ID: 1143900089

View in Genome Browser
Species Human (GRCh38)
Location 17:10167809-10167831
Sequence AGCTACTCGGGAGGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109344
Summary {0: 5, 1: 210, 2: 7956, 3: 41130, 4: 60043}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143900089_1143900097 7 Left 1143900089 17:10167809-10167831 CCACCTGGGCCTCCCGAGTAGCT 0: 5
1: 210
2: 7956
3: 41130
4: 60043
Right 1143900097 17:10167839-10167861 CAGGCATGCACCACCATGCCTGG 0: 4351
1: 14696
2: 43750
3: 92278
4: 164583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143900089 Original CRISPR AGCTACTCGGGAGGCCCAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr