ID: 1143900885

View in Genome Browser
Species Human (GRCh38)
Location 17:10173911-10173933
Sequence GAGCACAGGGAGACGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 513}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143900878_1143900885 -1 Left 1143900878 17:10173889-10173911 CCTGGAAAGGGAACAGAGCCATG 0: 1
1: 0
2: 1
3: 29
4: 312
Right 1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 513
1143900873_1143900885 20 Left 1143900873 17:10173868-10173890 CCAAAGAACCAGCAGCAGCAGCC 0: 1
1: 0
2: 5
3: 72
4: 584
Right 1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 513
1143900875_1143900885 12 Left 1143900875 17:10173876-10173898 CCAGCAGCAGCAGCCTGGAAAGG 0: 1
1: 0
2: 8
3: 46
4: 522
Right 1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 513
1143900872_1143900885 21 Left 1143900872 17:10173867-10173889 CCCAAAGAACCAGCAGCAGCAGC 0: 1
1: 0
2: 10
3: 126
4: 1024
Right 1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143900885 Original CRISPR GAGCACAGGGAGACGGTGGA GGG Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900110988 1:1005606-1005628 GGGCAGAGGCAGGCGGTGGAGGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901387739 1:8922131-8922153 GAGCAGGGGCATACGGTGGAGGG - Intergenic
901510887 1:9717537-9717559 GACCACAGGGACACAGAGGAAGG - Exonic
901758575 1:11456140-11456162 GAGCCCTGGGAGACGGGGGGAGG - Intergenic
901767859 1:11515332-11515354 AGACACAGGGAGACGGTGGGGGG - Intronic
902184196 1:14712846-14712868 AAGCACAGGGAAAAGGTGGGGGG - Intronic
902515952 1:16989775-16989797 GAGCACAGGGAGATGGGGGAGGG + Intronic
902896244 1:19482093-19482115 GACCACAGGGAAATGGTGGCAGG - Intronic
903034645 1:20485976-20485998 GAGGCAGGGGAGACGGTGGAAGG + Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903213869 1:21832640-21832662 GAGGACAGGGAGCCTGTGGCTGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904106375 1:28088461-28088483 GAGCACAGCGTGAAGGGGGATGG - Intronic
904613057 1:31735746-31735768 GAGCGCAGGGAGGAGGTAGAGGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904859130 1:33521564-33521586 GAGCACAGAGAGCAGGTGGGAGG + Intronic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905325457 1:37148730-37148752 GAGAACAGGGAGATAGGGGAAGG + Intergenic
905945773 1:41900572-41900594 GAGCACAGGGAGTGGGGAGAGGG - Intronic
905970966 1:42142112-42142134 GAGCTCAGGGGGAAGGTGGGAGG + Intergenic
905998152 1:42400095-42400117 AAGCAAAGGGAGATGGTGGAAGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907308599 1:53527053-53527075 GGGCTCAGGGAGATGGCGGATGG - Intronic
907954809 1:59217883-59217905 GAGCAGAGGGAGAGGGTAAAAGG - Intergenic
908116949 1:60949928-60949950 GAGCAATGGGAGGTGGTGGAGGG + Intronic
908166177 1:61461627-61461649 GAGAACAGGGAGACAGTGTGTGG + Intronic
908310334 1:62875047-62875069 GAAAGCAGGGAGACTGTGGAAGG + Intergenic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909069213 1:70974239-70974261 TAGAACAGAGAGACGGGGGAAGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913113555 1:115677091-115677113 GAGCATGGGGAGGCAGTGGATGG + Intronic
913585729 1:120273596-120273618 GAGAACAGGGAGAGAGTGGTAGG + Intergenic
914852927 1:151328076-151328098 GCGCGCAGGAAGACGGCGGACGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
915865515 1:159494693-159494715 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
916143064 1:161716367-161716389 GAACACACGGAGAAGCTGGAGGG - Intergenic
916219902 1:162433427-162433449 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
919091941 1:192987185-192987207 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
921519976 1:216146749-216146771 GAGCATAGAGACACGGAGGAGGG - Intronic
921903797 1:220475754-220475776 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
921983635 1:221285743-221285765 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
922056863 1:222050021-222050043 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
922283605 1:224148769-224148791 GAGCACAGGGATGATGTGGATGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922783715 1:228272849-228272871 CAGCTCAGGGACAGGGTGGAAGG - Intronic
922855829 1:228773979-228774001 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
