ID: 1143904567 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:10198592-10198614 |
| Sequence | AGAGCGAGCGGCGACGCCCC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 71 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 65} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143904565_1143904567 | 5 | Left | 1143904565 | 17:10198564-10198586 | CCGGGAAGCAGAGACTCGTTGGC | 0: 1 1: 0 2: 0 3: 16 4: 115 |
||
| Right | 1143904567 | 17:10198592-10198614 | AGAGCGAGCGGCGACGCCCCCGG | 0: 1 1: 0 2: 0 3: 5 4: 65 |
||||
| 1143904563_1143904567 | 10 | Left | 1143904563 | 17:10198559-10198581 | CCGCGCCGGGAAGCAGAGACTCG | 0: 1 1: 0 2: 0 3: 8 4: 76 |
||
| Right | 1143904567 | 17:10198592-10198614 | AGAGCGAGCGGCGACGCCCCCGG | 0: 1 1: 0 2: 0 3: 5 4: 65 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143904567 | Original CRISPR | AGAGCGAGCGGCGACGCCCC CGG | Intergenic | ||