ID: 1143900336

View in Genome Browser
Species Human (GRCh38)
Location 17:10169699-10169721
Sequence ATGGAGAAGAGGTCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 875
Summary {0: 1, 1: 1, 2: 2, 3: 81, 4: 790}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143900336_1143900341 -6 Left 1143900336 17:10169699-10169721 CCATCCCCAGACCTCTTCTCCAT 0: 1
1: 1
2: 2
3: 81
4: 790
Right 1143900341 17:10169716-10169738 CTCCATCCACCCCACTCCTTAGG 0: 1
1: 0
2: 0
3: 39
4: 302
1143900336_1143900348 15 Left 1143900336 17:10169699-10169721 CCATCCCCAGACCTCTTCTCCAT 0: 1
1: 1
2: 2
3: 81
4: 790
Right 1143900348 17:10169737-10169759 GGTGATCTCATCCAGTACAGCGG 0: 1
1: 0
2: 1
3: 28
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143900336 Original CRISPR ATGGAGAAGAGGTCTGGGGA TGG (reversed) Intronic
900298312 1:1964039-1964061 ATGAAGGACAGGTCTGGGGGTGG + Intronic
900421215 1:2556790-2556812 ATGGGGAAGAGATCTGTGGGAGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902555870 1:17246248-17246270 ATGGAGATCAGATCAGGGGAGGG + Intergenic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
903095968 1:20973897-20973919 TTGGAGTAGAGGTGTGGAGAAGG + Intronic
903172427 1:21562675-21562697 AGGGGGAAGGGGACTGGGGAAGG - Intronic
903186849 1:21633898-21633920 AGTGAGAAGAGGGCTGTGGAGGG + Intronic
903260740 1:22130414-22130436 ATGGGCTAGAGGTCTAGGGATGG + Intronic
903432228 1:23314987-23315009 ATGAAGAAGAGGGCTGGGCGCGG + Intronic
904336151 1:29799679-29799701 ATGGGGCAGTGGGCTGGGGAAGG + Intergenic
904833201 1:33318790-33318812 CTGGAGGAGAGGTCTGGGAAAGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905106366 1:35565751-35565773 TTGGGGAGGAAGTCTGGGGAGGG - Exonic
905411134 1:37769004-37769026 AAGGAAAAGAAGTCTGGGCACGG + Intergenic
905484844 1:38288221-38288243 ATGGAGTAGAGTCCTGGAGAGGG + Intergenic
905858378 1:41330048-41330070 CTGGAGAAGGGGCCTGGGGCTGG - Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
906947962 1:50311514-50311536 AGGGAGAAGAGGTCAGAGTAGGG + Intergenic
907588822 1:55646248-55646270 ATGGAGAAGAGGGGTGGTGTTGG - Intergenic
907597435 1:55732779-55732801 TTGGGGAAGAGGTATGTGGATGG + Intergenic
907679697 1:56551567-56551589 AAGGAGAAGATGCCTGGGAATGG + Intronic
907705375 1:56828020-56828042 TTGAACAAGAGGACTGGGGATGG + Intergenic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908737472 1:67291469-67291491 TTGGGGAAGAGGTATGTGGATGG + Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909172901 1:72317729-72317751 CTGGAGAAGAGGCATGGGAATGG - Intergenic
909577018 1:77186514-77186536 TTGGGGAAGAGGTATGTGGATGG + Intronic
909687566 1:78367979-78368001 AAGGAGAGGAGGGCAGGGGAGGG - Intronic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910638896 1:89439318-89439340 ATGGGGAAGAGGTATATGGATGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911257247 1:95646706-95646728 TTGGGGAAGAGGTATGTGGATGG - Intergenic
911315968 1:96357170-96357192 AAGGAAAAGATATCTGGGGATGG - Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
912050963 1:105527216-105527238 CTGGAGAACAGGCATGGGGATGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
913181904 1:116330396-116330418 ATGGCTAAGCGGTGTGGGGAGGG + Intergenic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
914887014 1:151593832-151593854 AAGCAGAAGCGGTTTGGGGAGGG + Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915319396 1:155047936-155047958 GGGGTGGAGAGGTCTGGGGAGGG - Intronic
915444297 1:155966200-155966222 ATGGGGATGAGGGCTGGGGATGG - Intronic
915451223 1:156006807-156006829 TTTGAGAACAGGTGTGGGGAAGG - Intronic
915667965 1:157461924-157461946 CTGGAGAACAGGTATGGGAATGG - Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916211521 1:162363783-162363805 ATTGAGAGAAGATCTGGGGAGGG - Intronic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916339430 1:163712697-163712719 ATTGAGAAGAAGCCTGGGCATGG + Intergenic
916631158 1:166613933-166613955 GCTGAGAAGAGATCTGGGGAAGG + Intergenic
916658984 1:166903599-166903621 AAAGAGAAGAGATTTGGGGAGGG + Intergenic
917217132 1:172690255-172690277 TTGGGGAAGAGGTATGTGGATGG - Intergenic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917899297 1:179526175-179526197 AGAGAGGAGAGGTCTGGTGATGG - Intronic
917928145 1:179806024-179806046 AGGGAGGAGAGCTCTGGGGCTGG - Intronic
918301915 1:183212454-183212476 AGGGAGGAGAGGTCTAAGGAGGG - Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918918141 1:190671222-190671244 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
919230306 1:194764830-194764852 CTGGAGAATAGGCATGGGGATGG - Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919783909 1:201245077-201245099 ATGGAGATGAGGCCTTTGGAAGG + Intergenic
920192467 1:204202367-204202389 CAGGAGAAAAGGTGTGGGGAAGG - Intronic
920197524 1:204239024-204239046 TTGGGGAAGAGGTATGTGGATGG + Intronic
920266311 1:204726048-204726070 TGGGAGAAGAGGGCTGTGGAGGG + Intergenic
920588714 1:207195693-207195715 ATGCACAAGAGTTCAGGGGAGGG - Intergenic
921038796 1:211409020-211409042 AAAGAGAAGAAGTCTGGGCATGG + Intergenic
921260923 1:213384517-213384539 ATGGTTAGGAGGTCTGTGGAGGG + Intergenic
921343769 1:214160555-214160577 AAGGAGAAGAAGTATGGGTAGGG + Intergenic
922036648 1:221854812-221854834 ATGGAGAAGAAGTCATGGAAGGG + Intergenic
922582645 1:226710143-226710165 TTGGAAAAGAAGTCTGGGGTGGG + Intronic
922637595 1:227190845-227190867 AGGGAGAAGAGGTGTAGGAATGG + Intronic
922919826 1:229293156-229293178 TAGGAGACGAGGTATGGGGATGG + Intronic
923063708 1:230499272-230499294 TCTGAGAATAGGTCTGGGGAGGG - Intergenic
923211927 1:231811263-231811285 AGGGAGAAGGGGGTTGGGGAGGG + Intronic
923638271 1:235723385-235723407 GAAGAGAAGAGGTCTGAGGAAGG + Intronic
924217572 1:241839849-241839871 CTGGAAAACAGGGCTGGGGAAGG - Intergenic
1063090083 10:2857101-2857123 AAGGAGGAGAGGTAAGGGGAGGG + Intergenic
1063434661 10:6020211-6020233 ATGGAAACCAGGACTGGGGAGGG - Intronic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1064290058 10:14025622-14025644 AATGAGAAGAGTTCTGGAGATGG - Intronic
1065174163 10:23061021-23061043 GTGGAGGAGAGGTGTGGGGTGGG - Intergenic
1065311144 10:24416919-24416941 ATGGAGGAGGAGTCTGGGAAGGG - Intronic
1065332673 10:24618887-24618909 ATGGAGAACAGATCTGGGGTGGG + Intronic
1065339664 10:24693046-24693068 ATGGTGATGAAGTCTGGAGAGGG + Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1066166936 10:32798572-32798594 TTGGGGAAGAGGTATGTGGATGG - Intronic
1067125461 10:43511890-43511912 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1067163336 10:43845385-43845407 CTGGAGGAGAGGTCCGGGGGTGG - Intergenic
1067191256 10:44070078-44070100 ATGATGAAAAGTTCTGGGGATGG + Intergenic
1067229720 10:44397707-44397729 ATGCAGATGAGGCCTGGGGCAGG + Intergenic
1067333228 10:45340875-45340897 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1067708988 10:48633833-48633855 AGGGAGCAGAGGGCTGGGCATGG + Intronic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1068082345 10:52335215-52335237 ATGGAAAAGAGGTCCTGGGAAGG + Intergenic
1068946577 10:62735535-62735557 AAAGAGAGGAGGTCTGGGGGAGG + Intergenic
1069192218 10:65505714-65505736 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1069733243 10:70632926-70632948 ATGGCAAAAAGGTCGGGGGATGG + Intergenic
1069977982 10:72231121-72231143 ATGGAGAAATGGTCTGGAGGGGG - Intronic
