ID: 1143892855

View in Genome Browser
Species Human (GRCh38)
Location 17:10115745-10115767
Sequence TTCTCCCCAGGGACTAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143892855 Original CRISPR TTCTCCCCAGGGACTAGGGG CGG (reversed) Intronic
901036096 1:6337139-6337161 ATGTCCCCAGGGAGGAGGGGTGG + Intronic
901465619 1:9419045-9419067 GTCTCCCCAGGGCTTGGGGGAGG + Intergenic
901533485 1:9867755-9867777 TTGTCTCCAGGGACTGGGGCAGG - Intronic
901649052 1:10732937-10732959 TTACCCCCAGGGACCAGTGGGGG - Intronic
902251320 1:15155581-15155603 GTCCCCCCAGGGAACAGGGGAGG + Intronic
903664659 1:24998871-24998893 GCCTTCCCAGGGACTAGGGCAGG - Intergenic
905919954 1:41712777-41712799 TTCTCCCCAGGGAGGATGGAGGG - Intronic
906532165 1:46530194-46530216 TACTCCCCAGGGCCTGGGGGCGG - Intergenic
909212659 1:72844213-72844235 ATCTCCCTAGGGGCTTGGGGTGG - Intergenic
910843210 1:91581206-91581228 TGGTCACCAGGGACTAGTGGAGG + Intergenic
913099866 1:115553330-115553352 TTCATTCCAGGGACAAGGGGAGG + Intergenic
914340035 1:146752582-146752604 TTCTCCCCAGGGTTGCGGGGAGG - Intergenic
915339058 1:155166588-155166610 TGCTCCCCAGGGGCTGGGGAAGG - Intergenic
915586206 1:156845284-156845306 CTCTCCCCAGGGACTCAGGGCGG - Exonic
916004296 1:160645715-160645737 TACTTCCCAAGGTCTAGGGGAGG - Intronic
916679378 1:167090207-167090229 TTCTCTCCAGTGCCCAGGGGTGG - Intronic
920126145 1:203695275-203695297 TTCTCCCCAGGGACCAGAGATGG - Intronic
920835414 1:209506303-209506325 TTCTCCCCAGGGACACTGGTTGG + Intergenic
921176578 1:212600280-212600302 CTGTCCCCAGGGACAAAGGGAGG - Intronic
921602619 1:217122630-217122652 TTCCCGCCATGGACTAGGGAAGG - Intronic
922152407 1:223017413-223017435 TTTTTCCCAGGGGCTGGGGGTGG - Intergenic
922802348 1:228370223-228370245 TACTCACCAGGAACCAGGGGTGG - Exonic
923029211 1:230233950-230233972 TCCTCCACAGGGTCTCGGGGAGG + Intronic
1067760251 10:49039557-49039579 TTCTCCCTAGAGAACAGGGGTGG + Intronic
1072661122 10:97364093-97364115 TTATCCCTAGGGCCTAGGGTGGG - Intronic
1073423457 10:103442157-103442179 TGCTCCTCAAGGCCTAGGGGAGG - Intronic
1073659978 10:105464104-105464126 TTTTTTCCATGGACTAGGGGTGG - Intergenic
1074221841 10:111445705-111445727 CTTTCCCCAGGGGCTAGAGGTGG + Intergenic
1076299783 10:129416349-129416371 TTTGCCCCAGGGAATATGGGTGG + Intergenic
1076861732 10:133141098-133141120 TTCTCCCCTGTGACCTGGGGAGG - Intergenic
1076906052 10:133361669-133361691 TTCAACCCAGGGATTTGGGGTGG + Intergenic
1076928691 10:133511539-133511561 AACTCCCCTAGGACTAGGGGAGG + Intergenic
1077459724 11:2702959-2702981 TTCCCCCAAAGGACTAGAGGAGG - Intronic
