ID: 1143897046

View in Genome Browser
Species Human (GRCh38)
Location 17:10144478-10144500
Sequence GATCCTTTCTTACCTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143897046_1143897048 9 Left 1143897046 17:10144478-10144500 CCAGTATCAGGTAAGAAAGGATC 0: 1
1: 0
2: 2
3: 7
4: 107
Right 1143897048 17:10144510-10144532 ATTACACAAATCCTTTTCTGTGG 0: 1
1: 0
2: 1
3: 31
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143897046 Original CRISPR GATCCTTTCTTACCTGATAC TGG (reversed) Intronic
902557501 1:17255585-17255607 GATCCTCCCGTACCTGATGCAGG + Intronic
904441092 1:30531772-30531794 GATATTTTCTCACCTGATAGAGG - Intergenic
906575646 1:46886842-46886864 GATCCTTTCTCATCTGAGCCTGG - Intergenic
906596330 1:47081054-47081076 GATCCTTTCTCATCTGAGCCTGG + Intronic
907651789 1:56302325-56302347 GATCCCTTCTTCCCTGCTCCAGG + Intergenic
909481205 1:76130364-76130386 GAGCCATTCTTACCTGAAACTGG - Intronic
912631834 1:111253069-111253091 GATCCTCTTTTTCCTCATACTGG - Intergenic
914384943 1:147159483-147159505 GAACCAGTCTTACCTGAGACTGG - Exonic
914897435 1:151689339-151689361 TATCCTGTCTTCCCTGATGCAGG - Intronic
917733843 1:177902444-177902466 GATCCTTTCTGTGCTGATGCTGG - Intergenic
917983855 1:180294665-180294687 TATCCTTTCATTCCTGAAACTGG + Intronic
918530058 1:185509391-185509413 CTTCCTTTCTTAGCTAATACTGG - Intergenic
920149401 1:203892362-203892384 GAGCCCTTCATACCAGATACAGG + Intergenic
923767640 1:236907197-236907219 CACCCCTTCTTACCTGATTCTGG - Intergenic
1064691892 10:17927036-17927058 ACTCCTGTCTTACCTGATACAGG - Intergenic
1076775410 10:132693947-132693969 GATCTGTTCATTCCTGATACAGG - Intronic
1078644071 11:13122491-13122513 GAAACTTTCTCACCTGATAAGGG - Intergenic
1084867983 11:72075442-72075464 GAGCCTTACTTAGCTGATGCTGG - Intronic
1090314395 11:125772180-125772202 GATTTTTACTTCCCTGATACAGG + Intergenic
1096445056 12:51681987-51682009 GGTCCTTCTTAACCTGATACAGG - Intronic
1096860976 12:54527913-54527935 GAGCCTGTCTTACCTGACAGAGG + Intronic
1102388047 12:112527416-112527438 GATCCAGTCATACCTGAAACTGG - Intergenic
1105399188 13:20072861-20072883 TATCCTTTCATTCCTGATACTGG + Intronic
1106881483 13:34136438-34136460 TGTCCTCTCTTACCTGATGCAGG - Intergenic
1108164515 13:47678048-47678070 GCTCCTTTCTTGCCTGCTAAGGG - Intergenic
1109526125 13:63579428-63579450 TATGCTTTCATACCTGAGACTGG + Intergenic
1110947864 13:81446001-81446023 GATGCTTTCTTCTCTGTTACTGG + Intergenic
1116113078 14:40611937-40611959 CATCCTTTCTTAATTGATAAAGG - Intergenic
1117865135 14:60140160-60140182 TATCCTTTCATTCCTGATATTGG - Exonic
1129508102 15:76099771-76099793 GAACTATTCTTACCTGAGACTGG + Intronic
1131353946 15:91726909-91726931 AATGCTTTCTATCCTGATACAGG - Intergenic
1133866774 16:9651368-9651390 GATCCTTTCTTGCCTCTTTCTGG - Intergenic
1134456627 16:14400019-14400041 GATCCTTTTTTACCTGATTACGG + Intergenic
1138952138 16:61925880-61925902 GCTACTTTCTGACCTGATCCTGG - Intronic