1070346130 10:75543769-75543791 AGGGAGAGGAGGTGTAGGGAGGG - Intronic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070429129 10:76318543-76318565 ATGGAGAAGAGGTCAGAGTCTGG - Intronic
1071266988 10:83973348-83973370 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1071507919 10:86243883-86243905 ATGGTGGCGAGGACTGGGGAAGG - Intronic
1071692760 10:87839714-87839736 ATGGAGAAGATTACTGGGGGCGG - Intronic
1071782431 10:88861139-88861161 CTGGAGAAGAGATTTGGGGTAGG + Intergenic
1073142197 10:101255519-101255541 AAGGAGAAGAGGTTAGGGGCAGG - Intergenic
1073240935 10:102057505-102057527 GTGGAGAAGAGTTCTGTGGGCGG + Intergenic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073557440 10:104466549-104466571 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1073566558 10:104540284-104540306 CTGCAGGAGAGGTCTCGGGAAGG + Intergenic
1073656596 10:105423836-105423858 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1073774530 10:106771002-106771024 CTGAAGAAGAGGTCTGGATAAGG + Intronic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074403431 10:113161116-113161138 ATGGAGAAGGGTTCTGGGGTAGG + Intronic
1075226818 10:120637051-120637073 AAGGAAGAGGGGTCTGGGGATGG + Intergenic
1075279111 10:121123471-121123493 ATGGAGAAGAGGTGGGGGAGAGG + Intergenic
1075486094 10:122823063-122823085 GAGGACAAGAGCTCTGGGGATGG + Intergenic
1075522116 10:123149295-123149317 AGGGAGAGGAGGTCTGGAGGGGG - Intronic
1075634111 10:124018757-124018779 GGTGAGAAGGGGTCTGGGGAGGG + Intronic
1076152228 10:128171995-128172017 GGGGAGAAGAGGACAGGGGAGGG - Intergenic
1076441391 10:130483600-130483622 ATAGAGATGGGGTCTGGGCAGGG - Intergenic
1076789655 10:132770063-132770085 ATGTAGAACAGGGCTGGCGAGGG + Intronic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077529900 11:3090255-3090277 AAGGAGCAGAGGGCTGGGGCAGG + Intronic
1078376165 11:10794967-10794989 ATGGAGATGAGGGCTAGGCAGGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078764377 11:14280235-14280257 ATGAAAAAGAGATCTGGAGATGG - Intronic
1078877424 11:15412417-15412439 GTGGAGAAAGGATCTGGGGAAGG + Intergenic
1078995986 11:16700482-16700504 GTGGAGAATGAGTCTGGGGATGG - Intronic
1079121111 11:17685912-17685934 AAGTAGAGGAGGTCAGGGGAAGG - Intergenic
1079135668 11:17774889-17774911 AGGGAGAAGTGTTCTGGTGAGGG - Intronic
1079141355 11:17812129-17812151 ATGGAGAAGTGGGTTGGGGCTGG - Intronic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082999749 11:59280497-59280519 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
1083206446 11:61152491-61152513 GTGTAGAAGAGGGCTGGAGAGGG - Intronic
1083627302 11:64078285-64078307 CTGGAGAAGAGGCCAGGGCAGGG - Intronic
1083722194 11:64608930-64608952 ATGGGTGAGAGGTCTTGGGAGGG + Intronic
1084540390 11:69782626-69782648 ATGGACTCGAGGCCTGGGGAAGG + Intergenic
1084594065 11:70106781-70106803 GTGGAGGAGAGGAGTGGGGAAGG - Intronic
1084645417 11:70454423-70454445 ATGGAGGAGATTGCTGGGGATGG - Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085243395 11:75077138-75077160 GTGGAGAGGAGGTATGGAGAAGG - Intergenic
1085939758 11:81195195-81195217 ATGGAGATGGGGTCTGGAGGTGG + Intergenic
1086336850 11:85809770-85809792 AAGGAGAAGAGGTGTGGGGACGG - Intronic
1086493414 11:87378054-87378076 ATGGAGAGGAGAGCTGGAGAGGG + Intergenic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087819413 11:102694934-102694956 AGGGAGAAGAGGAATCGGGATGG + Intronic
1088097297 11:106115789-106115811 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088480590 11:110293266-110293288 ATGGAAAACAGGACTGGGAAAGG + Intronic
1088485934 11:110340463-110340485 ATGGATAAGAGGTTTGGGAATGG + Intergenic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1089543707 11:119206430-119206452 GTGAAGAAGAGCTCTGGGGCCGG + Exonic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090362656 11:126184321-126184343 AAGGAGTACAGTTCTGGGGAAGG - Intergenic
1090742241 11:129674948-129674970 ATACAGGAGAGGTCTGAGGATGG + Intergenic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1091218778 11:133918815-133918837 AGAGAGAAGAGGGCGGGGGACGG + Intronic
1091311836 11:134580441-134580463 CTGGAGCAGAGGTCTGTGGGTGG + Intergenic
1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG + Intronic
1091946094 12:4544452-4544474 ATGGAGAAGAGATGGGCGGAAGG + Intronic
1092029981 12:5275939-5275961 ATGCAGAAGGGGTTTGGGAAAGG - Intergenic
1092232227 12:6782644-6782666 CAAGAGAAGAGGGCTGGGGATGG - Intergenic
1092380980 12:7996904-7996926 CTGGAGAAGAGGTATGGGAACGG + Intergenic
1092762017 12:11818979-11819001 AGGCAGAAGAGCTCAGGGGAAGG - Intronic
1092959621 12:13583704-13583726 CAGGCAAAGAGGTCTGGGGAGGG + Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093049587 12:14490342-14490364 TTGGGGAAGAGCTCTGGGCATGG - Intronic
1093645809 12:21584303-21584325 TTGGGGAAGAGGTATGTGGATGG + Intronic
1093657749 12:21716575-21716597 ATGGAAAAGATGTCTGGAGAAGG + Intronic
1093779762 12:23121736-23121758 ACGGAGAAGAGGACAGGGGCAGG + Intergenic
1094237290 12:28183553-28183575 TTGGAGATGAGATCTGGGTAGGG - Intronic
1095791962 12:46177230-46177252 ATGGAAAACAGGGCTGGGGCTGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095947276 12:47760408-47760430 ATGGGGAAGAGTTAGGGGGATGG + Intronic
1096457374 12:51798816-51798838 TTGGGGAAGAGGTATGTGGATGG - Intronic
1096457790 12:51801717-51801739 CTGGAGAACAGGTATGGGAATGG - Intronic
1096582042 12:52591965-52591987 AGGGCGCAGAGGCCTGGGGAAGG - Intronic
1096582758 12:52598958-52598980 CTGGAGATGCTGTCTGGGGACGG - Exonic
1096774596 12:53956239-53956261 AAGGTGAAAGGGTCTGGGGAAGG + Intronic
1096997197 12:55846007-55846029 ATGGAGGAGAGGTGAGGGGAGGG + Intergenic
1097227912 12:57489570-57489592 CTTGAGATGAGGACTGGGGAAGG + Intronic
1097388492 12:58979820-58979842 ATTGAGCAGTGGTCTGGGAAGGG + Intergenic
1097564562 12:61251811-61251833 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1097719143 12:63001636-63001658 CAGGGTAAGAGGTCTGGGGATGG - Intergenic
1097843265 12:64342120-64342142 TTGGGGAAGAGGTATGTGGATGG - Intronic
1098385320 12:69912404-69912426 ATGAAAAAGAGTTCTGGAGATGG - Intronic
1098749929 12:74280228-74280250 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098832201 12:75376322-75376344 CTGGAGAACAGGTATGGGAATGG - Intronic
1099183297 12:79491971-79491993 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1100401217 12:94231819-94231841 AAGGAGAAGTGGTCAGGGCAGGG - Intronic
1101254138 12:102960930-102960952 ATGGAGACTAGGTCTGGGTGGGG + Intergenic
1101342902 12:103858944-103858966 TTGTAGAAGGGGTCTGGGTAGGG - Intergenic
1101761585 12:107663105-107663127 ATGGAGAAGAGGCCTGGCCAAGG - Intergenic
1102383139 12:112484409-112484431 ATGGAGAGGAGGTCAAGGAATGG + Intronic
1102730639 12:115105929-115105951 AAGGTGAAGAGGGCTGTGGATGG - Intergenic
1103035709 12:117654704-117654726 TTGGGGAAGAGGTATGTGGATGG + Intronic
1103359046 12:120342826-120342848 ATGGACCAGAGGGCTGGGGTGGG + Exonic
1103433614 12:120907589-120907611 AGGGAGAAGGGGTTTGGTGAAGG + Intergenic
1103515803 12:121507537-121507559 ATGTAGAGGAGGCCTGGGGTAGG - Intronic
1106542917 13:30705864-30705886 CTGGAGGAGAGGGCTGGGAAGGG + Intergenic
1106767866 13:32933372-32933394 CTGAGGAAGAGGTGTGGGGAAGG + Intergenic
1106925467 13:34608371-34608393 GGGGAGAAGAGGTGAGGGGAAGG + Intergenic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1109822715 13:67679561-67679583 AAGCAGAAAAGGACTGGGGAGGG - Intergenic
1110123175 13:71908350-71908372 ATGGTGCAGACATCTGGGGAGGG - Intergenic