924948677 1:248863416-248863438 GAGCACAGGGAGGCCTTGGTCGG - Intergenic
1062805871 10:419064-419086 GAGCTCATGGAGACCGGGGATGG - Exonic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063095300 10:2903631-2903653 GAGCCCAGGGACACGCTGGGAGG - Intergenic
1063434343 10:6018308-6018330 GAGGACAGGGTGAGGGTGGAGGG + Intronic
1063555598 10:7076074-7076096 CAGCACTGGGAGATGGTGTACGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065743239 10:28815759-28815781 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
1067441922 10:46313325-46313347 GGGCACAGGGACACAGTTGATGG + Intronic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069299714 10:66890892-66890914 GAGCACAGAGAGAAGGAGCAGGG + Intronic
1069745397 10:70711915-70711937 GAGCCCAGGGAGCGGGTGGGGGG + Intronic
1070344634 10:75529971-75529993 CAGCTCAGAGAGATGGTGGAAGG + Intronic
1070601121 10:77867057-77867079 GAGCACAGAGATACTGTTGACGG + Intronic
1070800208 10:79240769-79240791 GAGAACAGGGAGATGGGGTAGGG + Intronic
1072547334 10:96449729-96449751 GAGCACAGAGTGGCAGTGGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074216948 10:111394453-111394475 GAGGAACGGGAGTCGGTGGATGG - Intergenic
1075949256 10:126463018-126463040 GGGCACTGGGAGACGGGGGGTGG - Intronic
1076261623 10:129071437-129071459 GAGCCCATGGAGGGGGTGGAAGG + Intergenic
1077145395 11:1042121-1042143 GAGCACAGGGAGAGGCTGCCGGG + Intergenic
1077260564 11:1617151-1617173 GAGCACAGGGAGACCCTGTATGG - Intergenic
1077263557 11:1636727-1636749 GAGCCCAGGGAGACGGACAAGGG + Intergenic
1077805800 11:5590154-5590176 GAGCCCATGGAGGCGGGGGAAGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078758908 11:14236020-14236042 GAGGACAGGCAGACCATGGAGGG + Intronic
1078861591 11:15252932-15252954 GGACACAGGGAGATGGTGGTTGG - Intergenic
1079315523 11:19404943-19404965 GAGCACAGAGAGAGGAGGGAAGG - Intronic
1080136393 11:28859444-28859466 GAGCACAGGGAGACCTTAGTAGG - Intergenic
1081589107 11:44408539-44408561 CAGCATAGGTAGACGCTGGAGGG + Intergenic
1083732564 11:64660704-64660726 GAGCACAGGGATAGGGAGCAGGG + Intronic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087025300 11:93643655-93643677 GAGCACAGGGATTCGGAGCAAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087935198 11:104025739-104025761 GAGCACAGGGAGATGAGGCAGGG + Intronic
1088098592 11:106129407-106129429 GAGCAGTTGGAGAGGGTGGAGGG + Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089466369 11:118689060-118689082 GAGCCCAGGGAGGCGGGGGAAGG + Intergenic
1089744593 11:120607867-120607889 GAGCAACTGGAGAAGGTGGAGGG + Intronic
1089780358 11:120869422-120869444 GGGCACAGGGAGCAGGTAGAAGG - Intronic
1090305031 11:125683974-125683996 GAGTAGAGGGAGAGGTTGGAAGG - Intergenic
1090357805 11:126151580-126151602 GACCACAGGTAGAGGGAGGAAGG + Intergenic
1090879384 11:130820401-130820423 AAGGACAGGGAGACCATGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091025170 11:132135485-132135507 GAGAACAGGCAGAAGGTGTAAGG + Intronic
1091237449 11:134031583-134031605 GAGATGAGGGAGACGGGGGAAGG - Intergenic
1091254704 11:134173260-134173282 GATCCCAGGGAGGCGGGGGATGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1091702658 12:2674236-2674258 GAGCACTGAGTGCCGGTGGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092572382 12:9739661-9739683 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093071315 12:14709379-14709401 GAGCATAGAGACACGGAGGAGGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096409115 12:51364614-51364636 AAGCACAGGGAGGCCCTGGATGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100444597 12:94649852-94649874 GAGCGCGGGGAGGCGGCGGACGG - Intronic
1102162240 12:110778889-110778911 GATCACAGGAAGCCAGTGGAAGG + Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1103146109 12:118597261-118597283 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
1103439187 12:120950411-120950433 GAGCCCACGGAGGCGGTGGAGGG + Intergenic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103825115 12:123731836-123731858 TAGCACAGGCAGGCGGTGGTGGG - Intronic
1104893726 12:132152007-132152029 GAGCACAGGGAGGCCATGGCTGG + Intronic
1104906491 12:132215995-132216017 GAGGGAAGGGAGACGGTGGCGGG + Intronic