1077672034 11:4166169-4166191 TCCTCCCCAGGGCCTAGAGCAGG - Intergenic
1079539044 11:21550051-21550073 TCCTCCACAGAGACTAGGAGAGG + Intronic
1079982680 11:27167743-27167765 TTCTCCCCAGTGACTAAGTATGG + Intergenic
1079986955 11:27209737-27209759 TTCTCCCCAGAGACTGGGGCAGG - Intergenic
1081638226 11:44734977-44734999 TTCTCCACAGGGACCATGGAGGG - Intronic
1081839041 11:46182574-46182596 TGCTCCTCAAGGACTAGAGGAGG - Intergenic
1083224092 11:61273779-61273801 TGCTCCCCAGGGAGTGGGGGTGG - Intronic
1084054978 11:66626162-66626184 TTCTCTGCAGGGCCCAGGGGCGG + Intronic
1085507409 11:77068184-77068206 CTGTCCCCAGGGTCTGGGGGTGG + Intronic
1087053639 11:93910362-93910384 TTCTACCCAAGGACTAGGGTGGG - Intergenic
1087492329 11:98844571-98844593 TACTCCCCATGGGCCAGGGGTGG - Intergenic
1088593028 11:111419532-111419554 GTCTCCCTTGGGACTAGGGTGGG + Intronic
1089078016 11:115754205-115754227 TTCTAGCCAGGGACCAGGGGTGG + Intergenic
1089396061 11:118136827-118136849 GGCTCCCCAGGGACAAGGGATGG - Exonic
1089981865 11:122779399-122779421 CTCTCCCCAGAGACTGGAGGAGG - Intronic
1090438783 11:126709331-126709353 CTCTTCCCCGGGAGTAGGGGTGG + Intronic
1091275368 11:134346113-134346135 GGCTCCCCAGGGACCAGGGGAGG - Intronic
1091823860 12:3494861-3494883 TTCTCCTCATGGAATAGGGCAGG + Intronic
1092261156 12:6953918-6953940 CTCAGCCCAGGGACGAGGGGAGG - Intronic
1096127438 12:49130318-49130340 CTGTCCGCAGGGACAAGGGGCGG + Intronic
1096574614 12:52544855-52544877 TTCTCCCCAGGGAGAGGGAGCGG - Intronic
1096633462 12:52944435-52944457 ATCTGCCCAGAGATTAGGGGAGG - Intronic
1098702114 12:73642301-73642323 TGGTTGCCAGGGACTAGGGGAGG - Intergenic
1101784962 12:107874757-107874779 CCCTCCCCAGGGACTAGAGCAGG + Intergenic
1102594821 12:113984246-113984268 ATCCCCCCAGGGAGAAGGGGAGG - Intergenic
1103322821 12:120101779-120101801 TTTTCCCCAGGGGCTTGGGAAGG - Intronic
1103726369 12:122999266-122999288 TTCTTCCCAGGGGCCAGGGCAGG + Intronic
1105747480 13:23391599-23391621 TAGACCCGAGGGACTAGGGGAGG - Intronic
1107295119 13:38899749-38899771 TTCTCCCCAGGGTCTGGGTGGGG - Intergenic
1110349586 13:74491727-74491749 TACTTGCCAGGGATTAGGGGAGG - Intergenic
1111682188 13:91457750-91457772 TTCTCCCTAGGCACTAGGAAAGG - Intronic
1111744885 13:92254864-92254886 TTATCCCCATGTACTGGGGGAGG - Intronic
1111918789 13:94389245-94389267 TTCACCCCAGGAACTTTGGGAGG - Intronic
1119535871 14:75402050-75402072 CTCGCCCCAGGGACAAAGGGAGG - Intergenic
1120704319 14:87731676-87731698 TTGTCCACAGAGACAAGGGGTGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1122284575 14:100643092-100643114 TTCTCTGGAGGCACTAGGGGAGG - Intergenic
