ID: 1143904566

View in Genome Browser
Species Human (GRCh38)
Location 17:10198580-10198602
Sequence CGTTGGCTTCGCAGAGCGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143904565_1143904566 -7 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904566 17:10198580-10198602 CGTTGGCTTCGCAGAGCGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 45
1143904560_1143904566 24 Left 1143904560 17:10198533-10198555 CCTCAGGCAGGCGGGGGACGCGC 0: 1
1: 1
2: 1
3: 11
4: 171
Right 1143904566 17:10198580-10198602 CGTTGGCTTCGCAGAGCGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 45
1143904563_1143904566 -2 Left 1143904563 17:10198559-10198581 CCGCGCCGGGAAGCAGAGACTCG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1143904566 17:10198580-10198602 CGTTGGCTTCGCAGAGCGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143904566 Original CRISPR CGTTGGCTTCGCAGAGCGAG CGG Intergenic