1105388725 13:19957673-19957695 GAGGACCAGGAGACGGTGGCAGG + Intergenic
1105426193 13:20297041-20297063 GAGGACAGGGAGACAGAGGGCGG - Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1106907700 13:34425778-34425800 AAGCACAGGGAGTCGGGGGTGGG + Intergenic
1108469424 13:50753392-50753414 GAGCACACGGAGGGGGTGGGAGG + Intronic
1109161465 13:58980473-58980495 GTGCACAGGGTGAAGGTGGGAGG - Intergenic
1109311167 13:60695328-60695350 GAGCACAGGGGGCAGGGGGATGG + Intergenic
1110368904 13:74718664-74718686 GAGCCCATGGAGGGGGTGGAAGG - Intergenic
1110417517 13:75268724-75268746 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
1110560818 13:76909153-76909175 GAGCAGAGTGACACGGTAGAGGG - Intergenic
1110792363 13:79600243-79600265 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1112065095 13:95784355-95784377 CAGCACAGGGAAAAGGTGCAAGG + Intronic
1112279073 13:98046861-98046883 GAGCACAGAGAAACAGTGTATGG - Intergenic
1112533138 13:100224134-100224156 GAGCCCAGGGAGGGGGTGGGAGG + Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113780482 13:112973957-112973979 GAGATCAGGAAGACGCTGGAAGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115754762 14:36519813-36519835 GAGCGCGGGGAGGAGGTGGAGGG + Intronic
1116390560 14:44385018-44385040 GAGCCCACGGAGGGGGTGGAAGG - Intergenic
1117189866 14:53278915-53278937 GTCCACAGGGAGTGGGTGGATGG + Intergenic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118355839 14:65012988-65013010 CAGGACTGGGTGACGGTGGAGGG + Intronic
1119148956 14:72340733-72340755 GAGCTCTGGGAGACTGTGAAAGG + Intronic
1120930465 14:89842772-89842794 GAGCACAGGGTAAAGGGGGATGG - Intronic
1121048517 14:90804883-90804905 GACCACAGAGGGGCGGTGGAGGG + Intronic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1122242643 14:100379032-100379054 GAGCACAGGGAAAGGGTGCAGGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122791641 14:104186306-104186328 GGGCGCAGGCAGACGGGGGAAGG - Intergenic
1123110483 14:105864795-105864817 GTTCCCAGGGAGACGGTGGCCGG + Intergenic
1123779592 15:23613286-23613308 GTGCACAGAGAGAGGGTGAAAGG + Intronic
1125914515 15:43473957-43473979 GAGCCCACGGAGGGGGTGGAAGG + Intronic
1126089031 15:45035110-45035132 GAGCCCACGGAGTCGGGGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127365342 15:58284283-58284305 GGGCACAGGGAGAAGGAGGGAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128058236 15:64716870-64716892 GAGCACAGGATGAGGCTGGAGGG - Intergenic
1128378204 15:67092209-67092231 GAGCACAGGAAGATGAGGGATGG + Intronic
1128666568 15:69542517-69542539 GGGCAGAGCGAGAGGGTGGAAGG + Intergenic
1128675079 15:69602600-69602622 TAGCAGAGAGAGAGGGTGGAGGG - Intergenic
1128937314 15:71757884-71757906 GAGCACTGTGAGACAGGGGAAGG - Exonic
1129196200 15:73968336-73968358 GAACACATGGAGATGCTGGAGGG - Intergenic
1129683436 15:77671291-77671313 GAGAAGAGGGAGAAGGTAGAGGG + Intronic
1130910356 15:88266395-88266417 GAGCACGGGGAGCAGGTGGCGGG + Intergenic
1130939460 15:88495614-88495636 GTGCAGAGGAAGACGGTGGAGGG - Intergenic
1131157677 15:90085019-90085041 GAGCACCGGGGGAAGCTGGATGG - Exonic
1131969726 15:97879824-97879846 GAAGACAGAGAGACGATGGAAGG + Intergenic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132862565 16:2078831-2078853 GAGAACGGGGAGACGCTGGGTGG - Intronic
1132953469 16:2578199-2578221 GAGCGCAGGGAGGCCCTGGAGGG + Intronic
1132960883 16:2621969-2621991 GAGCGCAGGGAGGCCCTGGAGGG - Intergenic
1133040088 16:3056103-3056125 GTGAACAGGGAGATGGGGGAGGG + Intronic
1133043965 16:3075948-3075970 GTGGACAGGGAGATGGGGGAGGG + Intronic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1135249852 16:20891733-20891755 GAGCACAGGGACACAGTGGCTGG - Intronic
1135325922 16:21525844-21525866 GGACACAGGGAGACCGTGGTTGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136605499 16:31330984-31331006 GAGGACAGAGAAACGGAGGAGGG + Intronic
1137446825 16:48537013-48537035 GGGCACAGGGAGGCTGCGGAAGG - Intergenic
1137819637 16:51431603-51431625 GAAAACATGGAGACGGTGGCTGG + Intergenic
1138424366 16:56920928-56920950 GAGCACATGGACACGTGGGAGGG + Intergenic
