ID: 1143897140

View in Genome Browser
Species Human (GRCh38)
Location 17:10145147-10145169
Sequence GCTCAGGGCTGCAGACGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143897130_1143897140 21 Left 1143897130 17:10145103-10145125 CCAACAGAAATCCACAGCCCCAC 0: 1
1: 0
2: 4
3: 23
4: 276
Right 1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG 0: 1
1: 0
2: 6
3: 38
4: 301
1143897133_1143897140 4 Left 1143897133 17:10145120-10145142 CCCCACACTGGCAGACAGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 331
Right 1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG 0: 1
1: 0
2: 6
3: 38
4: 301
1143897132_1143897140 10 Left 1143897132 17:10145114-10145136 CCACAGCCCCACACTGGCAGACA 0: 1
1: 0
2: 4
3: 45
4: 457
Right 1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG 0: 1
1: 0
2: 6
3: 38
4: 301
1143897136_1143897140 2 Left 1143897136 17:10145122-10145144 CCACACTGGCAGACAGCCTGGCT 0: 1
1: 0
2: 0
3: 19
4: 296
Right 1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG 0: 1
1: 0
2: 6
3: 38
4: 301
1143897135_1143897140 3 Left 1143897135 17:10145121-10145143 CCCACACTGGCAGACAGCCTGGC 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG 0: 1
1: 0
2: 6
3: 38
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143897140 Original CRISPR GCTCAGGGCTGCAGACGCCC TGG Intronic
900091839 1:924130-924152 GCGCGGGACTCCAGACGCCCCGG + Intergenic
900181061 1:1311189-1311211 GCCCAGGGCTGCAGTCCCTCAGG + Intronic
900205182 1:1428345-1428367 GCCCAGGGTTCCAGAAGCCCAGG + Intergenic
900312875 1:2042937-2042959 CCTCAGGGCTCCAGGGGCCCTGG + Intergenic
900918890 1:5658479-5658501 GCTCAGGGCTCCTGCCTCCCAGG - Intergenic
901242228 1:7702189-7702211 GGTCATGGCTGCAGCAGCCCAGG - Intronic
901336669 1:8455095-8455117 TCTGAGGGCTGCTGACGTCCTGG - Intronic
901871935 1:12143298-12143320 GCTGAGGGCTGCAGACATCTGGG - Exonic
901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG + Intronic
902510722 1:16965680-16965702 GCTCAGTGATGCAGAAGCCACGG - Intronic
902838932 1:19063281-19063303 GCTCAGGCCTGCAGGGACCCGGG - Intergenic
903250893 1:22052707-22052729 GCGCAGTGCTGCCAACGCCCCGG + Exonic
903352429 1:22725788-22725810 GCTCGGGGCAGCTGACACCCAGG - Intronic
903438409 1:23369259-23369281 GATCAGGGCCTCAGACGCCCAGG - Exonic
903496825 1:23774398-23774420 GGCCAGGGCTGGAGAAGCCCCGG - Intergenic
904003969 1:27353719-27353741 GCTATGGGCTGCAGGTGCCCTGG + Exonic
904351464 1:29909840-29909862 TCACCGGGCTGCAGACTCCCAGG + Intergenic
905410786 1:37766437-37766459 GCTCTGTGCTGCGGATGCCCTGG + Intergenic
905522578 1:38611886-38611908 TCTCAGTGCTGCAGACTCCCAGG + Intergenic
905745639 1:40415040-40415062 GCACAGGGCAGCAGACGCCCAGG - Intronic
905907057 1:41626196-41626218 GTGCAGTGCTGCAAACGCCCCGG - Intronic
910678498 1:89839359-89839381 GCTCAGGCCTGTAGCCACCCTGG + Intronic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
912946908 1:114092975-114092997 GCTCTGTCCTGCAGACACCCAGG - Intronic
914915308 1:151815841-151815863 GGTCAGGCCTGCAGGCTCCCTGG + Intronic
916594902 1:166234298-166234320 GCTCAGGCATGCAGAGACCCAGG - Intergenic
917788735 1:178486483-178486505 GCTCAGGGCTGCAGAGTCAGGGG + Intergenic
