ID: 1143904572

View in Genome Browser
Species Human (GRCh38)
Location 17:10198608-10198630
Sequence CCCCCGGGCCGGGCAGCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143904563_1143904572 26 Left 1143904563 17:10198559-10198581 CCGCGCCGGGAAGCAGAGACTCG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1143904572 17:10198608-10198630 CCCCCGGGCCGGGCAGCTCGCGG 0: 1
1: 0
2: 0
3: 25
4: 219
1143904565_1143904572 21 Left 1143904565 17:10198564-10198586 CCGGGAAGCAGAGACTCGTTGGC 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1143904572 17:10198608-10198630 CCCCCGGGCCGGGCAGCTCGCGG 0: 1
1: 0
2: 0
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143904572 Original CRISPR CCCCCGGGCCGGGCAGCTCG CGG Intergenic