1139247236 16:65457038-65457060 GATGATTTTGTACCTGATACTGG - Intergenic
1143897046 17:10144478-10144500 GATCCTTTCTTACCTGATACTGG - Intronic
1145371621 17:22311232-22311254 GGTCCTTTCTTTCCTGACAGGGG + Intergenic
1154095865 18:11414378-11414400 GGACCTTTCTTACCTGACTCTGG - Intergenic
1154421659 18:14235636-14235658 CTTCCTTTCTCACCTGATTCTGG - Intergenic
1156005289 18:32433275-32433297 GAACCTTTCTAACCTGATAAAGG + Intronic
1159663854 18:71132591-71132613 GATACTCTCTTACCTAATATTGG + Intergenic
1159943886 18:74429322-74429344 GAGGCTTTCTTTCCTGAGACAGG + Intergenic
1166338797 19:42124934-42124956 GATCCTTTCTTACCTGGTGCAGG - Intronic
927144489 2:20153635-20153657 GATTCTTTCTGCCCTCATACAGG - Intergenic
930087822 2:47510394-47510416 AATGCTTTCATAACTGATACAGG + Intronic
930678447 2:54230192-54230214 CTTCCTTTCTTTCCAGATACAGG + Intronic
934151597 2:89152741-89152763 TATCCTCTCTTAACTGTTACAGG + Intergenic
934215663 2:90029165-90029187 TATCCTCTCTTAACTGTTACAGG - Intergenic
934496482 2:94805488-94805510 CTTCCTTTCTAACCTGATTCTGG + Intergenic
940583268 2:155608747-155608769 TATCCATTCTTACCAAATACTGG - Intergenic
941511621 2:166417626-166417648 GATCATTTCTGGCATGATACAGG - Intronic
943559075 2:189439885-189439907 GGTACTTTGTAACCTGATACAGG - Intergenic
945698982 2:213147458-213147480 TAACCTTTCTTACCTGATACAGG + Intronic
1169152747 20:3303498-3303520 CATTCTTTCTTCCCTGATATTGG + Intronic
1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG + Intronic
1177923767 21:27187804-27187826 GTTCCTTTTATTCCTGATACTGG - Intergenic
1180025221 21:45156934-45156956 CTTCCTTTCTCACCAGATACTGG - Intronic
952196389 3:31079925-31079947 GAACCTTTCTTAAATGACACCGG + Intergenic
952698799 3:36303375-36303397 GCCCCTTTCTGACCTCATACCGG - Intergenic
954505700 3:51070703-51070725 CATCTTTTCTCAGCTGATACTGG + Intronic
957428167 3:80066975-80066997 GATCCTTTCTTACTAGGAACTGG + Intergenic
959827323 3:110813996-110814018 GAATCTTTATTACCTAATACAGG - Intergenic
960378475 3:116931676-116931698 TACAGTTTCTTACCTGATACTGG + Intronic
964128131 3:153258100-153258122 CATTCTTTCTTACCAGATTCTGG + Intergenic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
970832962 4:20365222-20365244 GAACCATTCTTAACTGATACGGG - Intronic
971669353 4:29536296-29536318 CATCCCTTCTTCCCTGAAACTGG - Intergenic
975298200 4:72758461-72758483 AATCCTTTTTAGCCTGATACAGG - Intergenic
977902664 4:102440136-102440158 GCTTCTTTCTTACCAGATAAAGG - Intergenic
979508444 4:121524764-121524786 GATCCTTCCTTACCTCTTCCTGG - Intergenic
981624634 4:146741771-146741793 TATCCTTTCTTTCCAGCTACTGG + Intronic
984013552 4:174400554-174400576 GATTCTTTGATACCTGATGCAGG - Intergenic
984115739 4:175679088-175679110 ATTTCTTTCTTGCCTGATACCGG + Intronic
984727912 4:183039051-183039073 GATCCTTTCTTAGTTGGTAGTGG - Intergenic
985884214 5:2663843-2663865 GATCCATTCTTATCTGAGAAGGG - Intergenic
