ID: 1143893717

View in Genome Browser
Species Human (GRCh38)
Location 17:10120941-10120963
Sequence GGCCCACTGGAACCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143893709_1143893717 23 Left 1143893709 17:10120895-10120917 CCTTTCTCACCATTTCCTTCCTT 0: 1
1: 0
2: 15
3: 170
4: 1575
Right 1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 173
1143893711_1143893717 8 Left 1143893711 17:10120910-10120932 CCTTCCTTCACAACTGCCACATG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 173
1143893712_1143893717 4 Left 1143893712 17:10120914-10120936 CCTTCACAACTGCCACATGAAAG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 173
1143893710_1143893717 14 Left 1143893710 17:10120904-10120926 CCATTTCCTTCCTTCACAACTGC 0: 1
1: 0
2: 1
3: 44
4: 534
Right 1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 173
1143893714_1143893717 -8 Left 1143893714 17:10120926-10120948 CCACATGAAAGCAAAGGCCCACT 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143893717 Original CRISPR GGCCCACTGGAACCCCAAGG TGG Intronic
900504936 1:3025134-3025156 TTCCCACTGAAACCCAAAGGTGG + Intergenic
903424664 1:23244982-23245004 GGCCCTCGTAAACCCCAAGGAGG + Intergenic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
905342988 1:37292058-37292080 AGCCCACAGCAACGCCAAGGTGG + Intergenic
906165185 1:43680779-43680801 GGCCCAATGTAATCCCAATGGGG - Intronic
906370501 1:45249079-45249101 AGCACACTGGAAAGCCAAGGTGG - Intronic
906675214 1:47688392-47688414 GGCCCCCTGGCACCACACGGGGG - Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
911055279 1:93703125-93703147 GTCCCTCTGGAAACCTAAGGAGG - Intronic
913549401 1:119902896-119902918 GGCCCACTGGAGCCACACCGGGG - Intergenic
915376572 1:155401532-155401554 AGCACACTGGAAGGCCAAGGTGG + Intronic
915470277 1:156121773-156121795 AGTACACTGGGACCCCAAGGAGG - Intronic
916341736 1:163744697-163744719 GGCCCACTGTAACCACAACCTGG + Intergenic
916890315 1:169106832-169106854 GGCCCGCGGGAAAGCCAAGGAGG + Exonic
917250932 1:173060135-173060157 GGCCCAATGTAATCACAAGGGGG - Intergenic
919231831 1:194783389-194783411 GATCCACTGGAACAACAAGGTGG + Intergenic
919974770 1:202603287-202603309 GGCCCATCAGAACCCCTAGGTGG + Intronic
920298795 1:204975961-204975983 TGCACACTGGAACCCCCAGGGGG - Intronic
921390393 1:214608667-214608689 GGCCCGCAGGGTCCCCAAGGGGG + Intronic
922549214 1:226481750-226481772 GCCCCACAGAAAGCCCAAGGAGG - Intergenic
1062765809 10:64227-64249 GGCCCACTGTAACCACAACTTGG + Intergenic
1063960331 10:11301323-11301345 AGCCCACTGGAGCCCCTATGCGG + Intronic
1064052061 10:12067963-12067985 GGCCCTCTGGGAGGCCAAGGAGG - Intergenic
1065628293 10:27653435-27653457 GGACCACTGCCACCCCTAGGTGG + Intergenic
1067820921 10:49529452-49529474 AGCCCACTAGAAGCCCAAGAAGG + Intronic
1069975398 10:72208914-72208936 AGCCCACTGGGAGGCCAAGGCGG + Intronic
1076451890 10:130561778-130561800 GGAGCACAGGAACCCCAAGAAGG - Intergenic
1076496298 10:130899864-130899886 GACCCACTGGGACCCCACCGAGG + Intergenic
1077295785 11:1825657-1825679 GGCCCTCTGGAACTGCAGGGAGG + Intergenic
1077359456 11:2134256-2134278 TGCCCTTTGGCACCCCAAGGTGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079545789 11:21630341-21630363 GGACCAAGGGAGCCCCAAGGAGG + Intergenic
1079898121 11:26148390-26148412 GGCCCTAAGGAACCCAAAGGTGG - Intergenic
1080118668 11:28649013-28649035 GGCCCCCTGGAACGCCAAGCTGG - Intergenic
1080579646 11:33631713-33631735 GGGCTACTGGAACACAAAGGAGG - Intronic
1082284847 11:50307205-50307227 GGCACTCTGGAAGGCCAAGGCGG - Intergenic
1083592636 11:63904483-63904505 GGCAGACTGGACCCTCAAGGCGG - Intronic
1083949676 11:65947136-65947158 GGCCCACTGGAAGGGGAAGGAGG - Exonic
1084219489 11:67668363-67668385 GGCCCAAGGGAACCCCAGTGGGG + Intronic
1084332713 11:68439318-68439340 GTCCCACTGTCACCCCAAGCCGG + Intronic
1084456392 11:69270302-69270324 GTCCCACAGGGACCCCATGGTGG + Intergenic
1084588849 11:70078794-70078816 GGCCTCCTGGGACCCCAGGGCGG + Intronic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1087722994 11:101687873-101687895 GGCCCAGTGGAATCACAAAGTGG + Intronic
1088706845 11:112471545-112471567 GGACCTCTGGAAGCCCCAGGAGG - Intergenic
1089401308 11:118166220-118166242 AGCCAACGGGAGCCCCAAGGAGG + Exonic
1089511219 11:118998395-118998417 GGCCAAGTAGAACCCCGAGGGGG - Intronic
1091369695 11:135047727-135047749 GCCCCACAGGCACCCCCAGGGGG - Intergenic
1093432438 12:19099080-19099102 AGCCCTCTGGGACGCCAAGGTGG - Intergenic
1093736477 12:22625553-22625575 GCCTCACTGGGACCCCCAGGAGG + Exonic
1094021104 12:25915368-25915390 GGCTCACTTAAACCCCCAGGAGG - Intergenic
1096421638 12:51463671-51463693 GGCCCACTGTGACCCCCATGTGG - Exonic
1100839090 12:98593896-98593918 GGCGCCCTGGAACCCCAACCGGG - Intronic
1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG + Intergenic
1107449707 13:40497442-40497464 GGCCCACGCGAATCCCAGGGAGG + Intergenic
1109213668 13:59563521-59563543 AGCTCACTGGGTCCCCAAGGAGG - Intergenic
1109696933 13:65972799-65972821 GGCACACTGGAACCCCTGGTTGG + Intergenic
1111845093 13:93497831-93497853 GGCTCTCTGGAACTCTAAGGGGG - Intronic
1116835008 14:49762022-49762044 GGCCTACTGTAACCCCCACGTGG + Intergenic
1116855430 14:49948262-49948284 GGCCCTCTGGGACACCCAGGTGG + Intergenic
1117647929 14:57871694-57871716 GCCCCACTACAACCACAAGGGGG - Intronic
1118641628 14:67798035-67798057 GGCCCAGTGGAGACACAAGGTGG - Exonic
1119286092 14:73456844-73456866 GACCTACTGAAACCCCCAGGTGG + Intronic
1119867316 14:77984618-77984640 AACCCACCGGGACCCCAAGGGGG + Intergenic
1121883579 14:97522616-97522638 GGGTCACTGGAAGTCCAAGGTGG - Intergenic
1122938712 14:104971782-104971804 GGCACACTGGGATCCCAGGGGGG - Intronic
1202941303 14_KI270725v1_random:149235-149257 AGCCCACTGGGAGGCCAAGGCGG - Intergenic
1124405763 15:29390096-29390118 GGCCCACTGGAGACCAAGGGCGG + Intronic
1125640790 15:41229401-41229423 GGCTCACTGCAACCTCCAGGCGG - Intronic
1126089506 15:45038942-45038964 GCCCTACTGTAGCCCCAAGGTGG - Intronic
1127293806 15:57592271-57592293 GGCCCCCTGAAACCTCAAGCGGG - Intronic
1127450440 15:59111279-59111301 GGCACTTTGGAAGCCCAAGGTGG - Intronic
1129690412 15:77710120-77710142 AGGCCTCTGGAACCCCAGGGGGG + Intronic
1131178826 15:90226586-90226608 GGCACTCTGGGAGCCCAAGGTGG - Intronic
1134481522 16:14623587-14623609 AGCACACTGGAAGGCCAAGGCGG + Intronic
1135389137 16:22074320-22074342 AGCACACTGGAAGGCCAAGGCGG + Intronic
1136383043 16:29905825-29905847 GGACCTCTGGCACCCCAACGTGG + Exonic
1136425165 16:30165284-30165306 GTCCCATTAGAACCCCAGGGAGG - Intergenic
1137728132 16:50670606-50670628 GGCCCACTGCAGCCCCACCGGGG - Intronic
1143376414 17:6470213-6470235 TGCCCACAGCCACCCCAAGGGGG - Intronic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1144728253 17:17512453-17512475 GGACCGCTGGAGCCCCAGGGAGG - Intronic
1145190744 17:20841198-20841220 GGCCCGCAGGGTCCCCAAGGGGG - Intronic
1148830003 17:50425424-50425446 GGGCCTCAGGAACCCTAAGGAGG + Intergenic
1149446094 17:56714456-56714478 GACCCTCAGGAGCCCCAAGGGGG - Intergenic
1151254251 17:72863396-72863418 GACCCAAGGGAAACCCAAGGAGG + Intronic
1152293700 17:79454732-79454754 GGGCCACAGGAGCCCTAAGGTGG - Intronic
1152743441 17:82028596-82028618 GGCGCTCTGGAAGCCCAGGGTGG - Exonic
1154309977 18:13259888-13259910 GGCCCAATGGAGGCCCCAGGAGG + Intronic
1157564280 18:48669038-48669060 GGCGCCCTGGAACCCAGAGGAGG - Intronic
1161423997 19:4192140-4192162 GGCCCACGGACAGCCCAAGGGGG - Intronic
1162069975 19:8147603-8147625 GGGCCTCTGGGAGCCCAAGGAGG + Intronic
1165434146 19:35787516-35787538 GGCCCATGGGGACCTCAAGGAGG + Exonic
1167235520 19:48312266-48312288 GGCCCACCAGAACCACATGGAGG - Intronic
1168343625 19:55640340-55640362 GGCCCACTGGAAGCCTGATGCGG - Intronic
926571356 2:14533679-14533701 GGCTACCTGGAACTCCAAGGAGG + Intergenic
929336144 2:40748415-40748437 GGCTCACTGCAAGCTCAAGGCGG - Intergenic
931101805 2:59010780-59010802 GGCCAAGTGGAGCACCAAGGAGG + Intergenic
932495590 2:72144427-72144449 GGCCCAGGGGCACCCCCAGGAGG + Intronic
932574070 2:72953209-72953231 TGCCCACAGGACCCCCCAGGAGG - Intronic
933101305 2:78261658-78261680 GGCCAATTTGAACCCCCAGGGGG - Intergenic
934843375 2:97645790-97645812 GACCCACAGGAACTCCAATGTGG + Intergenic
935688858 2:105712305-105712327 TGGCCACTGGAACCCCCAGGGGG - Intergenic
935755868 2:106275912-106275934 GGCCCACCTCCACCCCAAGGTGG + Intergenic
936573427 2:113634782-113634804 AACACACTGGAAGCCCAAGGAGG - Intronic
937263611 2:120601969-120601991 GGGCCACAGAATCCCCAAGGGGG - Intergenic
