ID: 1143904568

View in Genome Browser
Species Human (GRCh38)
Location 17:10198593-10198615
Sequence GAGCGAGCGGCGACGCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143904565_1143904568 6 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904568 17:10198593-10198615 GAGCGAGCGGCGACGCCCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 85
1143904563_1143904568 11 Left 1143904563 17:10198559-10198581 CCGCGCCGGGAAGCAGAGACTCG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1143904568 17:10198593-10198615 GAGCGAGCGGCGACGCCCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143904568 Original CRISPR GAGCGAGCGGCGACGCCCCC GGG Intergenic