ID: 1143907969

View in Genome Browser
Species Human (GRCh38)
Location 17:10224992-10225014
Sequence CTGTTGTTGCTCTGACTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143907962_1143907969 6 Left 1143907962 17:10224963-10224985 CCGCCCACCCTCTGCACATCTGC No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907955_1143907969 23 Left 1143907955 17:10224946-10224968 CCCCACCCCCACGTGCACCGCCC No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907961_1143907969 15 Left 1143907961 17:10224954-10224976 CCACGTGCACCGCCCACCCTCTG No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907964_1143907969 2 Left 1143907964 17:10224967-10224989 CCACCCTCTGCACATCTGCACAG No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907957_1143907969 21 Left 1143907957 17:10224948-10224970 CCACCCCCACGTGCACCGCCCAC No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907963_1143907969 3 Left 1143907963 17:10224966-10224988 CCCACCCTCTGCACATCTGCACA No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907960_1143907969 16 Left 1143907960 17:10224953-10224975 CCCACGTGCACCGCCCACCCTCT No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907956_1143907969 22 Left 1143907956 17:10224947-10224969 CCCACCCCCACGTGCACCGCCCA No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907958_1143907969 18 Left 1143907958 17:10224951-10224973 CCCCCACGTGCACCGCCCACCCT No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907966_1143907969 -1 Left 1143907966 17:10224970-10224992 CCCTCTGCACATCTGCACAGGCC No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907959_1143907969 17 Left 1143907959 17:10224952-10224974 CCCCACGTGCACCGCCCACCCTC No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data
1143907967_1143907969 -2 Left 1143907967 17:10224971-10224993 CCTCTGCACATCTGCACAGGCCT No data
Right 1143907969 17:10224992-10225014 CTGTTGTTGCTCTGACTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143907969 Original CRISPR CTGTTGTTGCTCTGACTTCA TGG Intergenic
No off target data available for this crispr