919913506 1:202126452-202126474 GCCCAGGCCTGCAGAGGCACAGG - Intronic
922794795 1:228334727-228334749 GATGATGTCTGCAGACGCCCAGG - Intronic
1063270932 10:4509474-4509496 GCACAGGCCTGCAGATGCCTGGG + Intergenic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1066464993 10:35642751-35642773 GCTCGGCGCTGCAGAAGACCCGG + Intergenic
1067007097 10:42674452-42674474 GGTCAGGGGTGGAGAAGCCCTGG + Intergenic
1067663658 10:48255423-48255445 GCTCAGGGCTGCTGTTGCCATGG - Intronic
1068610781 10:59057624-59057646 GCCCAGGGCTGGAGACAGCCAGG + Intergenic
1071589213 10:86856311-86856333 GCCCTGGGCTGCAGAGGGCCAGG - Intronic
1072539839 10:96390020-96390042 GCTCTGGGCTGCAGAGGCCAAGG + Intronic
1072616063 10:97049532-97049554 ACCCAGGACTGCAGGCGCCCAGG + Intronic
1074220009 10:111427187-111427209 TCTCAGGCCTTCAGACTCCCTGG + Intergenic
1075833673 10:125433902-125433924 GCTTAGGGGTGCTGACCCCCAGG - Intergenic
1076198615 10:128540269-128540291 GGTCAGGGCTCCAGAGGCCCCGG + Intergenic
1076669046 10:132109511-132109533 TCTCAGGACAGAAGACGCCCGGG - Intronic
1076683227 10:132185981-132186003 GCTCTGGGCGGCGGCCGCCCGGG + Intergenic
1077225829 11:1438747-1438769 GCCCAGGGCTGGGGACGTCCTGG - Intronic
1078090747 11:8263113-8263135 GCCCCGGGCTGCACGCGCCCGGG - Intronic
1078351974 11:10602237-10602259 GCTCAGGGCTGCACCACCCCAGG + Intronic
1080643896 11:34174452-34174474 GCTTAGAGCTGCAAACTCCCGGG + Intronic
1083062812 11:59892086-59892108 GCTCAGGTCAGCAGCCGCTCAGG - Intergenic
1083199519 11:61111769-61111791 GCCCAGGGCAGCAGACCCTCGGG - Intronic
1083282317 11:61634737-61634759 GATGAGGGCTGCAGAGCCCCTGG + Intergenic
1083291713 11:61694200-61694222 GTTCAGAGCTGGAGAGGCCCAGG - Intronic
1083600339 11:63943398-63943420 GCTGAGGGCTTCTGAAGCCCAGG + Intronic
1083697870 11:64454745-64454767 GGTCAGGGCTGCAGTGACCCAGG - Intergenic
1083878414 11:65536789-65536811 GCTGAGAGCTGCAGGCACCCAGG + Intronic
1084182727 11:67454758-67454780 GCTCTGGGCTAGAGAGGCCCTGG - Intronic
1084502577 11:69543651-69543673 GCACAGGGCCTCAGATGCCCGGG - Intergenic
1084860570 11:72015315-72015337 GCGCAGGGCTGCAGATGCCCTGG - Exonic
1085350891 11:75797378-75797400 GCCCAGGGCAGCAGACTCCTTGG + Intronic
1087701471 11:101440914-101440936 GCTCAGGACTGAAGACTTCCTGG - Intergenic
1088579136 11:111299349-111299371 GGTCAGGGCCGGAGCCGCCCCGG + Exonic
1088877947 11:113951483-113951505 ACTCAAGGCTGCAGAGGCTCGGG - Intergenic
1089300745 11:117497364-117497386 GCTCAGGGCTGCAGACCTCCTGG + Intronic
1089432495 11:118436069-118436091 GCTCAAGGCTGCAGGCGGCCCGG + Intergenic
1089432836 11:118437095-118437117 ATGCAGGGCTGCAGACCCCCAGG + Intronic
1089565495 11:119369051-119369073 GCTCAGCCCTGCAGAGACCCAGG - Intronic
1090273385 11:125403341-125403363 GGTCAGGGCTGGAGACACGCTGG + Intronic
1090418690 11:126558486-126558508 GCCCAGGGCTCCAGACACCCAGG - Intronic
1090981203 11:131724202-131724224 GGTGAGGGGTGCAGGCGCCCTGG - Intronic
1091784919 12:3237534-3237556 GGACAGGGCTGCAGAGGCTCTGG - Intronic
1093191532 12:16080568-16080590 ACTCATGACTGCAGAGGCCCAGG + Intergenic
1095446665 12:42288794-42288816 GCTGAAGCCTGCAGAAGCCCTGG - Intronic
1095978665 12:47957605-47957627 GCCCAGAGCAGCAGAGGCCCTGG - Intergenic