1110377253 13:74807102-74807124 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1110833532 13:80058595-80058617 TTGTAGAAGAGGTGTGGGAAAGG + Intergenic
1110834051 13:80063997-80064019 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1111252142 13:85615595-85615617 AGGGGGTAGAGGACTGGGGAGGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111471242 13:88685053-88685075 ATGGAGCACATGTCTGGGAATGG - Intergenic
1111535285 13:89595805-89595827 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1112082108 13:95983020-95983042 AAGGAGAAGTGGCCTGGGTATGG - Intronic
1112249841 13:97769647-97769669 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1112615189 13:100997370-100997392 CAGGAGAGGAGGTCTGGGGTGGG - Intergenic
1112633609 13:101189248-101189270 TGGGAGAAGAGGTATAGGGAAGG + Intronic
1112854800 13:103754746-103754768 ATGCAAAATATGTCTGGGGAGGG - Intergenic
1112915181 13:104539487-104539509 GTGGAGGAGAGGTATGTGGAAGG + Intergenic
1113055328 13:106260833-106260855 CTGCAGAAGAGGCCTGGGGTGGG - Intergenic
1114265750 14:21071595-21071617 GGGGAGGAGGGGTCTGGGGAGGG - Intronic
1114419081 14:22565097-22565119 CTGGATAAGAGTTCTGGAGATGG - Exonic
1114496967 14:23139554-23139576 AGGGAGAGGAGGTGAGGGGAAGG + Intronic
1114711761 14:24785785-24785807 AGGGAGGAGTGGTTTGGGGATGG + Intergenic
1115864471 14:37728902-37728924 AGGGAGAAGAGAACTGGAGAAGG - Intronic
1115965434 14:38882144-38882166 ATGGAGAAGAGTTGAAGGGAAGG - Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116617019 14:47153181-47153203 CTGGAGAAGAGATTTGGGGGTGG + Intronic
1118122348 14:62859537-62859559 TTGGGGAAGAGGTATGTGGATGG - Intronic
1119220285 14:72900960-72900982 AGGGAGAAGGGGGCTGGGGCTGG - Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120555906 14:85929805-85929827 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1120832375 14:89008806-89008828 AAGGAGGAGAGGTATGGGAAAGG - Intergenic
1120868356 14:89315516-89315538 ATGGAGGAGAGTTCGGGGAAGGG - Intronic
1121260896 14:92565304-92565326 AGGTAGAGGGGGTCTGGGGAAGG + Intronic
1121577339 14:94998947-94998969 ACGGAGAATAGCTGTGGGGAGGG - Intergenic
1122576638 14:102747165-102747187 ATGGAGGAGAGGGGAGGGGAGGG - Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1123983012 15:25621074-25621096 AAGACGAAGAGTTCTGGGGATGG + Intergenic
1124042153 15:26115641-26115663 ATGGAGAAAAGTGCTGGGAAAGG - Intergenic
1124219848 15:27841269-27841291 ATGGAGAAGAGATTGGGGCAGGG + Intronic
1125029328 15:35060580-35060602 AAGGACAAGGTGTCTGGGGAAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125895465 15:43298268-43298290 CTGCAGAAGAGCACTGGGGATGG + Intronic
1126891726 15:53212800-53212822 ATAGAGCAGTGGTGTGGGGAAGG - Intergenic
1127477267 15:59346634-59346656 ATGGGGAAGATGGCTGGGCATGG + Intronic
1127932769 15:63607986-63608008 ATTGTGCAGAGGTCTGGGGAAGG - Intergenic
1127976849 15:64004100-64004122 ATGGAGGGGAGCTCTGGGAAGGG - Intronic
1128114192 15:65095074-65095096 CTGGAGAAGGGGTGTGGGGTAGG + Intronic
1128642893 15:69352857-69352879 TTGGGGAAGAGGTATGTGGATGG + Intronic
1128870406 15:71151054-71151076 ATGGAGAAAAGGGCTGGGCTGGG + Intronic
1128891403 15:71335013-71335035 ATGGAGCTCAGGTCTGGGGAGGG + Intronic
1128990680 15:72257336-72257358 CTGGAGCAGAGGTATGGGGGAGG - Exonic
1129325975 15:74800516-74800538 GTGGGCAAGAGGTCTGGGGTGGG - Intronic
1130114285 15:80992841-80992863 TAGGAGGAGAGGCCTGGGGATGG + Intergenic
1130567394 15:85008417-85008439 ATGGAGGAAGGGTCTGGTGAGGG - Intronic
1130898017 15:88185721-88185743 GGGGAGGAGATGTCTGGGGAAGG - Intronic
1131111037 15:89765654-89765676 AGGGAGAAGAGGGGAGGGGAGGG + Intronic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1132310337 15:100852926-100852948 ATGGGGGAGAGGGTTGGGGATGG - Intergenic
1132538705 16:497135-497157 ATAGAGCAGACATCTGGGGATGG - Intronic
1133272693 16:4618200-4618222 ATAGCGGAGAGGGCTGGGGAGGG + Intronic
1133482473 16:6184335-6184357 GTGGAGAATAGGTGTGGGAAAGG + Intronic
1134031432 16:10995541-10995563 ATGGAAGAGAGGGCAGGGGAGGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1136923631 16:34351229-34351251 GGGGGGAAGATGTCTGGGGAGGG - Intergenic
1136980942 16:35060577-35060599 GGGGGGAAGATGTCTGGGGAGGG + Intergenic
1137270424 16:46899425-46899447 CTGGGGCAGAGGGCTGGGGAGGG + Intronic
1137626904 16:49914816-49914838 CTGCAGAAGAGGTGGGGGGAGGG + Intergenic
1137750825 16:50859943-50859965 TTGGAAATGAGGTCTGGGGAAGG - Intergenic
1137980985 16:53069366-53069388 ATGAAAAAGAGTTCTGGAGATGG - Intronic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138868466 16:60851415-60851437 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1140152095 16:72377986-72378008 ATGAAGATGAGGTCAGGGAAGGG + Intergenic
1140447011 16:75037666-75037688 TTGGAGAGAAGGTCTGGGGTGGG - Intronic
1140787432 16:78356494-78356516 CTGGAGATGAGGTCTAGGGTAGG - Intronic
1140980256 16:80101990-80102012 AAATAGAAGAGGTGTGGGGAGGG - Intergenic
1141294202 16:82751510-82751532 ATGGACCAGAGCTCTGGGGCAGG + Intronic
1141335391 16:83150016-83150038 ATGTGGAAGAGGTTTGGGAAAGG - Intronic
1141483070 16:84319604-84319626 AGGGAGAAGGGGACTGGGGCAGG - Intronic
1142212198 16:88813482-88813504 CTGGAGGAGGGGCCTGGGGAGGG + Intergenic
1142520894 17:503846-503868 AAGGAGAGGAGAGCTGGGGAAGG + Intergenic
1143024703 17:3934811-3934833 ATGGAGGGGAGGGCTGGGCACGG - Intronic
1143112606 17:4560642-4560664 ATCCAGAACAGGTCTGGGCAGGG + Exonic
1143145893 17:4775150-4775172 AATGAGATGAGGTCTGAGGAGGG + Intronic
1143637481 17:8174433-8174455 ATGGAGGAAAGGGCTGGGTAGGG + Intronic
1143705275 17:8693434-8693456 ATGGAGGGGAGGTCTGGGCTAGG - Intergenic
1143860646 17:9888152-9888174 ATGGAAAAAAGGTGTCGGGATGG + Intronic
1143864259 17:9912439-9912461 ATGGACAAGAAGGCTGGGGCTGG - Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1143994808 17:10997229-10997251 CTGGGGCAGAGGGCTGGGGAAGG - Intergenic
1144305183 17:13963391-13963413 ATAGAGATGAGGTCTAGGGCAGG + Intergenic
1144563482 17:16341037-16341059 AAGGTGAAGAGTTCTGGAGATGG + Intronic
1144681680 17:17200151-17200173 CTGAAGATGAGGGCTGGGGAGGG - Intronic
1145278997 17:21454988-21455010 AAGGAGAAGAGGGGAGGGGAGGG - Intergenic
1145875684 17:28317178-28317200 TTGGAGATGAGGTCAAGGGAAGG - Intergenic
1146140651 17:30365126-30365148 ATAAAGAAGAGTTCTTGGGACGG - Intergenic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147898287 17:43766870-43766892 AAAGGGAACAGGTCTGGGGAGGG + Exonic
1147912317 17:43862970-43862992 CTGGAGAAGGGGTCGGGGGTGGG + Exonic
1148207722 17:45790030-45790052 AAGGAGAAGTGGTGAGGGGATGG + Intronic
1148322605 17:46766663-46766685 ATGGAGAAGAGCTCTGGCTGAGG - Intronic
1149314100 17:55422205-55422227 TTGGAGAAGAGATCGAGGGAGGG + Intergenic
1149684836 17:58529360-58529382 GAGGAGAAGAGGGGTGGGGAAGG - Intronic
1150487964 17:65557079-65557101 ATGGAGAAGAGATCTTGGCCCGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151037716 17:70820967-70820989 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1151372679 17:73658495-73658517 AAGGGGGATAGGTCTGGGGAGGG - Intergenic
1151584809 17:75002698-75002720 ATGAAGAAGAGGTGTGGGCAGGG + Intronic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1152080646 17:78185357-78185379 ATGGGGAAGAGGTCCAGGAATGG + Intronic
1152133581 17:78491558-78491580 GTGGAGAACAGGCCTGGGGGAGG + Exonic
1152191560 17:78891377-78891399 ATGGACCAGAGACCTGGGGAAGG - Exonic