938197060 2:129337780-129337802 GGCTCACTGGAACAGCAAGCTGG - Intergenic
938381257 2:130837615-130837637 CCCCCACAGGAACCCCAAGATGG + Intronic
940372411 2:152918055-152918077 GGCCCACTGGAGCCACATGTGGG - Intergenic
940990645 2:160092714-160092736 GGGCCACTGGAACCTTGAGGGGG - Intergenic
942004042 2:171679799-171679821 GGCCAACGGGAAGCCCCAGGAGG + Intergenic
946112813 2:217435071-217435093 GGCACTCTGGGACACCAAGGCGG + Intronic
946132976 2:217621995-217622017 TGCCCACTGGGAAGCCAAGGGGG - Intronic
947463561 2:230323084-230323106 TTCCTTCTGGAACCCCAAGGTGG - Intergenic
1169141722 20:3230439-3230461 AGCCCCCTGTAACCCCAGGGTGG - Intronic
1171840138 20:30199730-30199752 AGCCCATTGGAAGGCCAAGGCGG - Intergenic
1175872740 20:62216135-62216157 GGCCCACAGGAGCCAGAAGGAGG + Exonic
1176581861 21:8537700-8537722 AGCCCACTGGGAGGCCAAGGCGG + Intergenic
1178495849 21:33085730-33085752 GCCCCTCTGGAAGCCAAAGGTGG + Intergenic
1180264696 22:10514772-10514794 AGCCCACTGGGAGGCCAAGGCGG + Intergenic
1180619346 22:17149716-17149738 GTCCAACAGGAACCCAAAGGTGG + Exonic
1180759123 22:18186098-18186120 CGCCCACGGGATCGCCAAGGAGG - Intergenic
1181121535 22:20670801-20670823 GGCCCGCAGGGTCCCCAAGGGGG + Intergenic
1181749285 22:24977574-24977596 GGCCCTTTGGAGCCCCAGGGTGG - Intronic
1183667101 22:39252449-39252471 GGTCCCCTGGTGCCCCAAGGGGG - Intergenic
1183832228 22:40424376-40424398 GGCCCACTGAAACCCAAAGCTGG + Exonic
1185275406 22:49948414-49948436 GGACCACGGGAACCCCCAGAGGG - Intergenic
1185426755 22:50776098-50776120 AACACACTGGAAGCCCAAGGAGG + Intronic
949546525 3:5077650-5077672 GGCTCACTGGAAGGCCAAGGTGG + Intergenic
950117827 3:10462871-10462893 GGCCAACTCGGACCCCAAGGAGG - Intronic
950168076 3:10816415-10816437 CGGCCACTGGAACAACAAGGTGG + Exonic
954420322 3:50415551-50415573 AGCCCATGGTAACCCCAAGGAGG - Intronic
954820464 3:53322203-53322225 GGCACCCTGGAAGGCCAAGGCGG + Intronic
955446069 3:59011148-59011170 AGCACTCTGGAAGCCCAAGGCGG + Intronic
961714058 3:128846789-128846811 GGCCCACGGGTAGCCCCAGGAGG - Intergenic
967941334 3:194768807-194768829 GGTCCACGGTGACCCCAAGGAGG + Intergenic
969301255 4:6298830-6298852 GGCCCACCAGAAGGCCAAGGAGG - Intronic
973207671 4:47578432-47578454 GGTCCACTGGAACCTGAAAGGGG - Intronic
973680976 4:53319617-53319639 GAATCACTGGAACCCGAAGGTGG - Intronic
974848274 4:67377908-67377930 GCCCCACTGCAAGCCCAGGGAGG + Intergenic
975048988 4:69835889-69835911 AGCACACTGGGACGCCAAGGAGG - Intronic
979069667 4:116185976-116185998 GGACCACTGGAACCACACGTGGG - Intergenic
986710701 5:10486210-10486232 CCCCCACAGGTACCCCAAGGGGG - Intergenic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
991674193 5:69075525-69075547 GGCCCAGAGGAGCACCAAGGTGG + Intergenic
993173223 5:84448161-84448183 GGCCCACTGAAAGCCTAATGAGG - Intergenic
