ID: 1143910451

View in Genome Browser
Species Human (GRCh38)
Location 17:10244620-10244642
Sequence TCATCTCCATGCACTGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143910448_1143910451 4 Left 1143910448 17:10244593-10244615 CCCAAATATTTACAAGCACGATT No data
Right 1143910451 17:10244620-10244642 TCATCTCCATGCACTGCATAGGG No data
1143910447_1143910451 29 Left 1143910447 17:10244568-10244590 CCTGTAGGGTAGCAAAGAGTTCT No data
Right 1143910451 17:10244620-10244642 TCATCTCCATGCACTGCATAGGG No data
1143910449_1143910451 3 Left 1143910449 17:10244594-10244616 CCAAATATTTACAAGCACGATTT No data
Right 1143910451 17:10244620-10244642 TCATCTCCATGCACTGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143910451 Original CRISPR TCATCTCCATGCACTGCATA GGG Intergenic