1139482706 16:67239366-67239388 GAGCAGCGGGAGATGCTGGAGGG - Exonic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139677883 16:68537803-68537825 TAGCACAGGGAGGCTGAGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140692873 16:77501121-77501143 GAACACATGGACACGGGGGAGGG - Intergenic
1141003529 16:80330841-80330863 GAGCACAGGGGTGCAGTGGACGG + Intergenic
1141947260 16:87319192-87319214 GAGCACAGGGGCAGGGTGGCTGG - Intronic
1142038955 16:87880535-87880557 GGACACAGGGAGACCGTGGTTGG + Intergenic
1142708292 17:1709940-1709962 GCGCACAGGGAGACTGCGGCCGG - Intronic
1142757222 17:2023689-2023711 GCGCACGGGGAGGGGGTGGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1143109340 17:4544684-4544706 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143109349 17:4544706-4544728 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143174251 17:4947549-4947571 GTGGACAGGGAGATGGTGGTGGG + Intronic
1143329406 17:6122216-6122238 GAGCACAGGCCGGGGGTGGAAGG + Exonic
1143594795 17:7907654-7907676 GAACACAGGGAGAGGCCGGAGGG + Exonic
1143663160 17:8339805-8339827 GGGCACAGTGAGATGGGGGAGGG - Intergenic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144955685 17:19017789-19017811 CAGCCCAGGGAGATGCTGGAGGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146507609 17:33418905-33418927 GAACACACGGACACGGGGGAGGG + Intronic
1146679973 17:34800018-34800040 GAGCAGAGGAAGACGAGGGAGGG + Intergenic
1147120205 17:38331143-38331165 GAGAGCCGGGAGTCGGTGGAGGG - Exonic
1150004694 17:61462530-61462552 GGGCATAGGGAGAGGGTGCAGGG + Intronic
1150267783 17:63842333-63842355 GAACTCCGGGAGACGGTGGAGGG - Intronic
1152009711 17:77704719-77704741 GAGGACAGGGAGGCAGTGGAAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152306025 17:79520558-79520580 GAGCAGAGGGAGACGGCTGGTGG - Intergenic
1152470802 17:80489348-80489370 GAGGGGAGGGATACGGTGGAGGG + Intergenic
1152470879 17:80489597-80489619 GAGGGGAGGGATACGGTGGAGGG + Intergenic
1152470956 17:80489846-80489868 GAGGGGAGGGATACGGTGGAGGG + Intergenic
1153914244 18:9732085-9732107 GAGCTGAGGGAGACGGAGGCTGG - Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154020393 18:10659752-10659774 GAGCACATGGAGACTCGGGAAGG + Intergenic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155538176 18:26839532-26839554 GAGCAAAGGGAGAGGGCTGATGG + Intergenic
1155976804 18:32140098-32140120 GAGCCCACGGAGAGGGTGGGAGG - Intronic
1156863690 18:41866033-41866055 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
1158427366 18:57352341-57352363 GAGTAGAGGGAAATGGTGGAGGG - Exonic
1159472912 18:68880080-68880102 GAGCCCATGGAGGGGGTGGAAGG + Intronic
1160080996 18:75727030-75727052 GAGCACAGGGAGAGGGGAGAAGG - Intergenic
1160176586 18:76600215-76600237 GAGCCCATGGAGGCGGGGGAAGG + Intergenic
1160265287 18:77336500-77336522 GAGCAGTGGGAGGAGGTGGAAGG + Intergenic
1160405508 18:78643853-78643875 GAGCAGAGGGTGACTGTTGAGGG + Intergenic
1161335433 19:3710406-3710428 GAGGACAGGGAGCTGGTGGCGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162968010 19:14164929-14164951 GGGCACAGGGCGAGGGTGGAGGG + Intronic
1162971508 19:14183704-14183726 GAGGACAGGGAGACTGAGGTGGG + Intronic
1163181691 19:15608730-15608752 GAACCCACGGAGACGGGGGAAGG + Intergenic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1165661926 19:37588554-37588576 GAGCACGGAGAGAAGGAGGAGGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167749084 19:51368990-51369012 GAGCCCAGAGAGACGGGGGGAGG + Exonic
1167887712 19:52515928-52515950 GAACACGGGAAGCCGGTGGAGGG - Intergenic
1167908851 19:52684925-52684947 GAACACGGGAAGCCGGTGGAGGG + Intronic
1167918585 19:52762267-52762289 GAACACGGGAAGCCGGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167937708 19:52921323-52921345 GAACACAGGAAGCCAGTGGAGGG + Intergenic
1167960297 19:53099485-53099507 GAACACGGGAAGCCGGTGGAGGG + Intronic
1167964093 19:53129317-53129339 GAACACAGGAAGCTGGTGGAGGG + Intronic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167992308 19:53370824-53370846 GAACACGGGAAGCCGGTGGAGGG - Intronic
1168306662 19:55439579-55439601 GAGGCCAGGGAGAGGGTGGTTGG - Intronic
1168706744 19:58474617-58474639 GAGCAGAGGGGGAGGTTGGAGGG - Intronic
924987764 2:287735-287757 GAGCCCCGGGAGCCGGCGGACGG - Exonic
