ID: 1143906767

View in Genome Browser
Species Human (GRCh38)
Location 17:10215496-10215518
Sequence CAGTAATTCTGGAGAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143906767_1143906769 -6 Left 1143906767 17:10215496-10215518 CCAGCTGCTCTCCAGAATTACTG No data
Right 1143906769 17:10215513-10215535 TTACTGAAAGCCTGTGAAAAAGG No data
1143906767_1143906772 6 Left 1143906767 17:10215496-10215518 CCAGCTGCTCTCCAGAATTACTG No data
Right 1143906772 17:10215525-10215547 TGTGAAAAAGGTAGATACCTGGG No data
1143906767_1143906773 17 Left 1143906767 17:10215496-10215518 CCAGCTGCTCTCCAGAATTACTG No data
Right 1143906773 17:10215536-10215558 TAGATACCTGGGACCAACTCAGG No data
1143906767_1143906771 5 Left 1143906767 17:10215496-10215518 CCAGCTGCTCTCCAGAATTACTG No data
Right 1143906771 17:10215524-10215546 CTGTGAAAAAGGTAGATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143906767 Original CRISPR CAGTAATTCTGGAGAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr