACCATATTGGATGCTGCAGG + Intronic
975794802 4:77995875-77995897 GCTACCATTTTAGATAGCATAGG - Intergenic
978225513 4:106329644-106329666 GCTACCATATTAGACAGTGCTGG + Intronic
981799820 4:148642445-148642467 TCTGCCATCTTGGATGGTACTGG + Intergenic
982749719 4:159145676-159145698 GCTACCATGTTAGATAGTGCAGG + Intronic
985757461 5:1727501-1727523 GCCAAAATGTTAGACGGTACTGG - Intergenic
987236644 5:15949420-15949442 GCTACCCTGTTGGGTGGCACAGG - Intergenic
988534140 5:32051026-32051048 GCTACCATGTTAGACAGCACGGG + Intronic
988670682 5:33377860-33377882 GCAAATGTGTTAGATGGTACAGG - Intergenic
990516221 5:56533240-56533262 GCTACCATATTGGATGGCATAGG - Intronic
990869356 5:60415009-60415031 CCTACCATGTGACAAGGTACTGG - Intronic
995722350 5:115150409-115150431 GCTACCATATTATATGACACAGG + Intronic
1000507227 5:162136421-162136443 GCTACCATTTTAGATAGGACAGG + Intronic
1000702505 5:164470561-164470583 ATTACCCTTTTAGATGGTACAGG - Intergenic
1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG + Intronic
1003336708 6:5180250-5180272 GCTACCATGTATGGTGGCACAGG + Intronic
1005198877 6:23320480-23320502 GCAAACATGTTACAAGGTACAGG + Intergenic
1007143165 6:39597666-39597688 GCTTCCATGTTTTATGGTATTGG - Intronic
1009037506 6:58135251-58135273 GCTACTATGTTAAATAGGACTGG - Intergenic
1009180612 6:60513087-60513109 GTGGCCATGTTACATGGTACTGG + Intergenic
1009213297 6:60888879-60888901 GCTACTATGTTAAATAGGACTGG - Intergenic
1011082709 6:83507340-83507362 GCTAACAGTTTAGATGGAACAGG - Intergenic
1011361578 6:86531113-86531135 GCTACTATGATAGATGTTAGTGG + Intergenic
1011772570 6:90691305-90691327 GCTACCATATTGGATAGCACAGG + Intergenic
1012130041 6:95479355-95479377 GCTGCCAAGTTGGATGGCACAGG + Intergenic
1012718731 6:102712558-102712580 GCTTCAGTGTTACATGGTACAGG + Intergenic
1018784358 6:167096489-167096511 GCTACCATGTTGGATGGCACAGG - Intergenic
1019222850 6:170488086-170488108 GCTGCCATGTTTGATGGTTGGGG + Intergenic
1021912875 7:25403934-25403956 GCTACCATATTGGATGTTACAGG - Intergenic
1032469157 7:132165517-132165539 GTTGCCATATTAGATGGCACAGG - Intronic
1033248478 7:139738495-139738517 GCTACCATTCTGGATGGTGCCGG + Intronic
1033335429 7:140448196-140448218 ACTACCTTGCTAGATTGTACTGG + Intergenic
1034057930 7:148055966-148055988 GAAGCCATGTTAGAGGGTACAGG - Intronic
1035320527 7:158026619-158026641 TCTTCCACGTGAGATGGTACAGG + Intronic
1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG + Intergenic
1041086134 8:54258330-54258352 GCTACCATGTTAGACATCACAGG + Intergenic
1041933864 8:63315622-63315644 GCTACCATGTTGGACAGTGCAGG - Intergenic
1043885784 8:85598846-85598868 GCTACCATCTAGGAAGGTACAGG + Intergenic
1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG + Intronic
1046074088 8:109296442-109296464 GTTACCTTGTCAGATGGAACTGG - Exonic
1049012047 8:139893792-139893814 CCTCACATGTTAGACGGTACTGG - Intronic
1049142520 8:140968758-140968780 GCTATCATGATATATGGTAAGGG + Intronic
1056974644 9:91240711-91240733 GCTACAATACTAGATGGCACAGG + Intronic
1059918601 9:119132483-119132505 GCTATCATATTGGATGGTATAGG - Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1193702210 X:84777439-84777461 GCTACCATGTTGGAGGGTCATGG - Intergenic
1196924594 X:120620939-120620961 GCTACCATATTAGATAGCATAGG - Intronic
1196976057 X:121158869-121158891 GCAACCAAGTTTGATGGTCCAGG - Intergenic