925088854 2:1136369-1136391 GAACACAGGGAGACGGCGCAGGG + Intronic
925353737 2:3222631-3222653 GAGCACAGGGAAATGAAGGAAGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925413893 2:3656187-3656209 GAGCCCAGGGAGGCCGGGGATGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927723001 2:25398875-25398897 GAGCACAGGGATTCAGAGGATGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928182161 2:29076044-29076066 GAGCACAGGGTGGGGGTGGGGGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930679820 2:54245031-54245053 GAGGATAGGGAGATGGGGGAAGG - Intronic
931708723 2:64969280-64969302 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
932239967 2:70148581-70148603 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
934898528 2:98139278-98139300 GAGCCCACGGAGGCGGGGGAAGG - Intronic
935157630 2:100497272-100497294 GAGGAGAGGGAGGCGGTGGGAGG - Intergenic
935420598 2:102865217-102865239 GTGCACATGGAGAAGGTGGTTGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936060579 2:109293238-109293260 GAGGACAGAGGGATGGTGGAGGG + Intronic
937525591 2:122765071-122765093 CAGCACAGACAGACAGTGGAAGG - Intergenic
938108628 2:128549924-128549946 GGGCACAGGGAGGAGGTAGATGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938579449 2:132633187-132633209 GAGCACAGGGAGTTGGGGAAAGG + Intronic
940537204 2:154960340-154960362 GAGGACAGGGAGACAGATGAGGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942867325 2:180691663-180691685 GAGCCCATGGAGGCGGTGGGAGG - Intergenic
942996261 2:182264013-182264035 GAGCCCAAGGAGACTGAGGATGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945528927 2:210925926-210925948 TAGCACAAGGAGACTGTGGCAGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946163132 2:217848054-217848076 GAACTCAGGGAGACTGGGGATGG + Exonic
946404470 2:219485021-219485043 GAGCCCAGGGACTCGGCGGAAGG - Exonic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948580012 2:238980620-238980642 GAGCACAGGGAGAGGGGCAATGG - Intergenic
948628477 2:239285206-239285228 GAGCACAGAGCCACGGTGGAGGG + Intronic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169325284 20:4670731-4670753 GAGCACAGGGAGAATGGGGGAGG + Intergenic
1169350774 20:4866455-4866477 GAGCACAGGGAGATGAGGGAAGG - Intronic
1169971126 20:11270544-11270566 GAACTCAGGGAGATGGTGCAGGG + Intergenic
1171255002 20:23684030-23684052 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171271453 20:23821675-23821697 ACACACAGGGAGATGGTGGAGGG + Intergenic
1172584111 20:36070637-36070659 GAGCACAGAGGGACCCTGGAGGG - Intergenic
1172782932 20:37447854-37447876 GAGCACAGGGAGAGGGAAGATGG - Intergenic
1173392865 20:42650393-42650415 GAGCCCAGGGAGATGGAGGAGGG - Intronic
1173801795 20:45898749-45898771 GCCCACAGGGAGGTGGTGGACGG + Exonic
1174104700 20:48153888-48153910 GAGCTCAGGGAGAGAGTGGATGG - Intergenic
1174208127 20:48856144-48856166 GAACCCAGGGAGACAGTGGTAGG + Intergenic
1174277278 20:49413248-49413270 GAGCCCAGATAGAGGGTGGAGGG - Intronic
1174567849 20:51479871-51479893 GAGGACAGAGAGAGGGTGGCAGG - Intronic
1175238050 20:57526501-57526523 GGGCACTGGGAGACGCTGGCGGG + Intergenic
1175876516 20:62232801-62232823 GAGGTCAGGGAGGGGGTGGAGGG - Intronic
1176654103 21:9574553-9574575 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1177496966 21:21902700-21902722 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1177565797 21:22818943-22818965 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1177637653 21:23807291-23807313 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1179160220 21:38890039-38890061 GAGGACTGGGAGATGGGGGAAGG - Intergenic
1179639567 21:42738438-42738460 GAGCACAGTGAGGCTGGGGAAGG + Intronic
1179666092 21:42913544-42913566 GAGCACAGGGCACTGGTGGAGGG + Intergenic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1180156077 21:45977900-45977922 GAGAGGAGGGAGACGGTGAAGGG + Intergenic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1180996556 22:19968665-19968687 GAATACAGGGAGGTGGTGGACGG + Exonic
1181266855 22:21635511-21635533 GAGCTCAGGGAGAAGGTAGCAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182554313 22:31120798-31120820 GAGCTCAGGGAGCGGGTGGTGGG + Intergenic