1152240000 17:79156116-79156138 ACGGGGAAAAGGTCTTGGGAAGG + Intronic
1153427074 18:4976751-4976773 ATGGTGAAGAGGTCAGATGATGG - Intergenic
1154068169 18:11128845-11128867 CTGGAGAACAGGCCTGGGAATGG + Intronic
1154068551 18:11131727-11131749 TTGGGGAAGAGGTTTGTGGATGG + Intronic
1154145739 18:11865033-11865055 ATGGAAAAGAGCTTTGTGGAGGG - Intronic
1154330570 18:13425987-13426009 TGTGGGAAGAGGTCTGGGGACGG + Intronic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1155321723 18:24625596-24625618 AGGGAGAAGAGGGTTGGGAATGG + Intergenic
1155736131 18:29224633-29224655 ATGGAGAATATATCGGGGGAGGG - Intergenic
1156913494 18:42438823-42438845 ATGGTGATGAGGGCTGGGGAGGG - Intergenic
1156998664 18:43498358-43498380 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157341295 18:46780653-46780675 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157998414 18:52587496-52587518 TTGGGGAAGAGGTTTGTGGATGG - Intronic
1158437120 18:57441509-57441531 GTGGTGCAGAGGTCGGGGGAGGG - Intronic
1158647902 18:59264217-59264239 CTGGAGAAGCGGACTGGGCAAGG + Intergenic
1159559016 18:69974735-69974757 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1159902544 18:74061024-74061046 AGGGGGATGAGGTCTGAGGAGGG - Intergenic
1160526894 18:79543623-79543645 AGGGAGACCAGGCCTGGGGAGGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160972231 19:1774726-1774748 ATGGAGAAGGGGGCTGGAGGGGG + Intronic
1161300884 19:3542821-3542843 AGGAAGAAGTGGTCTGGGGCTGG - Intronic
1161500814 19:4614436-4614458 ATGGAGATGAGGACAGGGGGTGG + Intergenic
1162068961 19:8142429-8142451 AGGGAGGATAGGCCTGGGGAAGG - Intronic
1162298552 19:9829905-9829927 ATGGATGAGAGGGGTGGGGACGG + Intronic
1162749662 19:12821072-12821094 TTGGAGATGAGGTCTGGCTATGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164117171 19:22233943-22233965 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1164918829 19:32073270-32073292 ATGGAGAGTAGTCCTGGGGATGG - Intergenic
1165311631 19:35032038-35032060 TGGGAGAAAAGGTCTGGGGGTGG - Intronic
1165432477 19:35780662-35780684 ATGGATGGGAGGTGTGGGGAGGG + Intronic
1165835177 19:38750700-38750722 AGAGATAAGAGGTCTGGGCATGG - Intronic
1165844993 19:38812520-38812542 CTGGAGAAGAGGCCTGGTGAGGG + Intronic
1165893401 19:39127833-39127855 ATGGGGAGGAGGGCTGGGAATGG + Intronic
1166056510 19:40292826-40292848 ATTGAGAAGATTCCTGGGGAGGG - Intergenic
1166057907 19:40304396-40304418 ATTGAGAAGATTCCTGGGGAGGG - Intergenic
1166135677 19:40775742-40775764 ATGGAGATAGGGTCTAGGGAAGG - Exonic
1166188763 19:41160987-41161009 AGGGAGGAGAGGTAAGGGGAGGG + Intergenic
1166233039 19:41436805-41436827 AGGGAGCAGAGGAGTGGGGATGG + Intronic
1166381693 19:42358233-42358255 AGGGAGTAGAGCTCGGGGGATGG - Exonic
1166538462 19:43590965-43590987 GTGGGTAAGAGGTCTGGGCATGG - Exonic
1166557317 19:43709271-43709293 TTGGGGAAGGGGTTTGGGGAAGG - Intergenic
1166998570 19:46731629-46731651 ATGGAGTGGAGCTCTGGTGATGG - Intronic
1167311703 19:48740816-48740838 CGAGAGGAGAGGTCTGGGGATGG - Intergenic
1167466265 19:49652340-49652362 GGTGAGAAGCGGTCTGGGGATGG + Exonic
1167510851 19:49894753-49894775 ATGAAGAAGGGGCCTGGGGCTGG + Intronic
1167622177 19:50566526-50566548 GAGGTGAGGAGGTCTGGGGAAGG + Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1168075274 19:53978042-53978064 AGAGAGAAGGGGTTTGGGGAAGG + Intronic
1168405547 19:56108424-56108446 CTGGAGGAGAGCTCTGGGCAGGG - Intronic
1168433505 19:56300122-56300144 GTGGAGAAGAGCTCTGGGTTTGG - Intronic
925460808 2:4061075-4061097 TTGGGGAAGAGGTATGTGGATGG + Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
927506111 2:23615919-23615941 AAGCAGAGGGGGTCTGGGGAGGG - Intronic
927683310 2:25154363-25154385 AAGGAGATGGGGTCTGAGGAGGG + Exonic
927867213 2:26597805-26597827 GTGGAAATGAGGCCTGGGGAAGG + Intronic
928271388 2:29858434-29858456 ATGGACAAAAGGTCTGAGGCCGG + Intronic
929007916 2:37413583-37413605 CCTGGGAAGAGGTCTGGGGATGG + Intergenic
929076852 2:38085333-38085355 ACGGAGAAGAGGTTGGGGCACGG + Intronic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930725334 2:54676146-54676168 ATGGAGATGAGGCAGGGGGAAGG - Intergenic
930809527 2:55525998-55526020 ATGATGGAGTGGTCTGGGGAGGG - Intronic
932820428 2:74895122-74895144 TTGGAGGAGGGGTCTGGTGAGGG + Intergenic
933113299 2:78432130-78432152 CTGGAGAACTGGTCTGGGGAAGG + Intergenic
933394386 2:81712725-81712747 TTGGGGAAGAGGTATGTGGATGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933794797 2:85911012-85911034 ATTGTGAAGAGGTCTGGAGAGGG + Intergenic
934050577 2:88207189-88207211 TTGGAGAAAAGGTTTGTGGATGG + Intergenic
934902698 2:98173176-98173198 CTGCAGAAGAGATCTGGGGCAGG + Intronic
935044896 2:99472425-99472447 AAGGTGAAGAGTTCTGGAGATGG + Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
936498905 2:113050501-113050523 AACGAGAAGAGTTCTGGAGATGG + Intronic
936513085 2:113164326-113164348 AGGATGAAGAGGACTGGGGAAGG + Intronic
936933267 2:117812270-117812292 CTTGGGAAGGGGTCTGGGGATGG - Intergenic
937648839 2:124297713-124297735 ATGGAGACTACGTCTGGTGATGG - Intronic
937785115 2:125887097-125887119 TTGGGGAAGAGGTATGTGGATGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937852481 2:126648107-126648129 TTGGGGAAGAGGTATGTGGATGG - Intergenic
938079182 2:128360204-128360226 AGGGAGAAGATGTCTGGCCAGGG - Intergenic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
940911181 2:159211461-159211483 AAGGAAAAGAGGGCAGGGGAGGG - Intronic
942626993 2:177912073-177912095 ATGGATCAGAGATGTGGGGAGGG + Intronic
942813734 2:180026724-180026746 TTGGAGGAGGGGTCTGGGGGAGG - Intergenic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943383983 2:187180462-187180484 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943392202 2:187284095-187284117 CTGGAGAACAGGCATGGGGATGG - Intergenic
943517510 2:188906627-188906649 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943713519 2:191124671-191124693 ATGGAGATTAGGTTTAGGGAGGG - Intronic
943833528 2:192490516-192490538 TTGGGGAAGAGGTATGTGGATGG - Intergenic
944681680 2:202083377-202083399 CTGGAGTAGAGGTCGGGGCAGGG - Intronic
945146427 2:206743043-206743065 CTGGAGAACAGGTATGGGAATGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946703676 2:222437165-222437187 TTGGGGAAGAGGTATGTGGATGG - Intronic
946896311 2:224327953-224327975 GTGGAGAAGATGTCTGAGTAAGG - Intergenic
946904860 2:224406342-224406364 TTGGAGAAAAGGTGTGGAGAAGG + Intergenic
947506922 2:230714048-230714070 TTGCAGAAGAGGTGTGTGGAAGG + Intronic
947846699 2:233250606-233250628 ATGGAGAAGAGAACTGGAAACGG - Intronic
947942452 2:234070154-234070176 ATTGAGGAGAAGTCTTGGGAAGG - Intronic
948102014 2:235382795-235382817 ATGGTGAAGAGGTCTGAGGCGGG - Intergenic
948359762 2:237412001-237412023 GTGGAGCAGAGGGCTTGGGAAGG - Intronic
948493282 2:238327679-238327701 AAGGAGAAGAGTCCTGGAGATGG - Intronic
948607725 2:239146729-239146751 GTGGAGCAGAGGCCTGTGGAAGG - Intronic
948964538 2:241367277-241367299 ATGCAGCAGTGTTCTGGGGAGGG + Intronic
1168947169 20:1770740-1770762 GTGGAGAAGAGGGCAGGGTAAGG + Intergenic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169712806 20:8583251-8583273 AGTGAAAAGAGTTCTGGGGATGG + Intronic
1170306476 20:14944231-14944253 AGGGAGAGGAGGGCTGGGGAAGG + Intronic
1170322394 20:15114616-15114638 ATGGATCAGAAGTCTGGGCATGG - Intronic
1170647340 20:18209251-18209273 GTGGAGAATGGGTGTGGGGAAGG - Intergenic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1172901215 20:38336266-38336288 GAAGAGAAGAGGCCTGGGGAGGG - Intronic