1123911021 15:24967102-24967124 TTCTCCCCAGGGGTGAGGGGAGG - Intronic
1124231966 15:27953527-27953549 TTCTCACCAGGCATGAGGGGAGG + Intronic
1124618257 15:31258045-31258067 ATGTCCACAGGGACTATGGGTGG + Intergenic
1124898444 15:33799342-33799364 CTCTCCCCAGAGGTTAGGGGAGG - Intronic
1125097501 15:35871451-35871473 TTCTGCACAGGGCCTAAGGGTGG + Intergenic
1126009587 15:44289397-44289419 TTCTCCCCGGGGTCTGGGGCGGG + Intronic
1128604870 15:69029154-69029176 TGGTTGCCAGGGACTAGGGGAGG - Intronic
1129584495 15:76849018-76849040 TCCTGCCCTTGGACTAGGGGAGG + Intronic
1130241484 15:82197255-82197277 CTGTCCCCTGGGAATAGGGGTGG - Intronic
1130788358 15:87124537-87124559 TTCTGCCCTGGGACCAGCGGGGG + Intergenic
1131525121 15:93146490-93146512 TTCTCCCCAGGGAGAGGCGGCGG - Intergenic
1134058199 16:11183136-11183158 TTTTCCCCAGGGCCTCGGGAGGG + Intergenic
1134264539 16:12681902-12681924 TACTCTCCAGGGGCTAGAGGTGG + Intronic
1135546837 16:23372050-23372072 CTCTCACCAGGGCCTAGGGTTGG + Intronic
1137872262 16:51961835-51961857 TTGTTCCCTAGGACTAGGGGTGG + Intergenic
1137935434 16:52630805-52630827 TTTTCCCCAGGGACTTGCTGTGG - Intergenic
1138092821 16:54190485-54190507 TAGTCCCCATGGACTGGGGGTGG + Intergenic
1138218498 16:55227152-55227174 TTGTCAGCAGGTACTAGGGGAGG - Intergenic
1139558497 16:67727574-67727596 CTCTCCCCAGAGCCTAGGTGTGG + Intronic
1139994253 16:70964826-70964848 TTCTCCCCAGGGTTGCGGGGAGG + Exonic
1142471890 17:169334-169356 GCCTCCCCAGGGGCCAGGGGAGG + Intronic
1143659284 17:8314896-8314918 TTCTCCACAGGGAAGAGGAGGGG + Exonic
1143892855 17:10115745-10115767 TTCTCCCCAGGGACTAGGGGCGG - Intronic
1144635705 17:16907581-16907603 TTCCCACCAAGGACTAGGTGTGG + Intergenic
1145784737 17:27586540-27586562 TTCTGCCCGGGCACTAAGGGAGG - Intronic
1145975481 17:28981583-28981605 ATCTCCCCTGGGCCTAGGGTGGG + Exonic
1146603020 17:34234897-34234919 TACTTCCCAGGGACTAAGGGTGG - Intergenic
1148470301 17:47889059-47889081 TTGTCCCCAGGGACAAAGGGAGG - Intergenic
1148509666 17:48157817-48157839 TGCTCCCCAGTGGCTAGGTGTGG - Intronic
1151170458 17:72241457-72241479 TGCTCCCCCTGGACTGGGGGTGG - Intergenic
1151345602 17:73499471-73499493 TTCTCCACATGGGCCAGGGGTGG + Intronic
1151353052 17:73542920-73542942 CGCTCTCCAGGGCCTAGGGGAGG - Intronic
1151541539 17:74767352-74767374 TTCTGCCCAGGGAAGGGGGGAGG - Intronic
1151783991 17:76266173-76266195 TTCCCCCCAGGGACCAGTGCCGG - Intronic
1151906887 17:77054604-77054626 CTCTCCCGATGGACTAGGAGAGG + Intergenic
1152225921 17:79092760-79092782 TTCTCCCCAAGGAATATAGGGGG - Intronic