1182625078 22:31639776-31639798 GAGCACAGACAGAGGGTGGGTGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183255583 22:36759478-36759500 GTGCACAGGGACAGGCTGGAGGG + Intronic
1183560658 22:38570226-38570248 GGGCGCAGGGTGAGGGTGGAAGG + Exonic
1183574049 22:38675757-38675779 CAGCACAGTGACACAGTGGAAGG + Intergenic
1183653451 22:39171875-39171897 AAACACAGGCAGACGGGGGATGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185161668 22:49233672-49233694 GAGCAGAGGGAGGTGGGGGATGG + Intergenic
1185400406 22:50612793-50612815 GAGCAGAGGGAGGAGGTGGGTGG - Intronic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
949577961 3:5357315-5357337 GAGCACAGGAAGACAGAGTAGGG - Intergenic
950289074 3:11769029-11769051 GAGCAGAGACAGAGGGTGGAGGG + Intergenic
952593674 3:34988653-34988675 GAGCCCAGGGAGGTGGTGGGAGG - Intergenic
952795278 3:37233279-37233301 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
952975087 3:38687060-38687082 AAGCACAGGGAGTGAGTGGAGGG + Intergenic
953124478 3:40078011-40078033 GAGCCCATGGAGAGGGTGGGAGG + Intronic
953548601 3:43883418-43883440 GAACACAGGGAAAGGGTGGGGGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954579981 3:51697987-51698009 GAGCACATGGAGACTTAGGATGG + Intronic
954956109 3:54519389-54519411 GAGCACTGTGAGATGGTGGAGGG - Intronic
955242224 3:57188203-57188225 GAGCATAGGAACAAGGTGGAAGG - Intergenic
958044133 3:88263055-88263077 GGGCACAGGGAAAAGGAGGAAGG + Intergenic
958084555 3:88789731-88789753 GAGCAGAGGGACACAGGGGATGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959644516 3:108682628-108682650 AAGCACAGGGAGAGGTTGGTTGG + Intronic
960073482 3:113458215-113458237 GAGGAGAGGGAGACGGGAGAGGG - Intronic
960283624 3:115802819-115802841 GAGCATTGGGAGATGGGGGAGGG + Exonic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963651790 3:147989461-147989483 GAGCCCATGGAGGCGGTGGCTGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963922926 3:150923441-150923463 GAGCAAGTGGAGACGGTGCAAGG + Intronic
964428598 3:156579833-156579855 GAACACAGGGTGATGGAGGATGG - Intergenic
965136399 3:164776609-164776631 TAGCACAGGCAGACAGTAGATGG + Intergenic
965245205 3:166258552-166258574 GAGCCCACGGAGGGGGTGGAAGG + Intergenic
965516912 3:169631076-169631098 GAGCACAAGGAGACTGCAGAAGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966916576 3:184587591-184587613 GGGCAGGGAGAGACGGTGGAGGG - Intronic
967478175 3:189944711-189944733 GGGCAAAGGGGGAGGGTGGAAGG - Intergenic
967962888 3:194939803-194939825 GGGAATAGGGAGACGCTGGAAGG + Intergenic
968121789 3:196130999-196131021 GACCAGAGGCAGACGTTGGAGGG - Intergenic
968132216 3:196198360-196198382 GAGCAGAGGGGGACATTGGAGGG + Exonic
968382673 4:109134-109156 GAGCACAGGGCCAGGGTGGCCGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968647154 4:1746701-1746723 GAGCACAGGTGGGCTGTGGAGGG - Intergenic
969480014 4:7442278-7442300 GGGCTCAGGGAGGGGGTGGAGGG - Intronic
969742329 4:9038893-9038915 GGGCTCAGGGGGAAGGTGGAAGG + Intergenic
970089173 4:12385783-12385805 GAACACATGGAGATGGTGGGTGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971377075 4:26064053-26064075 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974484751 4:62491980-62492002 GAGCCCATGGAGAGGGTGGGAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977171904 4:93772632-93772654 GAGGAGAGGGAGAAGGTGGGAGG - Exonic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980072410 4:128258132-128258154 GAGGCCAGGGACACAGTGGAAGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985810277 5:2078139-2078161 GAACACAGGGAGAGGCTGGCTGG + Intergenic
985882744 5:2652752-2652774 GAGCATAGGGGGCAGGTGGATGG - Intergenic
985900009 5:2780795-2780817 GAGCAGAGGGAGCTGGTGGGTGG - Intergenic
986012797 5:3731827-3731849 TAGCACGGGGTGACGCTGGAAGG - Intergenic
987018266 5:13843402-13843424 GAGCAAAGAGAGAAGGGGGATGG - Intronic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
987383975 5:17311857-17311879 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
988086952 5:26485364-26485386 GAACCCAGGGAGGCGGGGGAAGG + Intergenic
988684700 5:33515471-33515493 GAGCCCATGGAGGCGGGGGAAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989723584 5:44559572-44559594 GGACTCAGGGAGAGGGTGGAAGG + Intergenic
