ID: 1143907962

View in Genome Browser
Species Human (GRCh38)
Location 17:10224963-10224985
Sequence GCAGATGTGCAGAGGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143907962_1143907969 6 Left 1143907962 17:10224963-10224985 CCGCCCACCCTCTGCACATCTGC No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143907962 Original CRISPR GCAGATGTGCAGAGGGTGGG CGG (reversed) Intergenic
No off target data available for this crispr