ID: 1143900391

View in Genome Browser
Species Human (GRCh38)
Location 17:10170153-10170175
Sequence AATGATGGGGGGATGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3294
Summary {0: 1, 1: 0, 2: 13, 3: 212, 4: 3068}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143900391_1143900404 23 Left 1143900391 17:10170153-10170175 CCCCCCTCCATCCCCCCATCATT 0: 1
1: 0
2: 13
3: 212
4: 3068
Right 1143900404 17:10170199-10170221 GATCCTTGTAAACATCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143900391 Original CRISPR AATGATGGGGGGATGGAGGG GGG (reversed) Intronic