1096504910 12:52086651-52086673 GCTCAGAGCTGCAGCCTCTCTGG + Intergenic
1096648090 12:53049001-53049023 GCTTGGGGCTGAAGACTCCCAGG + Exonic
1100329598 12:93571314-93571336 GCTCCGAGCTGCGGAAGCCCAGG - Intronic
1102490339 12:113286670-113286692 GGCCAGGGCTGCAGAGGCCGGGG + Intronic
1103271134 12:119674736-119674758 GGGCAGGGCTGAAGAGGCCCTGG + Intronic
1103703787 12:122860855-122860877 GCTCAGGGCAGCAGCAGGCCTGG - Intronic
1104203042 12:126610201-126610223 GCTCGGGGATGCAGATGTCCAGG + Intergenic
1104583858 12:130031261-130031283 GCTCTGGGGAGAAGACGCCCAGG + Intergenic
1104620473 12:130308117-130308139 TCCCAGAGCTGCAGACGGCCAGG - Intergenic
1104699618 12:130892090-130892112 GCTCGGAGGTACAGACGCCCCGG + Intergenic
1105885595 13:24638454-24638476 GCCCAGGGCTGCACGCACCCAGG + Intergenic
1108003455 13:45925233-45925255 GCTCAGGGCTCCACAGGCTCTGG + Intergenic
1108088183 13:46818089-46818111 GGGCATGGCTGCAGCCGCCCAGG + Intergenic
1111973986 13:94946356-94946378 GCTCAGGTCTGAAGACGCCAGGG + Intergenic
1113638409 13:111938163-111938185 CTTCAGGGCTGCAGGCTCCCTGG + Intergenic
1113903809 13:113810093-113810115 GCTCTGCACTGCAGACGCCCTGG - Intronic
1113910611 13:113839590-113839612 CCTCAGGGCTGCAGCCTCCTTGG + Intronic
1113955547 13:114098453-114098475 CAGCAGGGCTGCAGGCGCCCAGG + Intronic
1115154032 14:30317875-30317897 ACTCCAGGCTGCAGACTCCCAGG + Intergenic
1115270871 14:31550808-31550830 GGTCAGAGTTGCAGACTCCCTGG + Intronic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1117937119 14:60919159-60919181 GCTCAGAGCTGGAGAGGACCAGG + Intronic
1118442132 14:65821628-65821650 GCTCAAGGCGGCAGATGCACTGG + Intergenic
1118593922 14:67421478-67421500 GCTCAGGCCACCAGACACCCAGG + Intergenic
1118850137 14:69576716-69576738 GTTAAGGGCTGCAGAGGTCCAGG + Intergenic
1120281711 14:82447082-82447104 GCTCAGGGCTGGAAACACTCGGG + Intergenic
1121312999 14:92945199-92945221 ACCCAGGGCTGCTGTCGCCCAGG - Intronic
1121928383 14:97949359-97949381 GCTAAGGGCTGCAGACCTCCAGG + Intronic
1122801322 14:104231090-104231112 GCTCAGGTCTGCAGCTTCCCAGG + Intergenic
1122837719 14:104438197-104438219 CCTGAGGGCTGCAGGCCCCCGGG + Intergenic
1122886602 14:104713125-104713147 GCTCAGGGAGGGGGACGCCCAGG + Intronic
1123050731 14:105540793-105540815 GCTTAGGGCTGCAGAGCCCTGGG + Intergenic
1124177821 15:27442478-27442500 GCTCCGGGCGGCACAAGCCCTGG + Intronic
1124937623 15:34187157-34187179 GCTGAATGCTGCAGACGACCAGG + Intronic
1126102848 15:45129992-45130014 GCGCAGAGCTGCAGAGGCACCGG + Exonic
1128097561 15:64969585-64969607 GCTGAGGGCTGTAGAAGGCCGGG - Intronic
1128727837 15:70000817-70000839 GCTCAGGGTGCCAGTCGCCCAGG + Intergenic
1129317585 15:74754742-74754764 CCTCAGGGCTGGAGAGGCCCTGG - Intronic
1129330274 15:74823571-74823593 CCGCATGGCTGCAGAAGCCCAGG + Exonic
1129658246 15:77538986-77539008 GCTCAGGGCTCCAGTCCCCTGGG - Intergenic
1130024617 15:80260562-80260584 GCTCAGGGCTCCCCATGCCCTGG - Intergenic
1130135268 15:81176872-81176894 GCTCAGGGCTGGGGAAGGCCCGG + Intronic
1130705796 15:86232001-86232023 CCTCAGGGCAGCAGAGACCCTGG - Intronic
1132791595 16:1692559-1692581 GATCAGAGCTGCAGCCTCCCTGG + Intronic
1132806106 16:1775874-1775896 GCGCAGGGCTGCAGGCGGCCTGG + Exonic
1132860974 16:2071647-2071669 GCTCAGGGCGTCAGAGGCGCTGG + Intronic
1132977265 16:2716943-2716965 GCTCAGAGCGGAAGAGGCCCGGG + Intronic
1136566441 16:31073436-31073458 GTTCTGGGCTGCGGACACCCAGG - Intronic
1136774651 16:32865349-32865371 GCTCAGGGCAGTAGAAGCCCTGG + Intergenic
1136776573 16:32874934-32874956 GCCCACGGGTGCAGATGCCCTGG - Intergenic
1136894042 16:33986579-33986601 GCCCACGGGTGCAGATGCCCTGG + Intergenic
1136895960 16:33996165-33996187 GCTCAGGGCAGTAGAAGCCCTGG - Intergenic
1138271609 16:55699747-55699769 GCTCTGGGATCCAGAGGCCCTGG + Intronic
1138542137 16:57694930-57694952 GATCAGGGCTGGAGGCCCCCAGG - Intronic
1139894887 16:70280594-70280616 CCTAAGGGCTGCAGATGCCCCGG + Intronic
1141022791 16:80513422-80513444 GCTCACTGCTGCAGACACCAGGG + Intergenic
1141127162 16:81408940-81408962 GAGCAGGTCTGCAGAAGCCCGGG - Intergenic
1141392805 16:83678618-83678640 GCTGACGGCTGCAGAGGGCCAGG + Intronic
1141479133 16:84294717-84294739 TGCCTGGGCTGCAGACGCCCTGG + Exonic
1141981084 16:87550874-87550896 GCCCAGGGCTGCAGACGCTGGGG - Intergenic
1142196038 16:88739735-88739757 GATCAGGGCAGGAGAGGCCCAGG + Intronic
1142213235 16:88818256-88818278 GCTCAAGCCTGCAGCGGCCCCGG + Intronic
1142243110 16:88956052-88956074 GCCCAGGGCTGCCAACCCCCAGG + Intronic
1142353331 16:89589721-89589743 GCTCAGGGCAGCAGAGGCACAGG - Intronic
1142395222 16:89828256-89828278 GCTCAGGGCTGGGGACGCGGGGG - Intronic
1203077078 16_KI270728v1_random:1127485-1127507 GCTCAGGGCAGTAGAAGCCCTGG + Intergenic
1203078988 16_KI270728v1_random:1137043-1137065 GCCCACGGGTGCAGATGCCCTGG - Intergenic
1142637030 17:1264180-1264202 GCCCAGGGCTGCTGAAGGCCAGG - Intergenic
1142727965 17:1830158-1830180 GCTCGGGGCCGCAGCCACCCCGG - Intronic
1142836931 17:2594054-2594076 GGTCCGGCCTGCAGCCGCCCGGG - Intronic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1143556895 17:7667726-7667748 CCTCAGGGCTGCTGGCTCCCAGG - Intronic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1144457736 17:15432787-15432809 GCTCAGGGCAGCAGATGGCATGG - Intergenic
1144742568 17:17592086-17592108 GCCCAGGGCCCCACACGCCCAGG + Intergenic
1145308512 17:21688636-21688658 GCTCAGGTCCCCAGACCCCCAGG - Intergenic
1146577358 17:34006336-34006358 ACTCTGGGCTGCAGCCACCCTGG - Intronic
1150390325 17:64786396-64786418 GTTCAGGGCAGCCCACGCCCTGG - Intergenic
1151239024 17:72743472-72743494 TCTCAGGTCTGCAGTGGCCCTGG + Intronic
1151626264 17:75277764-75277786 GTTCAGGGCTGGAGAGGACCAGG + Intronic
1151881679 17:76899283-76899305 GCTCAGAGCTGGAGACGAGCCGG - Intronic
1152308603 17:79535737-79535759 GCTCAGTGCTGCAGGCTTCCTGG - Intergenic
1152876172 17:82787396-82787418 GCCCAGGGCTTCAGACGCTCTGG - Intronic
1155403989 18:25467745-25467767 GCACAGGGCTCCAGCAGCCCAGG - Intergenic
1157112768 18:44836454-44836476 GCTCAGAGCTGCAGAGTCCAGGG + Intronic
1160158133 18:76449281-76449303 GCTCAGGGCTCTAGACACCGGGG - Intronic
1160528177 18:79549227-79549249 GGTCAGTGAGGCAGACGCCCAGG + Intergenic
1160541942 18:79628645-79628667 GCTCATGGCTGCCCAGGCCCAGG - Intergenic
1160659724 19:292265-292287 GCTCAGGGCTCCCCACGACCTGG - Intergenic
1160739378 19:678977-678999 GCTGAGGGCTGCAGACCCGAAGG + Intronic
1161064517 19:2231099-2231121 GCTCAGGGCTCCAGAAGCACTGG - Exonic