1152376382 17:79920875-79920897 TTCTCTCCTGGGACTGGGGCAGG + Intergenic
1152747789 17:82049216-82049238 CTCTCCCCAGGCCCTCGGGGAGG + Intronic
1154087687 18:11323094-11323116 TTCTCCCCGGGGACAAGGCCAGG + Intergenic
1154197887 18:12279524-12279546 TTCTCCCCATGGGAAAGGGGAGG + Intergenic
1157100026 18:44720912-44720934 TTCTCCCCAAGGGGTTGGGGTGG - Intronic
1157569882 18:48705222-48705244 TTCTTCCAAGGCTCTAGGGGAGG + Intronic
1160724332 19:610916-610938 TCCTCCCCAGGGGCTCCGGGGGG - Intronic
1160840956 19:1146853-1146875 TTCTCCCCAGGGTCGCGGGGAGG - Intronic
1161384731 19:3984991-3985013 TTCTGCCGGGGGACTAGGGGCGG - Intronic
1161741788 19:6025328-6025350 TTCTCCCAAGAGACAAGGGGAGG + Intronic
1163166641 19:15502635-15502657 TTGGCCCCAGGTCCTAGGGGTGG + Intergenic
1163425085 19:17236492-17236514 TTGTCCCCAGGAGCTGGGGGTGG - Intronic
1163681675 19:18686103-18686125 TGCTTGCCAGGGGCTAGGGGAGG - Intronic
1165443082 19:35842039-35842061 TTCTCTGCAGGGACTCAGGGAGG + Intronic
1167612108 19:50512625-50512647 GGCTCCCCAGGAACCAGGGGAGG - Intronic
1167648538 19:50718284-50718306 GTCTCCGCAGGGACGAGGTGGGG - Intronic
926038234 2:9652008-9652030 TTGTCCCTCAGGACTAGGGGTGG + Intergenic
926109396 2:10172353-10172375 TGCTCCGGAGGGACCAGGGGAGG + Intronic
927853152 2:26512463-26512485 TTCTCTCCAGAGACTAGGGCAGG + Intronic
927912790 2:26913274-26913296 TGATTGCCAGGGACTAGGGGAGG - Intronic
929869895 2:45750290-45750312 TTTTTCCCAGGGGCTGGGGGAGG - Intronic
930108541 2:47658596-47658618 TTCTTCCCAGGGGAGAGGGGAGG + Intergenic
932497397 2:72153222-72153244 TTCTTCCCAGGGCCTCGGGCTGG + Intergenic
932686543 2:73875526-73875548 TTCTCCCTCAGTACTAGGGGAGG + Intergenic
932816429 2:74865674-74865696 TCCTGCCCAGTGACTAGAGGTGG - Intronic
932942391 2:76183034-76183056 TTCTCCTCTAGGACTAGGGCAGG - Intergenic
936529940 2:113269006-113269028 ATGTCCCCAGGGAATATGGGGGG + Intronic
937853316 2:126655446-126655468 TTCTGCCCAGAGACAAGGGCAGG - Intergenic
941752130 2:169144495-169144517 TTCTCCTCAGGGTCCAGAGGCGG + Intronic
943674633 2:190705072-190705094 CTCTCCCCAGGGGGTAGGAGAGG + Intergenic
946280576 2:218663046-218663068 TCCTCCCAAGGCACTAGGGGAGG - Intronic
947203000 2:227632694-227632716 TTGTTGCCAGGGACGAGGGGTGG + Intronic
947680624 2:232028831-232028853 TTTTCCTCAGGGACTAGGGTGGG + Intronic
947765344 2:232634028-232634050 TTCGCCCCCGGGACCAGGGAGGG + Intronic
948444141 2:238019089-238019111 TTCCCCACAGGGACTAGTAGTGG - Intronic
948926745 2:241103763-241103785 TTCTTTCCAGGGAGTTGGGGTGG - Intergenic
1169255621 20:4095023-4095045 TTCTCTCCAGGCAGTAGGGTGGG - Intergenic
