ID: 1143904567

View in Genome Browser
Species Human (GRCh38)
Location 17:10198592-10198614
Sequence AGAGCGAGCGGCGACGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143904565_1143904567 5 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904567 17:10198592-10198614 AGAGCGAGCGGCGACGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 65
1143904563_1143904567 10 Left 1143904563 17:10198559-10198581 CCGCGCCGGGAAGCAGAGACTCG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1143904567 17:10198592-10198614 AGAGCGAGCGGCGACGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143904567 Original CRISPR AGAGCGAGCGGCGACGCCCC CGG Intergenic