1161065178 19:2233971-2233993 GTGCAGGGCTGCAGAGGGCCGGG - Intronic
1161120681 19:2524166-2524188 GCCCAGGGCAGCAGGGGCCCAGG - Intronic
1161390700 19:4018953-4018975 GCTCAGGGCCACACACACCCCGG - Intronic
1162961079 19:14127268-14127290 GCTCAGGCCTTGAGAGGCCCAGG - Intronic
1163015154 19:14450421-14450443 GCTCAGCGCTGCCAAGGCCCCGG + Exonic
1163513231 19:17748221-17748243 GCTCCGGCCTGCAGACCACCGGG + Intronic
1164157013 19:22603108-22603130 GCTCAGGGCTGCCGACAAGCAGG + Intergenic
1164532275 19:29057573-29057595 TCTCAGGGCTGCCCACACCCAGG - Intergenic
1165080370 19:33302992-33303014 GCTCTGCGCTGCAGCCTCCCCGG - Intergenic
1165111911 19:33507469-33507491 TGTCAGGGTTGCAGACGCCAGGG - Intronic
1165191139 19:34064461-34064483 ATTCAGGGCTGCAGACCCCCAGG - Intergenic
1165956336 19:39504078-39504100 GCTCAGGGCTGCAGCCTGCTCGG - Exonic
1165999540 19:39870254-39870276 GGACAGGGATGCAGACACCCTGG + Exonic
1166196265 19:41207688-41207710 GGGCAGGGCTGGTGACGCCCTGG + Intergenic
1166268765 19:41700949-41700971 GCTCAGGGCTTCAGACGGGTCGG + Intronic
1166836515 19:45670835-45670857 GCTGTGGGCTGGAGAGGCCCGGG + Intronic
1166918085 19:46209448-46209470 GTCCAGGGCTGCAGGAGCCCAGG + Intergenic
1167004559 19:46767135-46767157 GCTGAGGGGTGCAGGAGCCCGGG - Intronic
1167559213 19:50215268-50215290 TCTCATGGCTGCCGGCGCCCCGG - Intronic
1167561575 19:50229098-50229120 GCTCAGGGCTGTTGTCCCCCAGG + Intronic
1168201966 19:54822050-54822072 GATCAGGGCTCCAGGCACCCAGG + Intronic
1168206780 19:54856106-54856128 GGTCAGGGCTCCAGGCACCCAGG + Intronic
925800065 2:7590264-7590286 GCTAAGGGCACCAGAGGCCCTGG + Intergenic
926083637 2:10007730-10007752 GCTCTGGCCTGCAGACGCAGAGG + Intergenic
926724215 2:15984698-15984720 TCTCCGGGCTGCAGACAGCCTGG - Intergenic
927109043 2:19851284-19851306 GCTCATGGCTGCAGCATCCCCGG - Intergenic
927708609 2:25311947-25311969 GCTCTGGGCTGCGGAGCCCCAGG - Intronic
928373832 2:30759404-30759426 GCTGAGGGCTGCCGGCTCCCGGG - Intronic
932302368 2:70676445-70676467 GCTTGGGGCTGGAGACTCCCAGG - Intronic
932490068 2:72114746-72114768 GCCCAGGGCTGCAGAGCCGCAGG - Intergenic
932625638 2:73293593-73293615 GCTCCGGGCTTCCGACTCCCCGG + Exonic
934133296 2:88970288-88970310 TCACAGGGCAGCAGATGCCCAGG + Intergenic
935310917 2:101782498-101782520 GATCAGGGCTGCAGATGAGCAGG - Intronic
935526290 2:104171846-104171868 GCTGAAGGCCCCAGACGCCCTGG - Intergenic
937050138 2:118881919-118881941 GATCAGAGCTGTAAACGCCCAGG - Intergenic
937312397 2:120910225-120910247 GCTCAGGCCTGCTGACCACCGGG - Intronic
940638282 2:156323110-156323132 TCTCAGGGCTGCAGACACCTGGG + Intergenic
944198525 2:197081045-197081067 ACTCAGGGCTGTAGATGCACGGG - Intronic
947624092 2:231608599-231608621 GCTCAGGCCTGCAGATGAGCAGG + Intergenic
947915427 2:233829274-233829296 TAGCAGGGCTGCAGAGGCCCAGG - Intronic
948721523 2:239903931-239903953 CCTCAGGGCTGCAGAGAACCAGG + Intronic
948750608 2:240130275-240130297 TCTCAGGCCAGGAGACGCCCAGG - Intronic
948868227 2:240785901-240785923 GCCCAGGGCAGCAGAGGCCAAGG + Intronic
1169056577 20:2626913-2626935 GCTCAGGGCTGCAGAAGCTCAGG - Intronic
1170898946 20:20441451-20441473 GGTCACTGCTGCAGAGGCCCAGG - Intronic