991292345 5:65045020-65045042 GAGTAAAGGGTGATGGTGGATGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992358410 5:76009754-76009776 GAGCTCAGAGAGACGGAGGTGGG + Intergenic
996344979 5:122478119-122478141 GAGCATAGAGACACGGAGGAGGG + Intergenic
998046200 5:138989051-138989073 TAGCAAAGGGACACGGTGGAAGG + Intronic
998384715 5:141750138-141750160 GGGAACAGGGAGATGGTGGAGGG + Intergenic
999712148 5:154328349-154328371 GAGCCCAGGGAGAGAGAGGAGGG + Intronic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1002004599 5:176222109-176222131 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
1002170447 5:177371513-177371535 GAGAACTGGGGGACGCTGGAGGG - Exonic
1002221779 5:177688511-177688533 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
1003100227 6:3171041-3171063 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
1004094494 6:12539133-12539155 GAGCACAAGGGGAAGGTGGTTGG + Intergenic
1004235510 6:13872005-13872027 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005707411 6:28469437-28469459 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
1006135325 6:31892471-31892493 GAGGAGTGGGAGACGGTGGTGGG - Exonic
1006938844 6:37738026-37738048 GAGTACAGGGAGATGAGGGATGG + Intergenic
1007074068 6:39055711-39055733 GAGCACGGGGAGGGGGTGGGGGG + Intronic
1007691280 6:43703058-43703080 GAGCTCAGGGAGACTCAGGATGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1011830745 6:91368397-91368419 GAACACAGGGACACAGGGGAGGG - Intergenic
1016352199 6:143180035-143180057 GAGGACAGAAAGACGGTGGAAGG - Intronic
1016759413 6:147720476-147720498 GAGCTGGGGGAGACCGTGGAAGG - Intronic
1017302583 6:152879645-152879667 GAGGACAGCAAGATGGTGGAAGG + Intergenic
1017396213 6:154002583-154002605 GACCACTGGGAGCCAGTGGAAGG + Intergenic
1017689273 6:156946779-156946801 AAACACAGGGAAACGGTGGTGGG + Intronic
1017743521 6:157427172-157427194 GAGCACAGGAGGAAGGAGGAAGG + Intronic
1018545703 6:164933574-164933596 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018624610 6:165765370-165765392 GAGCCCACGGAGGCGGGGGAAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019541647 7:1554398-1554420 GAGCCCAGGAAGGCTGTGGAGGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019944230 7:4314021-4314043 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1019965719 7:4497014-4497036 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022130496 7:27400564-27400586 GAGCTCAGGGAGATGGTGGGTGG - Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1022528308 7:31052283-31052305 GAGCAGGGGGAGGCGGTGGTCGG + Intergenic
1022536107 7:31099594-31099616 GAGGAGAGGGAGAGGGTAGAGGG + Intronic
1022953960 7:35364410-35364432 GAGTCCAGGCAGAGGGTGGAAGG - Intergenic
1023776996 7:43617240-43617262 GAGCAATGGGAGGCTGTGGAAGG + Intronic
1023789158 7:43737915-43737937 GAGGACAGAGAGAGGGTGGGAGG + Intergenic
1024153472 7:46596748-46596770 GAACACATGGACACGGTGGGGGG + Intergenic
1024834082 7:53495298-53495320 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
1025280454 7:57623227-57623249 GAGCAGAGGGAGTGGGTGGCTGG - Intergenic
1025304277 7:57842280-57842302 GAGCAGAGGGAGTGGGTGGCTGG + Intergenic
1025911573 7:65832828-65832850 GAGGCCAGGGAGTCGGTGGGTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026202983 7:68231309-68231331 GAGCTCACGGAGGCGGGGGAAGG - Intergenic
1026727416 7:72880145-72880167 GAGCACAGAGAGGAGGAGGAAGG - Intronic
1027509554 7:79062732-79062754 GATGACAGGGAGGAGGTGGAAGG - Intronic
1027561706 7:79739578-79739600 GAGCCCATGGAGGCGGTGGGAGG - Intergenic
1027698248 7:81437173-81437195 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1027878259 7:83799689-83799711 GGGCACAGGCAGAAGATGGATGG + Intergenic
1028828467 7:95301529-95301551 CAGAACAGGTAGACGGTGGTGGG - Intronic
1028985056 7:97003027-97003049 AAGCACAGGGTGAGGGTGTAGGG + Intergenic
1029053650 7:97717034-97717056 GAGAACTGGGAGGCGGGGGAAGG + Intergenic
1029822773 7:103160814-103160836 GAGCACTGGGAAATGGTGAAGGG - Intergenic
1029906499 7:104098630-104098652 GAGCACAGGAAGCAGGTGGAAGG + Intergenic
1031911132 7:127517769-127517791 GAGCACAGGGACTGGGTGGATGG - Intergenic
