ID: 1143894797

View in Genome Browser
Species Human (GRCh38)
Location 17:10127689-10127711
Sequence GGGGCAGAAGGCCCCCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143894787_1143894797 7 Left 1143894787 17:10127659-10127681 CCCCCGATTCCAGGGCTCTGATG 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG 0: 1
1: 0
2: 4
3: 27
4: 221
1143894790_1143894797 5 Left 1143894790 17:10127661-10127683 CCCGATTCCAGGGCTCTGATGGA 0: 1
1: 0
2: 2
3: 13
4: 186
Right 1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG 0: 1
1: 0
2: 4
3: 27
4: 221
1143894784_1143894797 27 Left 1143894784 17:10127639-10127661 CCAGATCTTGCGCAGAAAATCCC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG 0: 1
1: 0
2: 4
3: 27
4: 221
1143894791_1143894797 4 Left 1143894791 17:10127662-10127684 CCGATTCCAGGGCTCTGATGGAA 0: 1
1: 0
2: 2
3: 16
4: 197
Right 1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG 0: 1
1: 0
2: 4
3: 27
4: 221
1143894788_1143894797 6 Left 1143894788 17:10127660-10127682 CCCCGATTCCAGGGCTCTGATGG 0: 1
1: 0
2: 1
3: 5
4: 115
Right 1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG 0: 1
1: 0
2: 4
3: 27
4: 221
1143894792_1143894797 -2 Left 1143894792 17:10127668-10127690 CCAGGGCTCTGATGGAAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG 0: 1
1: 0
2: 4
3: 27
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143894797 Original CRISPR GGGGCAGAAGGCCCCCTCCA AGG Intronic
900286216 1:1901828-1901850 GGGACAGAAGGGCAGCTCCAGGG - Intergenic
900719537 1:4166430-4166452 TGGGCAGATAGCCCCTTCCAGGG - Intergenic
901157757 1:7151757-7151779 TGGGAAGGAGGCTCCCTCCAGGG - Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903050093 1:20594255-20594277 GGGGCACAAGGCCCTGGCCAGGG - Intronic
903589095 1:24440794-24440816 CTGGCAGAAGGCAGCCTCCAGGG - Intronic
903643313 1:24875141-24875163 TTGGCAGGAGGCCCTCTCCAGGG - Intergenic
903657149 1:24956514-24956536 GGGGCACCAGGCTCTCTCCATGG + Intronic
904063164 1:27726496-27726518 GGGGCAGGAGGTCCCCACCAGGG - Intronic
904324917 1:29722107-29722129 GGCCCAGAAGGATCCCTCCAGGG - Intergenic
904338312 1:29812200-29812222 GGGGCAGCATGGCCCCTGCATGG + Intergenic
904774032 1:32895846-32895868 GGGGCAGCAGCCACCCGCCAAGG - Intronic
904806000 1:33133017-33133039 GGAGCACAAAGCCTCCTCCAAGG - Intergenic
904995625 1:34629151-34629173 CGGGCACTAAGCCCCCTCCAGGG + Intergenic
905478624 1:38246200-38246222 GGGCCAGTAGGGCCACTCCATGG - Intergenic
913681120 1:121187328-121187350 AGGGCAGAAGGGGCCCCCCACGG - Exonic
914032950 1:143974968-143974990 AGGGCAGAAGGGGCCCCCCACGG - Intergenic
914156496 1:145092998-145093020 AGGGCAGAAGGGGCCCCCCACGG + Exonic
920468434 1:206205852-206205874 AGGGCAGAAGGGGCCCCCCACGG - Intronic