1171201485 20:23245419-23245441 GCTCAGGTCTGCACACACACTGG - Intergenic
1172654421 20:36528274-36528296 GCTCAGGGCTCGTGACACCCTGG - Exonic
1172795901 20:37537279-37537301 GGCCAGGGCAGCAGAAGCCCAGG - Intergenic
1173396233 20:42682727-42682749 GCTCAGGGCCGCTGCTGCCCAGG - Intronic
1174065363 20:47860730-47860752 GCCCAGGGCTGGAGGCACCCAGG - Intergenic
1175310872 20:58010921-58010943 GCTGAAGGCTGCAGGCTCCCAGG - Intergenic
1175859401 20:62142588-62142610 GGGCCGGGCTGCAGCCGCCCGGG - Intronic
1179087383 21:38229331-38229353 GCTCAGGGCCCCAGACCCACAGG + Intronic
1180039869 21:45270365-45270387 GCTCACAGCTGCAAACTCCCCGG + Intronic
1180409013 22:12584845-12584867 GCTCAGGTCTGCAGACGTGGGGG - Intergenic
1180594821 22:16966229-16966251 CCACAGGGATGCAGACACCCTGG + Exonic
1180842983 22:18967892-18967914 ACTCCGGGCAGCAGACGGCCAGG + Intergenic
1180971371 22:19817747-19817769 GCTCAGGGATTCAGAGGCTCGGG + Intronic
1181058485 22:20270836-20270858 ACTCCGGGCAGCAGACGGCCAGG - Intronic
1181633409 22:24163280-24163302 GCTCAGGGCTGGAGGTGCCCTGG + Intronic
1181965974 22:26657163-26657185 GCTCAGGGCTGGAGAGGCGCGGG - Intergenic
1182159530 22:28107562-28107584 GCCCAGGGCTGCATATGCACTGG + Exonic
1182691917 22:32170283-32170305 GCTCAGGGCTGGTGGTGCCCTGG + Intergenic
1183359860 22:37377835-37377857 TCTCAGGGCTGCAGAGACCTTGG + Intronic
1183932144 22:41241176-41241198 GCCCAGGACTGCTGACTCCCGGG - Intergenic
1184533297 22:45070544-45070566 GCAGAGGGCTGGAGACACCCAGG + Intergenic
1184940459 22:47761044-47761066 GGTCTGGGCTGCAGACGCTCTGG + Intergenic
1185412800 22:50694843-50694865 GCTGAGCGCTGCAGAGGCCGAGG - Intergenic
952919610 3:38275700-38275722 CCACAGGGCTGCAGCCTCCCTGG + Intronic
953070746 3:39516971-39516993 ACTCAGGGCTGGAGGGGCCCTGG + Intronic
954364725 3:50139745-50139767 GCTGAGGGCTTCAGCCTCCCAGG - Intergenic
954838887 3:53494506-53494528 GCGCCGGGCTGCAGACCCGCCGG + Intergenic
956167195 3:66405756-66405778 GCTCCGGGCTCCAGACCCACTGG - Intronic
956238543 3:67103811-67103833 GCTCAGGGCTGCAGAATCCTGGG - Intergenic
957614468 3:82509373-82509395 GCTCAGGTATGCACACGCTCAGG + Intergenic
962414770 3:135172203-135172225 GTTCAGTGCTGCAGACACCCAGG + Intronic
962811614 3:138963282-138963304 GCTCAGGGCTGCAGGCGGCTGGG - Intergenic
967035343 3:185645275-185645297 GCTGAAGCCTGCAGAAGCCCTGG + Exonic
967493684 3:190120598-190120620 TCGAAGGGCTGCAGAGGCCCGGG + Exonic
968887417 4:3341846-3341868 GGTAGGGGCTGCAGAGGCCCCGG + Intronic
968908227 4:3464128-3464150 GCCCAGCGCTGCAGGCGGCCTGG - Intronic
969754247 4:9137981-9138003 GCCAAGGGCTGCAGACTCTCTGG + Intergenic
969814142 4:9674257-9674279 GCCAAGGGCTGCAGACTCTCTGG + Intergenic
969926818 4:10593224-10593246 TCTCAGTGCTGCAGAGGCTCAGG + Intronic
972203863 4:36747817-36747839 GCTCTGGGATGGAGAGGCCCTGG - Intergenic
972688721 4:41375654-41375676 GCACAGAGCTGCACACCCCCTGG - Intronic
973094221 4:46176817-46176839 GCTCAGGCATGCAGAGACCCAGG + Intergenic
974016035 4:56650092-56650114 GCCCAGGGCTGCAGAGCCCTGGG - Intronic
978238441 4:106488031-106488053 GCAAAGGGCTGTAGAAGCCCAGG + Intergenic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
985684340 5:1273873-1273895 GCACTGGGCTGGAGAGGCCCGGG - Intronic