1169542857 20:6619320-6619342 CTCTCCCCAGAGTTTAGGGGTGG + Intergenic
1172633372 20:36393548-36393570 TGCTCCCCAGGGGCTCGGTGTGG - Intronic
1173220085 20:41125371-41125393 TTCACCCCAGGGAATAAGGGAGG + Intergenic
1173264560 20:41467436-41467458 TTTTCTCCAGGGATTAGGGCTGG - Intronic
1174852173 20:54006141-54006163 TTCTCTTCAGGGAATAGGTGGGG - Intronic
1175036418 20:56004928-56004950 TTGTGCGCAGGGACTGGGGGCGG - Exonic
1175461724 20:59156673-59156695 TGATCACCAGGGAGTAGGGGAGG - Intergenic
1175832525 20:61974059-61974081 TTCTCCCCAGGCTCTGGGGAAGG - Intronic
1176218252 20:63958200-63958222 TTCTCCCTGGGGAATGGGGGAGG + Exonic
1177114184 21:17065684-17065706 TTCTCCCCAGGGACTTCAGGGGG + Intergenic
1180081302 21:45488965-45488987 TGCTGCCCAGGGCCTAGGAGAGG - Intronic
1180149141 21:45938848-45938870 GTCTCCTCAGGGACAAGGGCTGG + Intronic
1180153722 21:45966837-45966859 CTTTCCCCAGGGTCTAGGGTGGG - Intergenic
1182430471 22:30295907-30295929 GGCTGCCCAGGGATTAGGGGAGG + Intronic
1182619030 22:31608254-31608276 TTCTCCACAGGCTCTAGGGGAGG + Intronic
1182860611 22:33556415-33556437 TTACCCCCAGGGCCTAGGGCAGG + Intronic
1183581218 22:38727747-38727769 GTCTGCCCAGGGCCTGGGGGTGG + Intronic
1184874326 22:47263599-47263621 TTCTCACCAGGGACTAGAAGGGG - Intergenic
949535559 3:4993461-4993483 TTCTTCCCAGGGTGTAGGGCTGG - Intergenic
950492827 3:13316579-13316601 GACTCCCCAGGGCCTGGGGGAGG - Exonic
951447367 3:22798407-22798429 TTTCCCTCAGGAACTAGGGGCGG - Intergenic
952883276 3:37998430-37998452 TCCGCCCCAGGGTCTAAGGGAGG + Intronic
954459535 3:50618382-50618404 CTCTGCCCAGGAACCAGGGGTGG - Intronic
955104636 3:55885402-55885424 TTCTGCCCTGGGACTATGGGAGG - Intronic
961980422 3:131072403-131072425 TTCACCACAGGAACTAGGGGAGG + Intronic
964364470 3:155934571-155934593 TTCTCCCCAGAGATTCTGGGTGG + Intronic
964604425 3:158544996-158545018 TTCTCCACAGGGAATAGCAGTGG - Intronic
964723870 3:159794475-159794497 TTCTCAACAGGGAGTAGGTGTGG + Intronic
965322223 3:167264852-167264874 AAATCCCCATGGACTAGGGGTGG - Intronic
968451554 4:678436-678458 TTCAGCACAGGGACTGGGGGAGG - Intronic
969239142 4:5888049-5888071 TTGTCCCCAGAGGCTGGGGGAGG + Intronic
969458684 4:7315786-7315808 CTCTCCCCAGTGACTAGCTGTGG + Intronic
969615862 4:8252313-8252335 TTCAGCCCAGGGACTTGGGATGG - Intergenic
971047832 4:22825783-22825805 TGGTTACCAGGGACTAGGGGTGG - Intergenic
977614654 4:99074717-99074739 TTTACCCCTGGGACTTGGGGGGG - Intronic
985493154 5:190907-190929 TTCTCCCCAAGGACCCGGCGGGG - Intergenic
985626720 5:992763-992785 TTCTCCCCAGTGAGTACAGGGGG - Intergenic
986010491 5:3710204-3710226 TTCTCCACAGGGACTAAGATGGG + Intergenic