995499586 5:112790105-112790127 GGCACACTGGGAGGCCAAGGTGG - Intronic
995557634 5:113345427-113345449 GGCCCACTGTAACCACTATGTGG - Intronic
997225244 5:132204883-132204905 GGCTTAGTGAAACCCCAAGGGGG + Intronic
1001149840 5:169217562-169217584 GGCCCCCAGGAACCCCAGGCTGG - Intronic
1002178711 5:177418172-177418194 GGCTCACTGCAGCCTCAAGGAGG + Intronic
1004223694 6:13768278-13768300 AGCACACTGGAAGGCCAAGGCGG - Intergenic
1007323475 6:41043318-41043340 GGCTAACTGGAACCCCAGGCAGG - Intronic
1014528717 6:122533408-122533430 GGCCAAGTGGAAGGCCAAGGTGG - Intronic
1015407631 6:132855575-132855597 GGCCCACCAGAAGCCCTAGGAGG + Intergenic
1018251778 6:161878675-161878697 GGCCCTCTGCAACTCAAAGGTGG + Intronic
1018827555 6:167421265-167421287 GGCCCCCTGGAGCCCCTGGGCGG + Intergenic
1022439716 7:30423757-30423779 GGCCCACTGAAGGCCAAAGGGGG - Intergenic
1023875244 7:44283128-44283150 GTCCTGCTGGAGCCCCAAGGTGG - Intronic
1025288656 7:57691225-57691247 AGCCCACTGGGAGGCCAAGGCGG - Intergenic
1026499915 7:70935516-70935538 GGCCCCCTGGAGCCCCAACTTGG + Intergenic
1031513255 7:122673887-122673909 GGGCCACTGGGAGCCCACGGCGG + Intronic
1036972425 8:13369812-13369834 GGTCCACTTGAACCCCAAGTCGG + Intronic
1040074361 8:43213993-43214015 GGCCCACAGGAACACAACGGTGG - Intergenic
1041506125 8:58599743-58599765 GACTCACTGGAAGCCCAAGGGGG + Exonic
1044695618 8:94919667-94919689 GCCACACTGGAACCCCCTGGTGG + Intronic
1047191220 8:122680857-122680879 GGCCCACAGGGATCCCAGGGTGG - Intergenic
1049114616 8:140675235-140675257 GGCTCACTGCAACCCTAAGGAGG + Intronic
1050063007 9:1730066-1730088 GGCCCTCTGGGACCCCAACCAGG + Intergenic
1052537050 9:29761138-29761160 AGCTCACTGGATCCCCAAGCAGG + Intergenic
1060022262 9:120141927-120141949 AGCCCACTGGTCCCACAAGGTGG + Intergenic
1060176164 9:121499155-121499177 GGGTCGCAGGAACCCCAAGGAGG - Intergenic
1060917979 9:127402689-127402711 GCCCCACAGGAACCGCAGGGCGG - Exonic
1060943074 9:127554438-127554460 GCCCGACTGGAGCCCCAAGGGGG - Intronic
1062497871 9:136840097-136840119 GGCCAACGGGGACCCCAAGCTGG - Intronic
1062555956 9:137113563-137113585 GGCCCACAGGTGCCACAAGGAGG + Intronic
1062739438 9:138160044-138160066 GGCCCACTGTAACCACAACTTGG - Intergenic
1203611878 Un_KI270749v1:15736-15758 AGCCCACTGGGAGGCCAAGGCGG + Intergenic
1188511880 X:30944965-30944987 TGCCCACTGGATCCACAATGAGG - Intronic
1190126466 X:47709799-47709821 GGCTCACTGCAACCTCCAGGAGG + Intergenic
1195171488 X:102272847-102272869 GGGCCACTGGAAAAACAAGGAGG - Intergenic
1195187372 X:102414252-102414274 GGGCCACTGGAAAAACAAGGAGG + Intronic
1195282460 X:103349045-103349067 GGCCAACTGAAATGCCAAGGTGG - Intergenic
1195853553 X:109307915-109307937 GGACCACTGGAACCGGAAAGAGG + Intergenic
1198392732 X:136192692-136192714 GCACCCCTGGAACCCCAAGAGGG - Intronic
1199652475 X:149960168-149960190 GGCCATCTGCAACCCCAAAGAGG - Intergenic