985792492 5:1937711-1937733 CCTCAGGGCTGCAGCTGCCCGGG + Intergenic
986291986 5:6407458-6407480 GCTCAGGGCTGGCGACACCGTGG - Intergenic
986608277 5:9544906-9544928 GCTCAGGGTTTCAGACCCCAGGG - Intronic
986758285 5:10857548-10857570 GCTCAGGGCTGCAGAGTGTCAGG - Intergenic
991587810 5:68216715-68216737 GCTCCGGGTTGCAGGCTCCCTGG - Intronic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
994012156 5:94917925-94917947 GCTCTGCTCTGCAGAAGCCCAGG + Exonic
996314393 5:122145375-122145397 GCTGAGGTCTGCAGATGCCATGG + Intronic
996379003 5:122845415-122845437 GCGCAGGGCTCCAGGCGCCTGGG - Intronic
998151806 5:139761828-139761850 GGTGAGGGCTGCAGACAGCCAGG - Intergenic
999253959 5:150199255-150199277 CCCCAGGGCTGCCGATGCCCTGG - Exonic
1000646915 5:163770186-163770208 GCTCAGGGCTGGAGAGACCAGGG - Intergenic
1000694114 5:164358790-164358812 GGGCAGGGCTGCTGAGGCCCTGG + Intergenic
1001881443 5:175247948-175247970 GCCAAGGGCTACAGAAGCCCAGG + Intergenic
1001922881 5:175614251-175614273 GATCAGGGCTTCAGACACTCAGG + Intergenic
1002140515 5:177134535-177134557 GCTCTGGGGTGCAGCCGCCTCGG + Intronic
1005303028 6:24489551-24489573 GCTCAGAGCTGCAGCAGCACTGG + Exonic
1005855950 6:29863588-29863610 TCCCAGAGCTGGAGACGCCCAGG - Intergenic
1006717573 6:36130377-36130399 GCGCAGGGCTGGACAGGCCCGGG + Exonic
1006814127 6:36839434-36839456 GCCCAGGGCTCCAGTCGCTCCGG - Exonic
1007257780 6:40540807-40540829 GCAGAGGTCTGCAGACGCCCAGG + Intronic
1007341120 6:41192140-41192162 GCTCGGAGCTGCAGACCCCAGGG - Exonic
1011597466 6:89029791-89029813 TCTCAGGGCTGCAGAACACCTGG - Intergenic
1014561654 6:122898460-122898482 GCTCAAGGCTGCTGGCACCCTGG - Intergenic
1016417055 6:143843721-143843743 ACGCAGGGCTGCAGGCTCCCAGG - Intronic
1017222460 6:151982216-151982238 GGCCAGGGCTTCAGAGGCCCAGG - Intronic
1017813288 6:157999566-157999588 GCTCAGGGCTGCGAACATCCAGG + Intronic
1018058550 6:160072128-160072150 GCTATGGGCAGCAGGCGCCCTGG + Intronic
1018643828 6:165929791-165929813 GCTCAGAGCTGCTGTCACCCAGG + Intronic
1019266367 7:119526-119548 GCTCAGGTCTGCAGAGGCCGAGG - Intergenic
1019333512 7:471808-471830 GCTCAGGGCAGCGGGCTCCCTGG - Intergenic
1019472694 7:1229827-1229849 GCTCGGGGCTGCGGCCGGCCGGG - Intergenic
1019528842 7:1493802-1493824 GCTCGGGCCTGCGGACGCCATGG - Exonic
1019650859 7:2157517-2157539 GCTCAGTGCAGCACAGGCCCAGG + Intronic
1024936204 7:54714505-54714527 GCTCAGGAAGGCAGAAGCCCAGG + Intergenic
1025257950 7:57398448-57398470 GGTCAGGGCCCCAGAGGCCCAGG + Intergenic
1025929527 7:65982651-65982673 GGTCAGGGCTCCAGAAGCCCAGG - Intergenic
1032162052 7:129518442-129518464 CCTCAGGTCTGCAGACACCTTGG - Intergenic
1032826638 7:135576146-135576168 GCTCAGGGCTTAAGGGGCCCTGG - Intronic
1032878991 7:136068408-136068430 GCTCAGGACTCCAGACTCCAAGG - Intergenic
1034475124 7:151277147-151277169 GCTCCGGGCTGCAGCGGCGCAGG - Intronic
1034670930 7:152857870-152857892 GCTCAAGGCTGCAGGAGCCAGGG + Intergenic
1036560808 8:9899034-9899056 GGTCAGGGCTACAAACGCCAGGG - Intergenic
1037911905 8:22748641-22748663 ACTCAGGGCTGCTGACAGCCGGG - Intronic
1038540418 8:28386077-28386099 GCTCCGGGCTGCAGCGGCCGCGG + Intronic
1039948990 8:42153199-42153221 TCTCAGGGCTGCGGACGCGGCGG + Intronic