986449233 5:7849960-7849982 TTCTGCCCAGGGTCTGGAGGGGG - Intronic
986768053 5:10946064-10946086 TTCTCCCCAGGGCCTGCAGGAGG - Intergenic
987566329 5:19592829-19592851 TTGTTACCAGGGACTAGGGAAGG - Intronic
988956664 5:36327077-36327099 TTCTCCCCAGGGATCTGGGGAGG + Intergenic
990761400 5:59133818-59133840 TATTCCCCAGGGACTCTGGGAGG + Intronic
990996926 5:61741850-61741872 TTATCCCAAAGGATTAGGGGTGG - Intronic
992550422 5:77854579-77854601 TTCACCCCAGTGATTAGAGGTGG - Intronic
992741390 5:79776895-79776917 TTCTCCCCAGGGGAGCGGGGCGG - Intronic
995345840 5:111116327-111116349 TTCTCCTCAGGAAGTAGGGGTGG - Intronic
995841729 5:116448406-116448428 TTCACTCCAGGGAATATGGGAGG + Intronic
997102831 5:130987668-130987690 TTCTCCCCAGGGAGGAGGAGGGG - Intergenic
997200558 5:132007583-132007605 TTCTCCCCATTGCCTAGGTGAGG - Intronic
997720795 5:136077042-136077064 ATCTCCCCAGAGTCCAGGGGTGG - Intergenic
998043477 5:138968263-138968285 TATTCCCCAGGGGCCAGGGGAGG - Intronic
1001788014 5:174430620-174430642 TGGTCCCCAGGCTCTAGGGGAGG + Intergenic
1002195405 5:177498268-177498290 TTCAGCCCAGGCACTAGGGCCGG + Intergenic
1002785852 6:399352-399374 ATGTCCCCAGGGAGTAGAGGAGG - Intronic
1006335029 6:33415955-33415977 TTGTCTCCTGGGACTGGGGGAGG + Exonic
1007784830 6:44273573-44273595 TTCCCCCCAGGGAGGTGGGGAGG - Intronic
1008944174 6:57079270-57079292 TTCCCCCCAGGGGTTAAGGGTGG + Intergenic
1009197937 6:60709749-60709771 GTCTCCCCAAGGAGTAGGGCAGG - Intergenic
1009301593 6:62031103-62031125 AGCTCACCAGGGACCAGGGGTGG + Intronic
1015598220 6:134886889-134886911 TAATTCCCAGGGACTAAGGGTGG + Intergenic
1015782140 6:136879558-136879580 TTTTCCCCAGGGTCTCGAGGAGG - Intronic
1016795169 6:148110129-148110151 CTCTCCACAGGGAATGGGGGTGG - Intergenic
1019705172 7:2494184-2494206 TTCCCCACTGGGACTGGGGGTGG - Intergenic
1020013370 7:4818064-4818086 TTCTCTCCTGGGACTGTGGGCGG + Intronic
1020136385 7:5590359-5590381 TTCCCCGGAGGGACTTGGGGTGG + Intergenic
1020507336 7:9008342-9008364 GGCTACCCAGGAACTAGGGGAGG - Intergenic
1024037685 7:45522737-45522759 TTCTCCAGAGGCTCTAGGGGAGG + Intergenic
1026471854 7:70700570-70700592 TTCTCCCCAGGGAGGAAAGGGGG - Intronic
1027237723 7:76307802-76307824 TGCCCCCCAGGGAATATGGGGGG + Intergenic
1028426237 7:90692674-90692696 TCCTGCCCCAGGACTAGGGGAGG + Intronic
1031084357 7:117287575-117287597 GTCTCCCCAGGGACAGGGGTTGG + Intronic
1032334041 7:131008037-131008059 TAAGGCCCAGGGACTAGGGGTGG - Intergenic
1032498918 7:132385041-132385063 TTTTCCCTAAGGACTTGGGGTGG + Intronic
1033313773 7:140281405-140281427 TGCTTGCCAGGGACTGGGGGAGG + Intergenic