1173058058 20:39635648-39635670 CTGGAAAGAAGGTCTGGGGAAGG - Intergenic
1173566250 20:44040448-44040470 ATGGAGAAGTGTCTTGGGGAAGG + Intronic
1174408424 20:50318025-50318047 AGGGAGAGGAGGTATGGGCAGGG + Intergenic
1175170219 20:57074920-57074942 ATGCAGAAGAGACCTGGGGACGG + Intergenic
1175373446 20:58508555-58508577 ATGGAGCAGAGGACTGGCGGAGG + Intronic
1175406029 20:58729340-58729362 ATGGAAAAGAGTTCTGTGGTTGG + Intergenic
1175573313 20:60040488-60040510 ATGGTGAAGAAGTCTATGGAAGG + Intergenic
1177918343 21:27119560-27119582 ATGGAGTAGAGGTGTGGTGAGGG + Intergenic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178290201 21:31361034-31361056 ATGGACATGAGTGCTGGGGAAGG + Intronic
1178370062 21:32020179-32020201 ATGGAAAAAAGGTCTGGAGATGG - Intronic
1178604806 21:34026488-34026510 ATAGAGGAGAGGGCTGGGCATGG - Intergenic
1178692599 21:34761825-34761847 ATGGAGACAAGGTCTGCAGAAGG - Intergenic
1179557390 21:42188527-42188549 AGGGAGAAGGGGGCTGGGCAAGG + Intergenic
1179579484 21:42331893-42331915 ATGGAGAAGTGATAAGGGGAAGG + Intergenic
1179839246 21:44060052-44060074 AGGGAGATGAAGTGTGGGGACGG + Intronic
1179904446 21:44415067-44415089 ATGGATCGGAGCTCTGGGGAAGG - Intronic
1180051795 21:45335078-45335100 AGGGGGCACAGGTCTGGGGAGGG - Intergenic
1180051834 21:45335172-45335194 AGGGGGCACAGGTCTGGGGAGGG - Intergenic
1180051851 21:45335210-45335232 AGGGGGCACAGGTCTGGGGAGGG - Intergenic
1180051966 21:45335491-45335513 AGGGGGCACAGGTCTGGGGAGGG - Intergenic
1180051974 21:45335510-45335532 AGGGGGCACAGGTCTGGGGAGGG - Intergenic
1180702360 22:17788519-17788541 TTCGAGGAGAGGTCTGGGAAAGG + Exonic
1180963301 22:19772604-19772626 TTTGAGAAGAGGGCTGGGCACGG - Intronic
1181039578 22:20185525-20185547 ATGGGGCAGAGCTTTGGGGAGGG - Intergenic
1181400284 22:22646884-22646906 ATGGGGTGGAGGTCTGGGGATGG + Intronic
1182440736 22:30362441-30362463 ATCTAGAAGAAGTGTGGGGAAGG + Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182487303 22:30647105-30647127 ATGGAGAACAGGGCTGGGCATGG + Exonic
1182965669 22:34519099-34519121 CTGGAGAACAGGTATGGGAATGG - Intergenic
1183253062 22:36743980-36744002 AAGGGGAAGGGGTTTGGGGAGGG - Intergenic
1183306723 22:37086720-37086742 AGGGTGGAGGGGTCTGGGGAGGG - Intronic
1183313540 22:37124748-37124770 AAGGAGGAGAGGTGGGGGGAGGG - Intergenic
1183733257 22:39629914-39629936 AGGGAGACGTGATCTGGGGAAGG - Intronic
1185080100 22:48704948-48704970 ATGGTGCAGGGGGCTGGGGAGGG + Intronic
1185220527 22:49627225-49627247 ATGGAGCATGGGTCTGTGGATGG - Intronic
949090413 3:21309-21331 ATGGAGATAAGGTCAGGGAAAGG + Intergenic
949245961 3:1925554-1925576 TTGGGGAAGAGGTATGTGGATGG + Intergenic
949417954 3:3833482-3833504 CTGGAGAACAGGTTTGGGAATGG - Intronic
950260224 3:11537986-11538008 ATGTAGAAGAGGCCAGGGAAAGG + Intronic
950694857 3:14690960-14690982 ATGGAGGTGAGGGCTGAGGAAGG - Intronic
950979438 3:17286789-17286811 ATGGAAAGGTGGTCTGAGGATGG + Intronic
951291434 3:20876114-20876136 TTGGGGAAGAGGTATGTGGATGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951384609 3:22028148-22028170 TTGGGGAAGAGGTATGTGGATGG + Intronic
951970677 3:28441259-28441281 TTGGGGAAGAGGTATGTGGATGG - Intronic
952073072 3:29662717-29662739 ATGGAGAAGAAATCTGTAGAAGG - Intronic
952770978 3:37000134-37000156 ATAGAGAAGAGGTCCAAGGAAGG + Intronic
952871249 3:37903171-37903193 ATGGAGGAGAGGACTTGGGAAGG + Intronic
953538551 3:43794255-43794277 CTGGATGACAGGTCTGGGGAAGG - Intergenic
954054247 3:48008587-48008609 TTGGGGAAGAGGTATGTGGATGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
955898587 3:63727143-63727165 CTGGAGAAGAGCTCTGGAGCTGG + Intergenic
955932772 3:64074401-64074423 ATGGAGTAGAGGTGAGGGAAGGG + Intergenic
956289394 3:67646078-67646100 ATGGAGGGGAGGGCAGGGGAGGG + Intronic
956510270 3:69985658-69985680 AGGGAGAAGGGATGTGGGGAGGG + Intergenic
956718140 3:72096305-72096327 ATGGAAAAGATATGTGGGGAGGG - Intergenic
957030309 3:75233070-75233092 ATGGAGATAAGGTCAGGGAAAGG + Intergenic
957247482 3:77733266-77733288 TTGGGGAAGAGGTATGTGGATGG - Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959166544 3:102786816-102786838 ATGGAGAATAGCACTGGAGAGGG - Intergenic
959237768 3:103746503-103746525 TTGGAGAAGAGGTATGTAGATGG - Intergenic
959927215 3:111936410-111936432 ATGAATAAGAAGTCTGGGAATGG - Intronic
960150759 3:114246466-114246488 TTGGAGGAGGGGTCTGGGGGAGG + Intergenic
960188783 3:114677559-114677581 ATGGACTGGAGGTGTGGGGATGG - Intronic
960305184 3:116051818-116051840 ATGGTGCAGGGGGCTGGGGAGGG + Intronic
960696625 3:120402702-120402724 ATGGAGAAGAGGGCGGTGGCTGG - Intronic
961684593 3:128620832-128620854 ATGGAGATGAGGCCCAGGGATGG - Intronic
962060961 3:131926906-131926928 AAGGAGTAGGGGTCTGAGGATGG + Intronic
962752316 3:138442553-138442575 ATGGACAAGAGTCCTGGGGGTGG - Intronic
962976539 3:140451000-140451022 ATGGAGGAGAGGACTGGAGGTGG - Intronic
963035225 3:141019861-141019883 ATGTACAAGGGGCCTGGGGAGGG + Intergenic
964580760 3:158234665-158234687 AGGGAGAAGAGGATTGGGGAGGG - Intronic
964679148 3:159318285-159318307 TTGGGGAAGAGGTATGTGGATGG - Intronic
965586688 3:170325225-170325247 GTGGAGGAGAGGTATGGGGGTGG + Intergenic
965602788 3:170471387-170471409 GTAGAGAAGGGGTCAGGGGAGGG - Intronic
965879551 3:173372033-173372055 ATGCAGAAGAGGTCAGCAGATGG + Intergenic
966488125 3:180494027-180494049 GTGGAGAAGTGGTTAGGGGAAGG - Intergenic
966815430 3:183886102-183886124 TTGGAGTGGAGGTCTGGGAAAGG - Intergenic
967615060 3:191554986-191555008 CTGGAGATGAAGTTTGGGGAGGG - Intergenic
968422935 4:500142-500164 ATGGTGAAGAGTACTGGGGTAGG - Intronic
968467184 4:758581-758603 ATGGAGAAGAACTCGGGGGAGGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968907094 4:3459042-3459064 TTGGGGAAGAGGTATGTGGATGG + Intergenic
968945650 4:3662184-3662206 CTGGAGAAGAGGTCGCGGGCAGG + Intergenic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
969343638 4:6557951-6557973 GAGGAGGAGAGGTCTGGGGTGGG - Intronic
969748862 4:9095275-9095297 AGAGATAAGAGGTCTGGGCATGG - Intergenic
969937301 4:10695034-10695056 ATGGAGGAGTGGACTGGGAAAGG + Intergenic
970114707 4:12681769-12681791 ATGGCCAAGAGGTTTGGGGGAGG - Intergenic
970318578 4:14853435-14853457 ATGGAAAAAAGGTGTGGGGAAGG - Intergenic
971642132 4:29147726-29147748 ATGGAGGAGAGGATTGGAGATGG - Intergenic
971713288 4:30144790-30144812 ATAGAGAAGAGGGCCGGGCATGG + Intergenic
973130101 4:46639068-46639090 TTGGGGAAGAGGTATGTGGATGG - Intergenic
974289650 4:59913372-59913394 TTGGGGAAGAGGTATGTGGATGG + Intergenic
974465654 4:62252076-62252098 TTGTAGAAGAGGTCTATGGAAGG + Intergenic
974746825 4:66088275-66088297 TTGGGGAAGAGGTATGTGGATGG - Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975629289 4:76383353-76383375 ATGGTGAGGGGGTCTGTGGATGG - Intronic
975733997 4:77364313-77364335 CTGGAGAACAGGCATGGGGATGG - Intronic
975949997 4:79758883-79758905 ATGGTGAAGAGGACTGGAAAGGG - Intergenic
976034124 4:80795192-80795214 TTGGAGAATAGGTATGTGGATGG - Intronic
976355378 4:84110986-84111008 ATGGAAAAGAGGTAGTGGGAGGG - Intergenic
976863423 4:89694265-89694287 ATGGAGGAGGAGTTTGGGGAGGG - Intergenic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977224174 4:94374814-94374836 TGGGAGAAGAGGGCTGGGCATGG - Intergenic
977833143 4:101617208-101617230 TTGGGGAAGAGGTATGTGGATGG - Intronic