920716990 1:208349637-208349659 GGGACAGAAAGGGCCCTCCAAGG + Intergenic
920915430 1:210254392-210254414 GGAGCAGAAGGTTCCCCCCAGGG - Intergenic
1063157128 10:3390502-3390524 GGGGCAAAAACCCCCTTCCAGGG + Intergenic
1063424016 10:5937342-5937364 GGAGCAGAAGCCCCCCTCGCTGG - Exonic
1063959588 10:11296101-11296123 GGGGATGAAGGCACCCGCCAAGG - Intronic
1064250898 10:13705709-13705731 CGGCCAGAAGCCCCACTCCATGG - Intronic
1064282762 10:13966602-13966624 GGGACAGAAGTTTCCCTCCAGGG + Intronic
1067161230 10:43826378-43826400 GGGGCAGAAGGCACTCACCAGGG - Intergenic
1067214646 10:44292661-44292683 GGCGCAGAAGGCGCTCACCAGGG + Intergenic
1067342659 10:45418055-45418077 GGGGCAGAAGGGCCCCTCTCAGG - Intronic
1072891687 10:99330026-99330048 GGGGCAGCAGGTCCCCGCCTGGG - Exonic
1075263483 10:120981847-120981869 GGGGCAGGAGGCCCCCTGCAAGG - Intergenic
1075684269 10:124353167-124353189 GGGCCAGAAGCCCATCTCCAGGG + Intergenic
1076539412 10:131204718-131204740 GGGGCAGAAGACTCCCTTCAGGG + Intronic
1076719568 10:132387236-132387258 TGGGCGGAAGCCCCCCTCCCTGG + Intergenic
1076831438 10:132996365-132996387 GGGGCAGGAGGTCCCCACCTAGG - Intergenic
1076850447 10:133089905-133089927 GGGGCAGCAGGCCAGCCCCAGGG + Intronic
1077141193 11:1025658-1025680 GGGGCAGCAGGCACCCCTCAAGG + Intronic
1077241736 11:1514096-1514118 GGGGCAGAAGGGGACCTCCCTGG + Intergenic
1077408587 11:2393328-2393350 GAGGGAGAAGGCGCCGTCCAAGG - Intronic
1081813518 11:45926383-45926405 GGAGCAGAAGTCTCCATCCATGG - Intronic
1083613541 11:64015562-64015584 GAGGCAGATGGCCCCCGCCACGG + Intronic
1084311464 11:68318713-68318735 GGGGCTCAAGGACCCCTTCAAGG + Intronic
1084659260 11:70537528-70537550 GTGGCAGGAGGCCTCCTCCCCGG + Intronic
1089789554 11:120932836-120932858 GGGGCAGCTGGCCTCCTCAAGGG + Intronic
1091301403 11:134510349-134510371 GTGAGAGAAGGCCCCCACCAAGG - Intergenic
1091301546 11:134510979-134511001 GGGGCAGGATGCCCTCTCCTTGG + Intergenic
1091924693 12:4335871-4335893 GGGGCTGGAGGGCCCCTCAATGG - Intronic
1091994055 12:4978931-4978953 GGGGCAGGAGGCCCCTTGGATGG + Intergenic
1094845513 12:34359702-34359724 GAGGCAGAGGTCCCCCCCCACGG - Intergenic
1094848519 12:34372040-34372062 GTGGCAGAGGTCCCCCGCCACGG - Intergenic
1094849215 12:34374862-34374884 GTGGCAGAAGTTCCCCACCACGG - Intergenic
1094849667 12:34376713-34376735 GAGGCAGAAGTCCCGCACCAAGG - Intergenic
1094850077 12:34378419-34378441 CAGGCAGAAGGTCCCCACCAAGG - Intergenic
1094852470 12:34388435-34388457 GGGGCAGAGGTCCTCCACCACGG - Intergenic
1094856350 12:34404620-34404642 GAGGCAGAAGTCCCCCCACAAGG + Intergenic
1096215786 12:49796805-49796827 GGGGCTGCAGGCCCACTCAATGG - Exonic
1096983826 12:55743807-55743829 GGAGCAGAAGGCGCCCTTCGCGG - Intronic