1034271545 7:149805588-149805610 TTCTCCCTTGGGCCCAGGGGTGG + Intergenic
1035147840 7:156838375-156838397 TGGTTGCCAGGGACTAGGGGTGG - Intronic
1038536362 8:28355977-28355999 TTCTTCCCTGGGAGTAGGGTAGG + Intronic
1038898951 8:31820177-31820199 TACTCCACAGGAACTAGGGCTGG - Intronic
1042194331 8:66219735-66219757 TCCTCACAAGGGACAAGGGGAGG - Intergenic
1043740158 8:83801321-83801343 TTCTCCCCATGGGCTTGTGGTGG - Intergenic
1044474441 8:92609577-92609599 TTCTCCCAAGGCTCTAGGGAAGG + Intergenic
1046729931 8:117713807-117713829 TCCTCTCCAGGGAGCAGGGGTGG - Intergenic
1049389759 8:142361613-142361635 TTTTCCCCAGGGGACAGGGGAGG - Intronic
1050890786 9:10821633-10821655 CTCTTCCCAGAGACCAGGGGTGG + Intergenic
1052966103 9:34341798-34341820 AACTCCCCAGGGTCCAGGGGCGG - Intronic
1053025226 9:34723845-34723867 TTCTCCCCAGGGACTCGTGGAGG + Exonic
1053036755 9:34832907-34832929 TTCTCCCCAGGGACTCGTGGAGG + Intergenic
1055324181 9:75111371-75111393 TTCTCTTCAGGGACTGGGTGGGG + Intronic
1055589609 9:77797896-77797918 TACTCCCCAGAGGCAAGGGGTGG + Intronic
1056892112 9:90503894-90503916 TTCTGTCAGGGGACTAGGGGTGG + Intergenic
1058839809 9:108895323-108895345 TTCCCTCCAGGGACTGGGTGAGG - Intronic
1060394358 9:123305181-123305203 CTCTCCCAAGGGACTGGGAGGGG - Intergenic
1060572667 9:124656876-124656898 TTGTCCCCAGGGCCTGGGGGAGG + Intronic
1060920659 9:127418179-127418201 TGCCCCCCGGGGACCAGGGGTGG + Intergenic
1061282883 9:129607583-129607605 TTCTCAGCATGGACCAGGGGAGG - Intergenic
1061864350 9:133484869-133484891 TGCTCCCCAGGGACAGGCGGCGG - Intergenic
1061943437 9:133894893-133894915 TTTACCCCAGGGTCTAGGGCCGG - Intronic
1062170966 9:135134389-135134411 TGCTCCCCAGGGGCGAGGCGCGG - Intergenic
1062530560 9:136997664-136997686 TTCTCCCCAGGGCCTTGGTACGG + Intergenic
1203773609 EBV:61282-61304 TGCTCGCCGGGGAGTAGGGGGGG + Intergenic
1185813539 X:3132513-3132535 TTCTCCAGAGGCTCTAGGGGAGG + Intergenic
1189949518 X:46214336-46214358 CCCTCCCCAGAGATTAGGGGTGG - Intergenic
1192437795 X:71153584-71153606 TTCTCCCCATCGAGAAGGGGAGG - Intronic
1194459358 X:94147447-94147469 TTCTCCCCAACGACTTGGTGGGG + Intergenic
1199299919 X:146201128-146201150 TGGTCGTCAGGGACTAGGGGAGG - Intergenic
1200022505 X:153224016-153224038 TTTTCCCCATTGACTGGGGGTGG + Intergenic
1200204011 X:154302949-154302971 CTCTCCCTAGGTCCTAGGGGAGG - Intronic
1200275988 X:154732965-154732987 TTATCCCCAGGTACTTGGAGAGG + Intronic
1201268063 Y:12228027-12228049 TTCTCCAGAGGCTCTAGGGGAGG - Intergenic
1201349399 Y:13023333-13023355 CTCTCCCCCTTGACTAGGGGAGG - Intergenic