ID: 1143904565

View in Genome Browser
Species Human (GRCh38)
Location 17:10198564-10198586
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143904565_1143904570 11 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904570 17:10198598-10198620 AGCGGCGACGCCCCCGGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 190
1143904565_1143904566 -7 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904566 17:10198580-10198602 CGTTGGCTTCGCAGAGCGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 45
1143904565_1143904572 21 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904572 17:10198608-10198630 CCCCCGGGCCGGGCAGCTCGCGG 0: 1
1: 0
2: 0
3: 25
4: 219
1143904565_1143904567 5 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904567 17:10198592-10198614 AGAGCGAGCGGCGACGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 65
1143904565_1143904568 6 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904568 17:10198593-10198615 GAGCGAGCGGCGACGCCCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 85
1143904565_1143904569 10 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904569 17:10198597-10198619 GAGCGGCGACGCCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143904565 Original CRISPR GCCAACGAGTCTCTGCTTCC CGG (reversed) Intergenic