1099325262 12:81207273-81207295 GGGGCAGTAGGCCCAGTGCAGGG - Intronic
1101960548 12:109246286-109246308 GGTACAGAAGGTCCTCTCCAGGG - Exonic
1102424051 12:112826557-112826579 GGGGCAGAAGGGGGCCTCCATGG - Intronic
1103587090 12:121963894-121963916 AAGGCAGAAGCTCCCCTCCAGGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106409220 13:29499296-29499318 GGGGCACAAGCCCCCAGCCAGGG + Intronic
1110804884 13:79742847-79742869 GGGGCAGAGGGCTCCATCCCAGG - Intergenic
1113553741 13:111214360-111214382 GGCGCAGCAGGCCCCTTCCCAGG - Intronic
1114328995 14:21617518-21617540 GTGGCAGCAAGCCCCATCCAAGG - Intergenic
1118885958 14:69866054-69866076 GGGGAAGTAGGTGCCCTCCATGG - Intronic
1119777124 14:77256395-77256417 GGGGAAGAAGGCAGGCTCCAAGG + Intronic
1121336810 14:93082648-93082670 GGGGCGGCACGCCCACTCCAGGG + Intronic
1121778382 14:96606054-96606076 GGGACACAGAGCCCCCTCCATGG - Intergenic
1121786123 14:96662406-96662428 GGGGCAGCAGCCCGCCTCCAGGG - Intergenic
1122267908 14:100555209-100555231 GGGGCACAAGGCCTTCTGCAGGG - Intronic
1122770212 14:104094525-104094547 CGGGCAGGAGGCCCCCTACTAGG - Intronic
1126684373 15:51234682-51234704 GGGGCAGGAGGGCCTCTCCCCGG - Intronic
1128069106 15:64782981-64783003 GGCCCAGAAGGCCCTCTCCCAGG - Intergenic
1129295761 15:74599247-74599269 GGAGCAGAAGAGTCCCTCCAGGG - Intronic
1129465536 15:75722389-75722411 AGGGCCGAGGGCCACCTCCAGGG + Intergenic
1130320625 15:82837925-82837947 GAGGCACAAGTCCCCCTCCCTGG + Intronic
1131067227 15:89442248-89442270 GGGGCAGTAGGCCAGCTCCAGGG + Intergenic
1131590902 15:93747152-93747174 GTGACTGAAGGCCCCCTGCAGGG - Intergenic
1131620789 15:94065926-94065948 GGGGCAGGAAGCACCGTCCAGGG + Intergenic
1132602731 16:781264-781286 GGGGCAGAAGCCACCTTCAAGGG + Intronic
1132748349 16:1446207-1446229 GAGGCAGAGGGGCCCTTCCAGGG + Exonic
1135718448 16:24793484-24793506 GGAGTAGAAGGCTCCCCCCAGGG - Exonic
1136500022 16:30665376-30665398 GGGCTGGAAGGCCCCCTGCAGGG - Exonic
1137386808 16:48049549-48049571 GGGGCAGAATGTCCACTCCTGGG + Intergenic
1138456085 16:57121554-57121576 GGGGCAGCATGCTTCCTCCAGGG - Intronic
1139056747 16:63194929-63194951 GAAGCAGAAGGCTCCATCCAGGG + Intergenic
1139374966 16:66491192-66491214 TGGGCAGGAGGGCCCCTCCATGG + Intronic
1139961490 16:70720642-70720664 GGGGCAGAAGGGCCCATCTGAGG + Intronic
1141732160 16:85829974-85829996 GGGGCAGGAAGCGCCCTCCACGG + Intergenic
1141919551 16:87126890-87126912 GGCGCAGAGGGCCACCTACAAGG - Intronic
1141994558 16:87628260-87628282 GGAGCAGCAGGACCCTTCCACGG + Intronic
1142261312 16:89043719-89043741 GGGGCACCAGGCCCTTTCCAAGG + Intergenic
1142364754 16:89644377-89644399 GGGGGAGATGGCCACATCCAGGG + Intergenic
1142482381 17:227071-227093 GGGGGAGAAGCTCCCCTCCTGGG + Intronic
1142965412 17:3577775-3577797 GGGGCAGAAAGCTCCGTCTACGG + Intronic
1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG + Intronic
1144573507 17:16415410-16415432 GGGGAAGAATCCCCCATCCATGG + Intergenic
1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG + Exonic
1146283162 17:31558479-31558501 GGGGCAGCAGGTCTCCACCAAGG + Intergenic
1146427735 17:32758814-32758836 GGAGCAGAAGGCTAACTCCAAGG - Intronic
1148732790 17:49847822-49847844 GAGGCAGAAGATCCCCTGCATGG - Intronic
1151187440 17:72374346-72374368 GGGCCAGAACACCCCATCCAGGG - Intergenic
1152315355 17:79577326-79577348 GGGGCAAATGGCACCCTCCATGG + Intergenic
1152409098 17:80112972-80112994 GGGGTAGAAGGCCCCCAGCTGGG - Intergenic
1152462028 17:80446566-80446588 GGGGCAGCTGGCCCCGGCCAGGG + Intergenic
1152594297 17:81230712-81230734 GGGGCAGCAGGTCCACGCCAGGG + Intronic
1152810308 17:82378728-82378750 GGGGCTGCAGGGCCCCTCCTGGG - Intergenic
1153585591 18:6616878-6616900 GGGGCAGAAGGCCACATACACGG + Intergenic
1153950205 18:10051951-10051973 GGGGAGGAAGGCCAGCTCCAAGG + Intergenic
1155914158 18:31539656-31539678 TGGACAGAGGGCCGCCTCCAAGG + Intronic
1156446085 18:37237806-37237828 GGTGCATAAGTCCCCCTCCTTGG - Intergenic
1157608780 18:48942924-48942946 AGGGCAGAAGGCTCTCTCCTTGG + Intronic
1157803877 18:50643806-50643828 GGGGCTGACGGCATCCTCCACGG + Intronic
1160712595 19:559308-559330 GGGGCAGAAAACCCCATCCAGGG - Intergenic
1160754774 19:751501-751523 AGGCCAGAGGGGCCCCTCCATGG + Intronic
1160764886 19:803155-803177 AGGGCAGAGGACCCCCTCCATGG - Intronic
1161102377 19:2427513-2427535 GGAGCCGAAGCCGCCCTCCATGG + Exonic
1161331638 19:3691343-3691365 GGGGATGACGGCCCCTTCCAGGG + Intronic
1161554107 19:4930784-4930806 GACGCGGAAGGCCCCCTCCCGGG + Exonic
1161726817 19:5934050-5934072 GGGGGAGCTGGCCTCCTCCACGG - Intronic
1161900770 19:7117415-7117437 GGGGCAGAAGGACACGTCCTGGG + Intronic
1162818655 19:13210205-13210227 GGGGCAGACGCCCGCCTCCCAGG + Intronic
1163054261 19:14706439-14706461 GGGGAAGGTGGCACCCTCCAAGG - Intronic
1163338350 19:16688187-16688209 GGGGCAGATGTAGCCCTCCAGGG - Exonic
1163548136 19:17951221-17951243 GTGGCTGAAGGTCCCCACCAAGG + Intergenic
1163667362 19:18609682-18609704 AGGGCAGAAGTCACACTCCAGGG - Intronic
1163928139 19:20364591-20364613 TGGTCAGGAGCCCCCCTCCATGG + Intergenic
1164594462 19:29524749-29524771 GGAGCTGCAGGCCCTCTCCAAGG - Intergenic
1167050090 19:47072599-47072621 TGGGCAGGAGGCCCACACCAGGG + Exonic
1167074443 19:47240108-47240130 GTGGCACAAGGCCAACTCCAGGG - Intergenic
1168211432 19:54893630-54893652 GGGCAAGATGGCCCTCTCCAGGG + Intergenic
1168306726 19:55439866-55439888 GGGGCAGAAGGGCTTCTCCGAGG - Intronic
925064326 2:917274-917296 GGGGCAGGAGGCCTCCACCCTGG - Intergenic
925619245 2:5774696-5774718 GGGGAAGAAGGCCCCTCCCAAGG + Intergenic