978341495 4:107724919-107724941 TTGGGGAAGAGGTATGTGGATGG - Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978847294 4:113288816-113288838 GAGGAGAAGGGGTCAGGGGAGGG - Intronic
979011426 4:115375418-115375440 CTGGAGAACAGGTCTTTGGAAGG + Intergenic
979898329 4:126188438-126188460 TTGGGGAAGAGGTATGTGGATGG - Intergenic
980888964 4:138793783-138793805 AAGGAGAAGAGGGGAGGGGAAGG + Intergenic
981017091 4:139985347-139985369 ATGGAGCAGAGTTCTGGAGGAGG + Intronic
981417080 4:144505898-144505920 TTGGAGAGGATATCTGGGGAAGG + Intergenic
981966830 4:150613958-150613980 ATGGACACGAGGTCAGAGGAAGG - Intronic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
982308655 4:153960661-153960683 AAGGATAAGAGGTCTAGAGAGGG + Intergenic
982597686 4:157406415-157406437 TTGGGGAAGAGGTATGTGGATGG - Intergenic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
983185152 4:164692203-164692225 TTGGGGAAGAGGTATGTGGAAGG + Intergenic
983617166 4:169720166-169720188 ATGGAGGAGTTGTTTGGGGAGGG + Exonic
983939461 4:173525137-173525159 ATGGGGAGGAGGTGTGGGGGAGG - Intronic
984628951 4:182040011-182040033 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984628982 4:182040086-182040108 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629022 4:182040186-182040208 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629033 4:182040211-182040233 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
985117435 4:186605552-186605574 ATGGAGAAGAGGTGGAGGGAGGG + Intronic
985559897 5:579807-579829 ATCAAGAAGAGGGCTGTGGAGGG - Intergenic
986087193 5:4463347-4463369 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
986261542 5:6151893-6151915 TTGGGGAAGAGGTATGTGGATGG - Intergenic
986531315 5:8739697-8739719 TTGGAGAAGAGGTATGTGAATGG - Intergenic
986743038 5:10720389-10720411 TTGGGGAAGAGGTATGTGGATGG + Intronic
986814573 5:11394398-11394420 AAGAAGAAGGGGTCTGTGGAGGG + Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987468059 5:18296015-18296037 TTGGGGAAGAGGTATGTGGATGG - Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987726472 5:21707039-21707061 AAGGAGACGAGGTTCGGGGAAGG - Intergenic
988079743 5:26400797-26400819 TTGGAGAAGAGGTATGTGTATGG - Intergenic
988107837 5:26773175-26773197 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988188869 5:27901871-27901893 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988267781 5:28973650-28973672 CTGGAGAACAGGCCTGGGAATGG - Intergenic
989045118 5:37266961-37266983 TTGGGGAAGAGGTATGCGGATGG - Intergenic
989467883 5:41778438-41778460 AGAGAGAAGAGGTCTGGAGATGG + Intronic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
990503646 5:56423148-56423170 ATGGAGAAGTGAGCTGGTGAAGG - Intergenic
990567761 5:57046994-57047016 GGGGAGAAGAGGTGAGGGGAAGG - Intergenic
991005096 5:61821081-61821103 AAGGAGAAGAGGTGTTTGGAGGG + Intergenic
991013709 5:61910258-61910280 TTGGGGAAGAGGTTTGTGGATGG - Intergenic
991330653 5:65489054-65489076 TTGGGGAAGAGGTATGTGGATGG - Intergenic
991500110 5:67268454-67268476 AGAGAGAACAGGACTGGGGAAGG - Intergenic
991540310 5:67720479-67720501 AGGGAGAAGAGGAGAGGGGAGGG - Intergenic
991691409 5:69228722-69228744 ATTGATAAGAGGGCTGGGCATGG + Intronic
992080432 5:73231010-73231032 ATTGAGAAGGGGGCTGGGGCGGG - Intergenic
992242579 5:74787152-74787174 CTGGAGAACAGGTGTGGGAACGG + Intronic
992243040 5:74790482-74790504 TTGGGGAAGAGGTATGTGGATGG + Intronic
992379570 5:76223916-76223938 ATGGGGAAGTGGTGGGGGGATGG + Intronic
992409278 5:76489418-76489440 ATGTAGAAGAGGTCAGGGATGGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992425183 5:76649758-76649780 ATGGAGGAGAAGTGTGGGGTTGG - Intronic
992495755 5:77291502-77291524 ATGAAGAAGAGGTCTTTGCATGG + Intronic
992883202 5:81130990-81131012 ATGGAGATGGGGTCAAGGGAAGG - Intronic
993317540 5:86429594-86429616 TAAGAGAAGTGGTCTGGGGATGG - Intergenic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
993791865 5:92219538-92219560 TTGGAGAAGAGTTATGTGGATGG + Intergenic
994223800 5:97228633-97228655 ATGGAGGAGAGGACAGGAGAGGG + Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994958170 5:106562034-106562056 CTGGAGAAGAGGCATGGGAATGG + Intergenic
996018646 5:118568490-118568512 TTGGGGAAGAGGTATGTGGATGG + Intergenic
996140067 5:119895979-119896001 AGGCAAAAGAAGTCTGGGGAAGG - Intergenic
996383508 5:122885820-122885842 ATGGACAGGTGGTCGGGGGAGGG + Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996711756 5:126550270-126550292 ATGAAGAAGAGGTCTTTGCATGG - Exonic
996825261 5:127675522-127675544 ATGGAGAACAGGCATGGGAATGG + Intergenic
996825652 5:127678470-127678492 TTGGGGAAGAGGTATGTGGATGG + Intergenic
997167257 5:131674422-131674444 ATGGAGAATAGGGCTGGGCATGG + Intronic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998055104 5:139068359-139068381 AAGGACAAGAAGTCTGGGGTAGG + Intronic
999100835 5:149024746-149024768 GTGGAGAGGAGGTCAGGGGTGGG - Intronic
999679670 5:154045056-154045078 AAGGACAAGAGGGATGGGGAAGG - Intronic
1000223589 5:159236899-159236921 CTGGAGAACAGGTATCGGGATGG - Intergenic
1000288232 5:159846374-159846396 AGGGAAGAGAGGTCTGGGGCAGG - Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1000932708 5:167271195-167271217 ATGGTGAGGAGGAGTGGGGAGGG + Intergenic
1001210968 5:169809910-169809932 ATGGAGAAGAGGATTAGAGAAGG - Intronic
1001233772 5:170012583-170012605 GTGGAGAGGAGGTATGGGCAGGG + Intronic
1001529707 5:172453753-172453775 ATGGAGGAGATCTCTGGGAATGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001927235 5:175647221-175647243 AAGGAGAAGAGTACTGGGAATGG - Intergenic
1001933885 5:175691255-175691277 CTGGAGAGGAAGTCAGGGGAAGG + Intergenic
1002895144 6:1374694-1374716 AGAGAGAAGTGGTATGGGGACGG - Intergenic
1002912698 6:1502420-1502442 ATGGAGCAGAGGTACAGGGATGG + Intergenic
1003594200 6:7460067-7460089 TTGGAGATGAGATCTTGGGAGGG + Intergenic
1003619461 6:7685188-7685210 CTGGAGAAGAAGCCTTGGGATGG + Intergenic
1003758698 6:9150709-9150731 TTGGGGAAGAGGTATGTGGAGGG + Intergenic
1003791317 6:9550676-9550698 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1004223393 6:13766031-13766053 AGGAAGAAGATGTCTGAGGAGGG + Intergenic
1004884173 6:20036065-20036087 ATAGGGTAGAGGTGTGGGGAAGG + Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1004955791 6:20726295-20726317 ATGGAGAACAGGTGGGGGGAGGG - Intronic
1004998461 6:21216765-21216787 CTGGAGATGAGGGTTGGGGAAGG - Intronic
1005185259 6:23157694-23157716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1005207926 6:23426368-23426390 GTGGAGGTGAGGGCTGGGGAAGG - Intergenic
1005401551 6:25439328-25439350 TTGGAGGAGAGGTCTGGAGTTGG + Intronic
1005622761 6:27635289-27635311 CTGGAGAACAGGCATGGGGATGG - Intergenic
1005652936 6:27901368-27901390 GTCGATAACAGGTCTGGGGATGG + Intergenic
1005952475 6:30642078-30642100 AGGGAGCAGAGGTTTGGGGTTGG + Intronic
1006062434 6:31433842-31433864 TTGGGGAAGAGGTTTGTGGATGG + Intergenic
1006252357 6:32798426-32798448 ATGAAGCAGAGGGCTAGGGATGG + Intergenic
1006339003 6:33435702-33435724 AAGGAGGAGAGGCTTGGGGAAGG + Intronic
1006385209 6:33726933-33726955 TCAGAGCAGAGGTCTGGGGAAGG + Intronic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1006941213 6:37753510-37753532 CTGGAGCAGAGGTCTGAAGAAGG + Intergenic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007657822 6:43462815-43462837 AAAGACAAGAGGTCTGAGGATGG - Intergenic
1007772487 6:44202658-44202680 TTGGAGAAAATGTCTGGGGCAGG + Intergenic