1031962279 7:128000854-128000876 GAGCACAAGCAGACTGTAGATGG + Intronic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1032427480 7:131833273-131833295 GAGCCCAAGAAGAGGGTGGAGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033366922 7:140678830-140678852 GACCCCAGGGAGACGGGGAAGGG + Intronic
1033460315 7:141541608-141541630 GAGCCCAGGGAGAAGGAGGCAGG - Intergenic
1033652821 7:143355205-143355227 GAGCACAGGCAGAGGATGGGCGG - Exonic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035300033 7:157891135-157891157 GACCCCAGGGAGAAGGTGCATGG + Intronic
1036809475 8:11857731-11857753 GAGCACAGGGAGGTGTGGGAGGG - Intronic
1036916644 8:12810722-12810744 GAGCAAAGGGAGAAGAAGGAAGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039854273 8:41398893-41398915 GAGTAGAGGGAGATGGTGGATGG + Intergenic
1040016740 8:42706305-42706327 GGGGTCAGGGAGACTGTGGAGGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040863217 8:52022477-52022499 GAGCACAGGAAGCCTCTGGAAGG - Intergenic
1042249967 8:66746218-66746240 GAGAACAGGCAGAGGTTGGAGGG - Intronic
1043346493 8:79303771-79303793 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044434001 8:92140855-92140877 GAGAAAAGGAAGACGGTGAAAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045394035 8:101742861-101742883 GAACACAGGGACACAGGGGAGGG - Intronic
1045467728 8:102485597-102485619 GAGCCCACGGAGGCGGGGGAAGG + Intergenic
1045815313 8:106270865-106270887 GAGCAAAGGACGCCGGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047221942 8:122925860-122925882 GATCACAGGGACAGAGTGGAAGG + Intronic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048251204 8:132868284-132868306 GAGCTCAGGAAGAGGGGGGAAGG - Intronic
1049411499 8:142475751-142475773 GAGCAGAAGGGGCCGGTGGAGGG + Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1055197583 9:73615089-73615111 GAGCAAAGTGAAAGGGTGGAAGG + Intergenic
1055294567 9:74820953-74820975 AAGCAGAGGGAGATGGTAGAGGG + Intronic
1055989890 9:82094190-82094212 GAGCTCATGGAGACAGGGGAGGG + Intergenic
1057184761 9:93050934-93050956 AAGCGCAGGGAGACCCTGGATGG + Intergenic
1057784010 9:98073229-98073251 GAGAACAGGGAGTCAGGGGAAGG - Intronic
1059309273 9:113377136-113377158 GTGCACAGTGAGACGAAGGAGGG - Intergenic
1060408885 9:123386879-123386901 GGGAACAGGGAGAGGGTGCAGGG + Intronic
1060594199 9:124838818-124838840 GAGCCCATGGAGGCGGTGGGAGG + Intergenic
1061512569 9:131069970-131069992 GGGCACAGGGAGAAGGTAGGTGG - Intronic
1061656304 9:132093175-132093197 GAGCAGAGGTAGATGGGGGAAGG + Intergenic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061930791 9:133832116-133832138 GAGGACAGGAAGAAGGTGCAGGG + Intronic
1062109575 9:134774559-134774581 GGGAACAGTGAGACGGTGAAAGG - Intronic
1062638691 9:137505708-137505730 GAGTGCTGGGAGACCGTGGAGGG + Exonic
1203770454 EBV:47491-47513 GAGACCCGGGAGACGGTGGTGGG + Intergenic
1203631825 Un_KI270750v1:78011-78033 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1187119560 X:16391410-16391432 GAGCAAAGGGAGATTGTGGTTGG - Intergenic
1187163902 X:16787130-16787152 GAGCGCAGGGGGGCGGGGGAAGG - Intronic
1187304641 X:18084079-18084101 GAGCCCATGGAGGCGGTGGGAGG - Intergenic
1187557542 X:20366934-20366956 GAGCCCATGGAGGCGGTGGGAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188586723 X:31785638-31785660 GAACACATGGAGATGGGGGAGGG - Intronic
1189082996 X:37994239-37994261 GAGCATAGGGATACAGTGGGTGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1195221950 X:102753119-102753141 GGGCACAGGGAGAGAGGGGAGGG - Exonic
1196582725 X:117394956-117394978 GAGCCCACGGAGGCGGGGGAAGG - Intergenic
1196741546 X:119029790-119029812 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
1196845089 X:119890867-119890889 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1200071310 X:153530800-153530822 GAGCACTGGGGGCCGGTGGGGGG + Intronic
1200236342 X:154469577-154469599 GAGCCCAGGGAGAAGGGCGAGGG - Intronic
1201048448 Y:9909118-9909140 GAGCATAGGGATACCGGGGATGG + Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201285449 Y:12375094-12375116 GAGCCCATGGAGGGGGTGGAAGG + Intergenic
1201423015 Y:13820290-13820312 GAGCCCATGGAGTGGGTGGAAGG + Intergenic