926620644 2:15043827-15043849 GAGTCAGAAGGCACCCTCCAAGG - Intergenic
927241235 2:20921023-20921045 GTGCCAGAAGGCTCCCTCGATGG - Intergenic
928022428 2:27715426-27715448 GGGGGAGAAGCCCTCCTCCCGGG + Intronic
929437896 2:41942079-41942101 GGGGAAGCAGCCCTCCTCCATGG - Intronic
929891519 2:45922464-45922486 AGGGCAGTTGACCCCCTCCATGG - Intronic
932447248 2:71788412-71788434 GGGGCTGGCGGCCCCCTCCCTGG + Intergenic
934569507 2:95359908-95359930 TGGGCCAAGGGCCCCCTCCAAGG - Intronic
934713055 2:96528006-96528028 AGGGCTTAATGCCCCCTCCACGG + Intergenic
934880110 2:97969364-97969386 GGGGCAGAAGGGCCCAAACATGG - Intronic
937235900 2:120431856-120431878 GAGGCAGAAAGCTCCCTCCCTGG + Intergenic
938341977 2:130541754-130541776 GAGGCTGAAGGGCCCCTCCAAGG + Intronic
938347855 2:130578957-130578979 GAGGCTGAAGGGCCCCTCCAAGG - Intronic
940855329 2:158724754-158724776 TGAGCAGCAGTCCCCCTCCAGGG - Intergenic
942224007 2:173798742-173798764 AGGGCAGGAGGCCCTCCCCAGGG + Intergenic
944661597 2:201926142-201926164 AGGGCAGAAGCCACCCTCCAAGG - Intergenic
946185265 2:217977332-217977354 GGGGCAGAAAACCCACTGCATGG + Intronic
948336002 2:237207500-237207522 GGTTCAGGAGCCCCCCTCCATGG - Intergenic
948827196 2:240578448-240578470 GGGCCAGAGGGCCCTCCCCAGGG - Exonic
1169392113 20:5198732-5198754 TGGGCAGAGGGCCCACGCCAGGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172100575 20:32482586-32482608 GGGGCAGCCGGCCGCCTCGAGGG - Intronic
1172271191 20:33656679-33656701 GGGGCAGGAGGACACCCCCAGGG + Intergenic
1173452233 20:43175218-43175240 GGCTAAGAAGGTCCCCTCCACGG + Intronic
1175188740 20:57197419-57197441 GGGGCAGATGAGCCCCTGCAGGG - Intronic
1175767866 20:61603565-61603587 GGAGCAGAAGGGCCCATCCCGGG + Intronic
1175812579 20:61866444-61866466 AGGGCAGCTGGCCCCTTCCATGG - Intronic
1175942049 20:62541921-62541943 GAGGGAGGAGCCCCCCTCCATGG - Intergenic
1175985628 20:62762969-62762991 GGAGCAGTGGGCCCCCTGCAGGG + Intergenic
1176136103 20:63522636-63522658 GTGGCAGGAAGACCCCTCCACGG - Intergenic
1178708056 21:34890210-34890232 GGGGCAGCAGCCGCCCTCCCTGG + Intronic
1179431314 21:41323082-41323104 GGGGCAGACGGCTGCCTTCATGG + Intronic
1179563689 21:42233358-42233380 GTGCAAGAAGGCTCCCTCCACGG - Intronic
1180956584 22:19743953-19743975 GGGGCAGAACCCCAGCTCCAAGG - Intergenic
1181093143 22:20487909-20487931 GGAGCTGAGGGCCCCCTGCAGGG - Intronic
1183453782 22:37910650-37910672 GGGGCACCAGACCCCTTCCAAGG + Intronic
1183640683 22:39090694-39090716 GGGACAGCAGGCACCTTCCACGG - Intergenic
1183835958 22:40453403-40453425 GGGGCAGAGGGCCAACTGCAAGG + Intronic
1183932069 22:41240940-41240962 CTGGCAGGAGCCCCCCTCCACGG + Intergenic
1184744492 22:46448290-46448312 GGGGCAGAGGGCCCACGCGAGGG + Intronic