1041304519 8:56446208-56446230 GCCCTGGGCCGCGGACGCCCAGG - Intronic
1042039717 8:64578623-64578645 GCTCAAGCCTGCAGAACCCCCGG + Intergenic
1043008733 8:74855450-74855472 GCCCAAGGCTGGAGACTCCCAGG + Intergenic
1049058442 8:140257355-140257377 GCTCAGCGCAGAAGAGGCCCAGG - Intronic
1049510530 8:143024721-143024743 ACTCAGGGCTGGGGACCCCCAGG - Intergenic
1049555446 8:143279194-143279216 GCTCAGGGTCGCAGGCGTCCCGG - Intergenic
1049677093 8:143894904-143894926 GCTCAGGGTTGCAGAGGGCAGGG + Intergenic
1049691077 8:143959457-143959479 GGTCCGGGATGCAGAGGCCCAGG + Intronic
1049717650 8:144100499-144100521 GCTCAGCTCTGAAGACGCCCAGG - Intronic
1050204410 9:3181729-3181751 GCTCAGGGCTGCCGCCCCGCTGG - Intergenic
1051376699 9:16409274-16409296 GGTCAGAGCTGCAGAGGTCCTGG - Intergenic
1051843909 9:21430117-21430139 GCTCAGGACTGCAGACGTCAAGG + Intronic
1055091226 9:72365801-72365823 GCCCAGGGCTGCCAATGCCCCGG + Intergenic
1056091471 9:83209523-83209545 GCCAAGGGCTGCAGACCCCTGGG + Intergenic
1056761497 9:89418762-89418784 GTGCAGGACTGCAGACGCTCAGG + Exonic
1056954509 9:91071533-91071555 GCTCTTGTCTGCAGAGGCCCAGG - Intergenic
1057030686 9:91773112-91773134 GCAGAGGGCTGCAGGGGCCCTGG - Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057934022 9:99221804-99221826 GCTCAGCGCCGCCCACGCCCAGG + Exonic
1058828832 9:108797547-108797569 GCTCAGAGCTACTCACGCCCCGG + Intergenic
1059155122 9:111982712-111982734 GCTCAGGGCTGCAAACGAATGGG - Intergenic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060010801 9:120041405-120041427 TCTCTGGGCTCCAGAGGCCCTGG - Intergenic
1060196889 9:121629606-121629628 GCTCGGGGCTTCAGGGGCCCTGG - Intronic
1060530537 9:124344909-124344931 GAGCAGGGCTGCAGACCTCCTGG + Intronic
1060659450 9:125395407-125395429 GCTCAGGACTGCAGACAGCAAGG - Intergenic
1060659910 9:125399307-125399329 CCACAAGGCTGCAGAAGCCCTGG - Intergenic
1060723983 9:125995414-125995436 CCTCAGAGCTGCAGGGGCCCTGG + Intergenic
1061388246 9:130303041-130303063 GCTCCTGGCTGCTGAGGCCCTGG + Intronic
1061513046 9:131072514-131072536 GCTCAGGGCTGCTGATGCCTGGG + Intronic
1061520540 9:131114889-131114911 GCCCAGGGCTGGAGACACTCAGG + Intronic
1061674751 9:132209463-132209485 TCTCAGGGCTGCAGCCCGCCCGG - Intronic
1062020915 9:134319094-134319116 GCTGAGGGCTGTACACGCTCAGG - Intronic
1062030184 9:134358681-134358703 GCCCAGTCCTGCAGACGACCAGG - Intronic
1062167231 9:135113900-135113922 GCGCAGCCCTGCAGGCGCCCTGG - Intronic
1062458811 9:136654307-136654329 TCGCAGGGCTGCAGGGGCCCAGG - Intergenic
1185642698 X:1597388-1597410 GCACAGAGAGGCAGACGCCCTGG + Intronic
1186496708 X:10016412-10016434 GCAGTGGGCCGCAGACGCCCGGG - Intronic
1197424758 X:126282346-126282368 TCACAGGGCTGCAGAAGCCCTGG + Intergenic
1198378318 X:136061154-136061176 GCTCTGAGGTGCAGACTCCCGGG + Intergenic
1200064990 X:153499961-153499983 GCTCAGGGGGGCAGACGCCCAGG + Intronic
1200084737 X:153598680-153598702 GCGCAGAGCTGCGGGCGCCCGGG + Intronic
1200090189 X:153632399-153632421 TCCCAGGGCTGCAGAGGCCCTGG - Intergenic
1200103288 X:153699106-153699128 GCCCACGGGTGCAGATGCCCTGG + Intergenic
1200142605 X:153909493-153909515 GCGCAGGGCTGCAGACTGCAGGG - Exonic
1200152515 X:153958204-153958226 GCTGAAGACTGCAGCCGCCCAGG - Exonic