1007941250 6:45783462-45783484 ATTGAGAAGAGTCCTGGAGAAGG - Intergenic
1008321365 6:50118310-50118332 ATAGAGAAAAGGTTGGGGGAAGG - Intergenic
1009660602 6:66606300-66606322 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1010448844 6:75979355-75979377 ATGGAAAAGGGGTGTGGAGAGGG + Intronic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012263818 6:97117452-97117474 ATGGGGGAGAGGTGTGGAGAGGG - Intronic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012452395 6:99366405-99366427 CTGAAGAAGAGGTCAGGGCATGG + Intergenic
1013174893 6:107668763-107668785 ATGGAGGAGAGGTGAGGAGAGGG - Intergenic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1013899385 6:115135003-115135025 ATGAAGTAGGTGTCTGGGGATGG - Intergenic
1014363317 6:120507723-120507745 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1014631728 6:123797430-123797452 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1016119841 6:140332063-140332085 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1016419528 6:143870040-143870062 TTGGGGAAGAGGTATGTGGATGG - Intronic
1016455830 6:144229893-144229915 ATGGAGAATAGATCGGGGGAGGG - Intergenic
1016581095 6:145629967-145629989 CCAGAGAACAGGTCTGGGGAAGG - Intronic
1017227718 6:152040462-152040484 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1017534623 6:155333540-155333562 ATGTGGAAAAGGTCAGGGGAAGG + Intergenic
1017731175 6:157317494-157317516 AAAGAGAAGAGGTCTGAGGAAGG - Intronic
1017867585 6:158457328-158457350 ATGCAGAAGAGGCCTGGGCAGGG - Intronic
1018041844 6:159931477-159931499 ATGAAAAAGAGTTCTGGAGATGG + Intergenic
1018072152 6:160174260-160174282 ACGGGGAAGAGGTGTGGGGTGGG + Intronic
1018107635 6:160504101-160504123 ATGGAGAACAGGCATGGGAATGG - Intergenic
1018183376 6:161243711-161243733 AGGGAGAAGGGGTCAAGGGAAGG - Intronic
1018599978 6:165528166-165528188 TTGGGGAAGAGGTATGTGGATGG + Intronic
1018902446 6:168058386-168058408 AGAGAGAAGAGGGCTGGGCACGG - Intronic
1018902455 6:168058421-168058443 AGAGAGAAGAGGGCTGGGCACGG - Intronic
1019205845 6:170360895-170360917 GTGGAGATGTGGTTTGGGGAAGG + Intronic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019535328 7:1526293-1526315 AAGGAGAAGAGGGGAGGGGAGGG + Intergenic
1019779298 7:2930111-2930133 AAGGAGAAGGGGGCCGGGGAGGG + Intronic
1020606701 7:10346970-10346992 AAGGAGAAGAGGATTGGGAATGG + Intergenic
1021957466 7:25840344-25840366 CTGGAGAAGAGGTGTGAGGGAGG - Intergenic
1022529871 7:31060094-31060116 ATGAAGCAGAGGGCTGGGGGTGG + Intronic
1023904335 7:44511857-44511879 ATGGACAGGAGGTTTGGTGAAGG - Intergenic
1023910908 7:44555795-44555817 AGGCAGAAGAGGGCTGGGGGTGG + Intergenic
1024442211 7:49433442-49433464 AAGGACCAGAGGTCTGGAGATGG - Intergenic
1024999469 7:55302927-55302949 ATGCAGAAGAGGTGAGGGGTAGG + Intergenic
1026262491 7:68767079-68767101 ATGGAGAAAAGGGCCGGGCACGG - Intergenic
1026945724 7:74314802-74314824 GTGGGGAAGAGGCCTGGGGGTGG + Intronic
1027056460 7:75053087-75053109 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027056477 7:75053132-75053154 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027056494 7:75053177-75053199 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027056510 7:75053222-75053244 ATGGAGTTGGGGTCTGGGGGTGG + Intronic
1027056526 7:75053267-75053289 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027198010 7:76044529-76044551 GTGGAGATGAGGACTTGGGAGGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027685888 7:81278586-81278608 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028278812 7:88894823-88894845 ATAGATCAGAGGTTTGGGGAGGG + Intronic
1028396326 7:90372604-90372626 ATGGAAAATATGGCTGGGGAGGG - Intronic
1028474048 7:91234469-91234491 ATGGAGAAGGCGTCTGCAGAAGG - Intergenic
1028935103 7:96455694-96455716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1029578360 7:101419099-101419121 AGGGAGAAGAGGGGAGGGGAGGG - Intronic
1030106143 7:105989214-105989236 GTGGAGAAGAGGTGGGGGGGTGG - Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030403405 7:109081046-109081068 AGGAAGAAGAGGTGTGAGGAGGG + Intergenic
1031739430 7:125410717-125410739 ATGGAAAGGAGCTCTGGAGAGGG + Intergenic
1031925779 7:127636888-127636910 CTGGAGGAGAGGTCTGGGCTGGG + Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032502750 7:132412259-132412281 ATGGAGCTGAGGTCTGGAGGGGG - Intronic
1033045872 7:137961827-137961849 ATGGAGGAAAGGCCTGGGGTAGG - Intronic
1033076346 7:138253675-138253697 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1033345964 7:140525953-140525975 ATGAAGAGCAGGGCTGGGGAGGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034298573 7:149995396-149995418 AGGGAGAGGAGGACAGGGGAAGG + Intergenic
1034313269 7:150108853-150108875 ATGGAGAGTAGTTGTGGGGAAGG + Intergenic
1034782610 7:153894668-153894690 CTGGGGAAGAGGTCGGGGGCAGG - Intronic
1034793592 7:153991815-153991837 ATGGAGAGTAGTTGTGGGGAAGG - Intronic
1034807441 7:154101382-154101404 AGGGAGAGGAGGACAGGGGAAGG - Intronic
1034835708 7:154350174-154350196 ATGGACATGTGGTCTGGGGCTGG + Intronic
1035343001 7:158176539-158176561 ATGGAGCACAGGTCTGGGTGTGG + Intronic
1035757445 8:2044768-2044790 ATGGAGGAGAGTTGCGGGGAGGG + Intergenic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1035766856 8:2113392-2113414 AGTGAGCAGAGGTGTGGGGAAGG + Intronic
1036069470 8:5424782-5424804 ATGGATAAGAAGTTTGGGCAGGG + Intergenic
1036076533 8:5508360-5508382 ATGGGGAAGAGGTCTGATAAAGG - Intergenic
1036738158 8:11338019-11338041 AAGGAGAACATGTCTGGGAATGG + Intergenic
1036795468 8:11753363-11753385 GACGAGAAGAGTTCTGGGGATGG + Intronic
1037029047 8:14079156-14079178 AGGGAGGGGAGGGCTGGGGAGGG + Intergenic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037586874 8:20283055-20283077 CTTGAGAAGAGCTCTGGAGAAGG + Intronic
1037620129 8:20556195-20556217 ATGGAGAAGAGGTCAGGTACAGG - Intergenic
1037620140 8:20556264-20556286 ATGGAGAAGAGGTCAGGTACAGG - Intergenic
1037620151 8:20556333-20556355 ATGGAGAAGAGGTCAGGTACAGG - Intergenic
1037620163 8:20556402-20556424 ATGGAGAAGAGGTCAGGTACAGG - Intergenic
1037992593 8:23331316-23331338 AGGGAGAAGGGCTCTGGGGTGGG - Intronic
1038348801 8:26757515-26757537 ATGGAGCAGAGGTGGGGGGTGGG - Intronic
1038454367 8:27663008-27663030 TTAGGGAAGAGGTCTGTGGACGG - Intronic
1038646887 8:29369434-29369456 CTGGAGAAGAGGTGTTGGGGAGG + Intergenic
1038876793 8:31559076-31559098 ATGCAGCAGTGCTCTGGGGAGGG - Intergenic
1039037757 8:33378221-33378243 ATGAGGAAAAGGTCTGGGGAGGG - Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039498413 8:37998490-37998512 AGGGAGAGGAGGTTTGGGGTCGG - Intergenic
1040013688 8:42683037-42683059 AAGATGAAGAGGTCTGGAGATGG + Intergenic
1040607658 8:48950759-48950781 GTGGAGAAAAGGTCTGGGATGGG - Intergenic
1040938552 8:52808122-52808144 ATGCTTAGGAGGTCTGGGGAGGG - Intergenic
1041904929 8:63021962-63021984 ATGGATATGAGGTCTGGGCATGG - Intronic
1041985889 8:63922181-63922203 ATGGAGAACAGGTATGGGAATGG + Intergenic
1041986269 8:63925098-63925120 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1042092436 8:65173196-65173218 AAGGAGAAGAGATCTGGAGAGGG + Intergenic
1042193270 8:66209623-66209645 ATGGAGTAGAGGTTTGCAGATGG + Intergenic
1043243489 8:77967407-77967429 ATGGAAAAGAGGTGGGAGGAGGG + Intergenic
1043667535 8:82835546-82835568 AGTGAAAAGAGGTCTGGGGAAGG - Intergenic