949877392 3:8635188-8635210 GGTGCAGACGGCCCCCTCCAGGG + Intronic
950568482 3:13785887-13785909 GGGGCACATAGCCCCCTCCCTGG - Intergenic
950750030 3:15121144-15121166 AGGCCAGCAGGCCCTCTCCAGGG + Intergenic
954389599 3:50261634-50261656 GGGGGAAAGGGCCCTCTCCAGGG + Intergenic
954622140 3:52002379-52002401 CTGTCACAAGGCCCCCTCCATGG - Intergenic
960998153 3:123352905-123352927 GGGGCAGGAGGGCCACTGCAAGG + Intronic
961508231 3:127385651-127385673 GGGGCTGAGGGTCCCCTTCATGG + Intergenic
963525423 3:146409471-146409493 TGGTCAGAAGGCCCCCTCCATGG - Intronic
968204916 3:196790843-196790865 GGGCAAGATGGCCCTCTCCAGGG - Intronic
969291204 4:6241260-6241282 GGGGCAGCGAGCGCCCTCCACGG - Intergenic
969307358 4:6333481-6333503 GGCTAGGAAGGCCCCCTCCATGG + Intronic
969677491 4:8622075-8622097 GGGGCAGCAGGGCCCAGCCAGGG - Intergenic
969678446 4:8627716-8627738 GGGGCAGCAGGGCCCAGCCAGGG - Intergenic
969679402 4:8633350-8633372 GGGGCAGCAGGGCCCAGCCAGGG - Intergenic
971197886 4:24486770-24486792 GGGCCAGAAGGCCATCTCCTAGG + Intergenic
972727537 4:41758264-41758286 GGGGCAGCAAAGCCCCTCCAAGG + Intergenic
975616950 4:76256310-76256332 GGGGCAGAAAGCCCTCCACAGGG - Exonic
985403250 4:189612810-189612832 GGGGCAGCAGGCCCACTGCCAGG + Intergenic
985576925 5:677890-677912 GCGCCGGAAGGCCTCCTCCAGGG + Exonic
985653914 5:1120085-1120107 GGGGCTGAGGGGACCCTCCACGG + Intergenic
985719451 5:1481555-1481577 GGAGCAGAAGGTCCACCCCAGGG - Intronic
985886452 5:2683889-2683911 AGGGCTGCAGGCACCCTCCACGG - Intergenic
992622838 5:78610547-78610569 AGGCCAGAAGGCCCTCTTCATGG + Intronic
994507038 5:100656664-100656686 TGGGCTGAAGGGCTCCTCCACGG - Intergenic
997523784 5:134539813-134539835 TCTGCAGAAGCCCCCCTCCAAGG - Intronic
997727462 5:136133264-136133286 GGGTCAGGGGGTCCCCTCCAGGG - Intronic
998336333 5:141375554-141375576 CTGGCAGAAGACACCCTCCAGGG + Exonic
1001402144 5:171451769-171451791 GTGCCCGAAGGCCCCGTCCATGG - Intronic
1002319346 5:178365788-178365810 GGGGGAGTGGGCCCCCTCCCAGG - Intronic
1003867360 6:10375649-10375671 GGGGCAGAAGGCCCTGTCTGGGG - Intergenic
1006220251 6:32484032-32484054 GGGGCACAAGGGTCCCACCACGG - Intergenic
1008878628 6:56356765-56356787 TGGGCAGCAGGGCTCCTCCATGG - Intronic
1013288594 6:108700613-108700635 CGGTCAGAAGGACACCTCCACGG - Intergenic
1014981972 6:127955559-127955581 GGGGCAAATGGCTCCCTCCCAGG + Intergenic
1017000023 6:149990176-149990198 GGGGCAGAAGGAGCCCTGCGTGG + Intergenic
1018738987 6:166713051-166713073 GGGGAAGGACGCCACCTCCAGGG - Intronic
1019073688 6:169370140-169370162 GGTGCAGCGGGCCCCCTGCAGGG + Intergenic
1019341829 7:512127-512149 GGGGCAGGAGACACCCTCGAAGG + Intronic
1019430613 7:997318-997340 GGGGCTGGAGGGTCCCTCCAAGG + Exonic
1019734703 7:2644947-2644969 GGGGCAGATGGTCCCCTGCCTGG - Intronic
1021894779 7:25223453-25223475 GCTGCAGCAGACCCCCTCCAAGG - Intergenic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1023911812 7:44561755-44561777 GGGGTAAAATGTCCCCTCCAAGG - Intergenic
1023995784 7:45158097-45158119 GAGGCACAGGGCCCCCTCCGGGG + Intronic
1029969241 7:104773157-104773179 GGGTAAGAAGACCCCCACCAGGG - Intronic
1031150706 7:118050655-118050677 GGGGAAGAAGGTTCCCTGCAAGG - Intergenic
1031715580 7:125105092-125105114 GACCCAGAAAGCCCCCTCCATGG - Intergenic
1034720355 7:153286641-153286663 AGGGCAGAAGTCCCACTGCAGGG + Intergenic
1035023900 7:155814470-155814492 CAGGCAGAAGGCCCCCCACACGG + Intergenic
1038440060 8:27565382-27565404 GGGGCAGCAGGCACACTCCCAGG - Intergenic
1038481000 8:27901833-27901855 GGGGCCGAAGCCCCCATCCCAGG + Intronic
1039998333 8:42554953-42554975 AGGGGAGAAGGCCGCCTCCAAGG + Intergenic
1040111515 8:43568947-43568969 GAGGCCGAAGCCCCCCGCCAGGG - Intergenic
1040915527 8:52564187-52564209 GGGACAGAAGGGCCCCTCTGCGG - Intronic
1048970480 8:139642707-139642729 GGGGCTGGAGGGCCCATCCACGG - Intronic
1049210687 8:141385156-141385178 GGGGCAGCTGGCCCCACCCAGGG - Intergenic
1049435230 8:142583420-142583442 GGGGCAGCAGGCCTGCTCCTGGG - Intergenic
1049536112 8:143183279-143183301 GGGGCATTAGGACCCTTCCAAGG + Intergenic
1053593157 9:39533791-39533813 GGGGCCCATGGCCCCCTCCAGGG + Intergenic
1053850893 9:42288499-42288521 GGGGCCCATGGCCGCCTCCAGGG + Intergenic
1054573150 9:66831486-66831508 GGGGCCCATGGCCCCCTCCAGGG - Intergenic
1056779706 9:89539964-89539986 GGGGCAGAGGACACCCTCCCAGG - Intergenic
1056852080 9:90093299-90093321 GGGGCTGAAGCCACCATCCAGGG + Intergenic
1057441499 9:95086888-95086910 AGGGCAGGAGGCAGCCTCCAGGG - Exonic
1060106605 9:120876899-120876921 GGGGCAGAGGGGCCCCACCCGGG - Intronic
1062265128 9:135683476-135683498 GGGACAGCAGGCCCCCTGCAGGG + Intergenic
1062376193 9:136262943-136262965 GGGACAGGAGCCTCCCTCCAAGG + Intergenic
1062402251 9:136377833-136377855 GGAGCACAAGGCCACCTCCCTGG - Exonic
1062467554 9:136687775-136687797 GGGGCAGGAGGCCCAGACCATGG - Intergenic
1062595702 9:137298205-137298227 GAGGAAGCAGACCCCCTCCAGGG + Intergenic
1190162888 X:48046647-48046669 GGGGCAGATGACACTCTCCAAGG + Intronic
1190720509 X:53143750-53143772 GGGCCAGAAGGACTCCTACATGG - Intergenic
1191683520 X:63865790-63865812 GGGGCAGACTGCCTCCTCAAAGG - Intergenic
1195535389 X:106003630-106003652 GGGCTAGCAGGCCCCCTCCAGGG - Intergenic
1197707690 X:129646388-129646410 AGGGGAGAAAGCCCCCTCCAAGG + Exonic
1200133925 X:153865528-153865550 GGGGCAGAAGGCACCCAGCAGGG + Intronic
1200210267 X:154344030-154344052 GGAGCAGCAGGCCACCTCCTGGG + Intergenic
1200220585 X:154388062-154388084 GGAGCAGCAGGCCACCTCCTGGG - Intergenic