ID: 1143900391 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:10170153-10170175 |
| Sequence | AATGATGGGGGGATGGAGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3294 | |||
| Summary | {0: 1, 1: 0, 2: 13, 3: 212, 4: 3068} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143900391_1143900404 | 23 | Left | 1143900391 | 17:10170153-10170175 | CCCCCCTCCATCCCCCCATCATT | 0: 1 1: 0 2: 13 3: 212 4: 3068 |
||
| Right | 1143900404 | 17:10170199-10170221 | GATCCTTGTAAACATCCAGCTGG | 0: 1 1: 0 2: 0 3: 11 4: 89 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143900391 | Original CRISPR | AATGATGGGGGGATGGAGGG GGG (reversed) | Intronic | ||