1044150512 8:88770825-88770847 ATGGAGAACAGGCATGGGAATGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044487073 8:92766553-92766575 TTGCAGAAGAGGTATGTGGATGG - Intergenic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1045000572 8:97874703-97874725 AAGTAGAAGAGGTCAGGGCATGG - Intronic
1045242283 8:100413112-100413134 ATGGTGAAGAGCTTTGGGGCAGG - Intergenic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1045578628 8:103453674-103453696 ACAGAGAAGAGGGCTGGGAATGG - Intergenic
1047228925 8:122979589-122979611 TGGGTGATGAGGTCTGGGGAAGG - Intergenic
1047381711 8:124371499-124371521 AGGGACAGGAGGGCTGGGGAGGG + Intronic
1047399917 8:124537769-124537791 CTGGAGTAGGGGTTTGGGGAGGG - Intronic
1047880170 8:129184262-129184284 ATGGAAAACAGGGCTGGGCATGG + Intergenic
1048418101 8:134249624-134249646 AAAGAGGAGAGGGCTGGGGAAGG - Intergenic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1049151401 8:141037586-141037608 ATGGAGATGAGCTCTGGGCCGGG + Intergenic
1049422047 8:142521363-142521385 AGGGATAGGGGGTCTGGGGAGGG - Intronic
1049536121 8:143183298-143183320 AAGGAGAAATGGTGTGGGGAGGG + Intergenic
1049587464 8:143438693-143438715 CTGGAGGGGAGATCTGGGGAGGG - Intronic
1049829437 8:144690946-144690968 ATGGACAAAAGGGCTGGGCAAGG - Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1051264644 9:15298912-15298934 ATGGAGAAGTGATGTGGGGAAGG - Intronic
1051524762 9:18031589-18031611 ATGTAGCAGTGCTCTGGGGAAGG + Intergenic
1051582598 9:18694175-18694197 TTGGAGGAGGGGGCTGGGGAAGG - Intronic
1051966115 9:22831938-22831960 CTGGAGAACAGGTATGGGAATGG + Intergenic
1052227670 9:26109000-26109022 TTGGGGAAGAGGTATGTGGATGG + Intronic
1052389793 9:27866348-27866370 TGGGAGAAGTTGTCTGGGGAAGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052737256 9:32354949-32354971 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1053277569 9:36794888-36794910 ATGGAGGAGGGGTCCGGGGTGGG - Intergenic
1053303018 9:36965053-36965075 AAGGAGAAGGGGTGTGGGGGTGG - Intronic
1053391511 9:37739719-37739741 ATAGAACTGAGGTCTGGGGAGGG + Intronic
1055370545 9:75593676-75593698 ATGGAGTTGAGGTCTTTGGAAGG + Intergenic
1056156760 9:83845833-83845855 TTGGGGAAGAGGTATGTGGATGG + Intronic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056314145 9:85372317-85372339 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056353776 9:85777693-85777715 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1057316285 9:93970834-93970856 CTGGAGAACAGGCATGGGGATGG + Intergenic
1059073857 9:111168287-111168309 ATGGAGTGGAGGGCTAGGGAAGG + Intergenic
1059783345 9:117553132-117553154 ATGGAGGTGGGGTCTGGGGCAGG - Intergenic
1059840734 9:118212686-118212708 ATAGAGATGAGGGTTGGGGAAGG + Intergenic
1059950048 9:119453011-119453033 ATGGAGAAGAGGTATTGGATAGG + Intergenic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060725384 9:126002674-126002696 ATGGGGAGGAGGCCAGGGGAGGG + Intergenic
1060738594 9:126082586-126082608 TGGGAGTAGAGTTCTGGGGATGG + Intergenic
1060762525 9:126267899-126267921 ATGGAGAAGATCTCCTGGGAAGG - Intergenic
1060933565 9:127503547-127503569 GAGGGGACGAGGTCTGGGGATGG + Intergenic
1061189168 9:129071633-129071655 ATGGGAAAGGGGTCTGGGGATGG + Exonic
1061214480 9:129213195-129213217 CTGGAGAAGAGGTCAAGGGAGGG - Intergenic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061498247 9:130987908-130987930 ATGGAGCAGAGCCCAGGGGAGGG + Intergenic
1061942718 9:133891861-133891883 ATGGAGGGGAGGCATGGGGATGG + Intronic
1062086853 9:134653576-134653598 ATGGAGGGGAGGTCTGGGTGAGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062242653 9:135548485-135548507 ATGGACAAGAGCTCAGGGGTGGG - Intronic
1062556665 9:137115938-137115960 AAGGAGCAGAGGTGTGGGGTGGG - Intergenic
1185539599 X:891884-891906 AAGGAGAAGAGGTTTCGGCATGG + Intergenic
1185739848 X:2523033-2523055 ATGGGAAAGAGGCCGGGGGAAGG + Intergenic
1186310896 X:8317660-8317682 ATTGAGAGGAGGTCAGGGAAAGG + Intergenic
1186384008 X:9091133-9091155 TTGGGGAAGAGGTATGTGGATGG - Intronic
1186469038 X:9807042-9807064 ATGGAGATGGGGTCTAGGGAAGG + Intronic
1187433563 X:19246854-19246876 ATGGAGAGGTGGTCTGATGATGG - Intergenic
1187920138 X:24193906-24193928 AAGATGAAGAGTTCTGGGGATGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1189154797 X:38746105-38746127 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1189310800 X:40015912-40015934 AGGCAGGAGAGGACTGGGGATGG + Intergenic
1189974729 X:46449296-46449318 GTGGAGGAGAGGTGTGGGGCTGG - Intronic
1190177966 X:48167160-48167182 AGGGAAAAGAGTTGTGGGGAAGG + Intergenic
1190801982 X:53797789-53797811 AAGGAGAAGGGATTTGGGGATGG + Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191659108 X:63632291-63632313 CTGGAGAACAGGTATGGGAATGG - Intergenic
1191759436 X:64630537-64630559 TTGGAGGAGAGGTATGTGGATGG + Intergenic
1191769412 X:64739470-64739492 TTGGGGAAGACGTCTGTGGATGG - Intergenic
1191941178 X:66483251-66483273 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1192175293 X:68881242-68881264 ATGGAGAACAGGCTGGGGGAGGG + Intergenic
1192180264 X:68911952-68911974 ATGGGGAAAGGGTCTGGGGTTGG - Intergenic
1192547863 X:72028539-72028561 GAGGAGTAGAGATCTGGGGAAGG - Intergenic
1192678435 X:73225290-73225312 ATGGAGAACAGGGATGGGAAAGG + Intergenic
1192898791 X:75472533-75472555 TTGGGGAAGAGGTATGTGGATGG + Intronic
1193447239 X:81619388-81619410 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1193573626 X:83174548-83174570 TTGGAGAAGAGGTATTTGGATGG - Intergenic
1193996112 X:88367244-88367266 ATGAAGAAGAGATGTGGGGTTGG - Intergenic
1194209982 X:91060055-91060077 CTGGAGAACAGGTATGGGAATGG + Intergenic
1194598921 X:95895943-95895965 TTGGAGAAGAGGCCTTGAGATGG - Intergenic
1194671638 X:96740921-96740943 ATGGGGAAGAGCTCTGAGGTTGG - Intronic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195748847 X:108144735-108144757 TTGGGGAAGAGGTATGTGGATGG - Intronic
1196299858 X:114041191-114041213 ACGGAGAAGGGGTCGGGGGGCGG - Intergenic
1197002381 X:121453545-121453567 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1197084118 X:122452872-122452894 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197097177 X:122610540-122610562 ATGGAGAACAGGCATGGGAATGG + Intergenic
1197182179 X:123548408-123548430 TTGGGGAAGAGGTCTGTGGATGG + Intergenic
1197244963 X:124158365-124158387 TTGGGGAAGAGGTATGTGGATGG - Intronic
1197386688 X:125811616-125811638 TTGGGGAAGAGGTCTGTGGATGG - Intergenic
1197409245 X:126095818-126095840 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197467182 X:126819634-126819656 AGGGAGAAAAGGAGTGGGGAGGG - Intergenic
1197477284 X:126940805-126940827 TTGAGGAAGAGGTCTGTGGATGG - Intergenic
1197497762 X:127207273-127207295 CTGGAGAACAGGCCTGGGAATGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1198782960 X:140257184-140257206 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1198915839 X:141670725-141670747 GTGGAGTAGATGTCTGGTGAGGG + Intronic
1199310350 X:146313773-146313795 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199523881 X:148769757-148769779 AAGGAGAAGGGGTCTGGGTTTGG - Intronic
1199830173 X:151541647-151541669 ATGGAGACAAGGGCTGGGGGAGG - Intergenic
1200086523 X:153609934-153609956 AAGGAGAAGGGGTCCAGGGAGGG - Intergenic
1201918868 Y:19212708-19212730 AGGGCAAAGAGGCCTGGGGAAGG + Intergenic
1202341346 Y:23872180-23872202 CTGGAGAACAGGCATGGGGATGG - Intergenic
1202529420 Y:25797906-25797928 CTGGAGAACAGGCATGGGGATGG + Intergenic