987567500 5:19611605-19611627 GATCCTTTGGTACGTCATACAGG - Intronic
988652561 5:33168496-33168518 GACCCTCTCTTTCCTGATATTGG + Intergenic
989490885 5:42051560-42051582 GATCCTTCATTACCTGGTCCAGG - Intergenic
989589097 5:43096660-43096682 CATCCTTTGTCACCTGAAACAGG - Intronic
990540516 5:56768241-56768263 AATACATTCTTATCTGATACAGG - Intergenic
994554321 5:101278591-101278613 GATCCTTTGTAACCTGTTCCCGG - Intergenic
998264469 5:140657604-140657626 GATCCTTTCATACCTGAGGCAGG + Exonic
1004048410 6:12048765-12048787 GACCCTTTCTTTCCAGTTACTGG + Intronic
1004344033 6:14831739-14831761 GATCCTGTCACACCTGACACAGG - Intergenic
1004769981 6:18770604-18770626 TATCCTTTCTAACCTGTTCCAGG - Intergenic
1013428264 6:110034254-110034276 GATCCTTCCTTCCCTGCTGCGGG + Intergenic
1013663491 6:112322958-112322980 TCTGCTTTCTTACCTCATACAGG + Intergenic
1014014321 6:116512227-116512249 TGTCTTTTCTTACCTGAGACTGG - Exonic
1015082961 6:129250651-129250673 GTACCTTTCTTACCTAAAACAGG - Intronic
1017235578 6:152114188-152114210 GTACCTTTCTTTCCTGATGCAGG - Intronic
1017489169 6:154929346-154929368 GCTCCTTTCTTACCTTCTTCTGG - Intronic
1021783971 7:24134369-24134391 CATCCTTTCATACCTGAGAGTGG + Intergenic
1027476524 7:78638599-78638621 GATCCATTCTTACAATATACAGG + Intronic
1028000865 7:85496493-85496515 GTTCCTTTCTTACTGAATACAGG + Intergenic
1029578077 7:101417168-101417190 GTGCCTTTCTTCCATGATACTGG + Intronic
1033286403 7:140044485-140044507 GATCCTTTCTTGCCTCCTCCAGG - Intronic
1037017401 8:13925617-13925639 CATCCTGTCTTACCTGAAAAGGG - Intergenic
1039262406 8:35785995-35786017 GAAACTTTCTTCCCTGTTACTGG + Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039601976 8:38846944-38846966 GCTCCTTTCTGAACTGATCCAGG + Intronic
1049864066 8:144922257-144922279 GATCCCTTCTCACCTCATGCAGG - Intergenic
1050188994 9:3005348-3005370 GATCCTTCCTTACCTCTTCCTGG - Intergenic
1050650832 9:7774796-7774818 AATACTTTCTTACTTGATATTGG - Intergenic
1053015655 9:34660550-34660572 AATCCTTTCTTTCCTGGGACTGG + Exonic
1053660662 9:40274959-40274981 CTTCCTTTCTAACCTGATTCTGG - Intronic
1054361675 9:64127858-64127880 CTTCCTTTCTAACCTGATTCTGG - Intergenic
1054372786 9:64421177-64421199 CTTCCTTTCTAACCTGATTCTGG - Intergenic
1054523948 9:66101325-66101347 CTTCCTTTCTAACCTGATTCTGG + Intergenic
1054680412 9:67910952-67910974 CTTCCTTTCTAACCTGATTCTGG - Intergenic
1057514461 9:95709865-95709887 GATTCTTTCCAAACTGATACAGG - Intergenic
1058341285 9:103900178-103900200 GATCATTTCTGACCAGATTCAGG + Intergenic
1187814971 X:23221763-23221785 TATCCTTTTTTAACTAATACAGG - Intergenic
1187908923 X:24092801-24092823 GATGCCTTCTTTTCTGATACAGG + Intergenic
1188675605 X:32935819-32935841 GATCCTTCCTTAGCTGTTAATGG - Intronic
1192447791 X:71223570-71223592 CATCCTTCCTTTCCTGCTACTGG + Intronic
1193364448 X:80614467-80614489 GATCCTTGATTACCTTGTACAGG + Intergenic
1194423428 X:93706287-93706309 GACTCTTTCTTTTCTGATACTGG + Intronic